BÁO CÁO KHOA HỌC: "PHÂN LẬP CÁC CHỦNG BACILLUS THURINGIENSIS KURSTAKI Ở VIỆT NAM"

Chia sẻ: phalinh6

Ngày nay các chế phẩm sinh học an toàn cho phòng trừ sâu hại cây trồng và nông sản bảo quản đã được khuyến khích, ứng dụng để thay thế dần các thuốc trừ sâu hoá học, trong đó thuốc trừ sâu vi sinh Bacillus thuringiensis (gọi tắt là Bt) được dùng rộng rãi nhất.

Bạn đang xem 10 trang mẫu tài liệu này, vui lòng download file gốc để xem toàn bộ.

Nội dung Text: BÁO CÁO KHOA HỌC: "PHÂN LẬP CÁC CHỦNG BACILLUS THURINGIENSIS KURSTAKI Ở VIỆT NAM"

PHÂN LẬP CÁC CHỦNG BACILLUS
THURINGIENSIS KURSTAKI Ở VIỆT NAM


Bùi Thị Hương, Đỗ Thị Ngọc Huyền, Nguyễn Tuấn,
Nguyễn Thuỳ Châu
Bộ môn Vi Sinh, Viện Công Nghệ Sau Thu hoạch
Đinh Duy Kháng
Phòng Vi Sinh Phân tử, Viện Công Nghệ Sinh học


Ngày nay các chế phẩm sinh học an toàn cho phòng trừ sâu
hại cây trồng và nông sản bảo quản đã được khuyến khích,
ứng dụng để thay thế dần các thuốc trừ sâu hoá học, trong
đó thuốc trừ sâu vi sinh Bacillus thuringiensis (gọi tắt là
Bt) được dùng rộng rãi nhất. Trong những năm gần đây các
nhà khoa học đã có rất nhiều cố gắng để phân lập vi khuẩn
này từ môi trường của nhiều nước trên thế giới với hy vọng
tìm ra những chủng B. thuringiensis có phổ gây bệnh mới
và khoảng vật chủ rộng hoặc nâng cao hoạt tính các chủng
B.thuringiensis đối với các nhóm côn trùng mới, hay tìm
kiếm nguồn gen từ những chủng phân lập cho các kỹ thuật
di truyền tiếp theo. Với sự phát triển mạnh mẽ của công
nghệ sinh học hiện đại, đặc biệt là công nghệ gen đã mở ra
những tiềm năng hết sức to lớn cho việc phát triển thuốc trừ
sâu sinh học B. thuringiensis. Việc làm giàu thêm bộ sưu
tập các chủng B. thuringiensis phân lập ở Việt Nam và
nguồn gen quý từ những chủng này nhằm tạo ra các chủng
tái tổ hợp mới có phổ diệt sâu rộng hơn đối với một số loài
côn trùng quan trọng là rất cần thiết. Chúng tôi đã tiến hành
phân lập, phân loại các chủng B. thuringiensis có hoạt tính
diệt sâu từ nguồn tự nhiên của Việt Nam, sử dụng một số
kỹ thuật sinh hoá và sinh học phân tử để xác định tính chất
của các chủng B. thuringiensis var. kurstaki phân lập được.


I. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU:


I.1. Thu thập mẫu để phân lập các chủng B. thuringiensis


Tiến hành thu thập 137 mẫu gồm có 55 mẫu đất nông
nghiệp, 56 mẫu lá, 26 mẫu mùn thóc từ các nguồn khác
nhau của một số tỉnh có sinh thái khác nhau ở miền Bắc
Việt nam.
I.2. Phân lập các chủng B. thuringiensis:


Cắt một phần của lá (2-3 cm2) nghiền với 0,5 ml dịch nước
muối. Đối với các mẫu đất và mùn thóc cân 0,5 gam trộn
với 5 ml môi trường T3 lỏng chứa 0,25 M đệm natri acetate
(pH = 6,8) và lắc trong 4 giờ ở 150 vòng/phút, nhiệt độ 30
0
C. Mẫu được xử lý nhiệt ở 800C trong 3 phút. Lấy 0,2 ml
dịch nổi trải trên đĩa petri có môi trường T3 nuôi ở 30 0C
trong 3 ngày. Quan sát hình dạng tinh thể của các chủng B.
thuringiensis phân lập bằng kính hiển vi đối pha Olympus.


I.3. Thử sinh học hoạt tính diệt sâu:


Tiến hành theo phương pháp của S.H.Park [10]: Đối tượng
sâu được thử là sâu tơ (Plutella xylostella), sâu keo
(Spodoptera exiqua) và sâu khoang (Spodoptera litura): lá
bắp cải tươi được cắt thành các khoanh tròn có đường kính
3cm vào hỗn dịch bào tử tinh thể B. thuringiensis có nồng
độ 5x107 bào tử/ml, sau đó đặt vào đĩa petri và cho vào
mỗi đĩa 10 con sâu; mỗi mẫu thử với 30 con sâu. Đối với
sâu bông (Helicoverpa armigera) cũng được tiến hành
tương tự trên lá bông. Hoạt tính diệt sâu ngài gạo (Corrcyra
cephalonia) được đánh giá như sau: bỏ 30 con sâu ngài gạo
vào bình thuỷ tinh 400g gạo đã được nhiễm bào tử và tinh
thể của B. thuringiensis với liều 5x107 bào tử/gam gạo, nuôi
ở 300C với độ ẩm 70-80%.


I.4. Xác định tính chất 10 chủng B. thuringiensis kurstaki
phân lập.


Điện di protein (SDS-PAGE) bào tử và tinh thể của các
chủng B. thuringiensis.
Chủng B. thuringiensis phát triển trên môi trường thạch T3
đã được tạo hỗn dịch trong 5 ml dịch 0,02% Triton X-100.
Ly tâm trong 1 phút. Cặn được hoà tan với 30 l đệm SDS
(1x SDS gel- loading buffer). Các mẫu được đun sôi trong
5 phút, ly tâm ở 8000vòng/phút trong 5 phút, lấy dịch nổi
và chạy điện di trên gel polyacryamide 10% ở 30 mA theo
phương pháp của Sambrook và Maniatis.


I.5. Phát hiện gen cry1Ab, cry1C bằng kỹ thuật PCR.
Phản ứng PCR được tiến hành với tổng thể tích 25l đựng
trong ống Eppendorf bao gồm các thành phần: nước khử
ion 13,6l, dNTP 2,5l, buffer 2,5l, primer 2l, enzim
Tag-polymeraza 0,4l, MgCl2: 2l, ADN 2l ( nồng độ
50ng/l).


Sử dụng cặp mồi TY6(5’-
GGTCGTGGCTATATCCTTCGTGTCACAGC-3’) và
TY14(5’-GAATTGCTTTCATAGGCTCCGTC-3’); TYIC
(5’-CAAC CT CTAT TT G GTGCAGGTTC-3’) và
TYIUNI (5’-
ATCACTGAGTCGCTTCGCATGTTTGACTTT CTC-3’)
theo thứ tự, để nhân bản đoạn ADN đặc hiệu nằm trong gen
cry1Ab và cry1C. Các sản phẩm PCR được phân tích bằng
điện di trên gel agaroza 1%.


II. KẾT QUẢ VÀ THẢO LUẬN:


II.1. Phân lập các chủng B. thuringiensis
Trong số 137 mẫu từ các nguồn khác nhau gồm: 55 mẫu
đất, 56 mẫu lá, 26 mẫu mùn thóc, đã phân lập được 36
chủng B. thuringiensis. Số chủng tinh thể có hình quả trám
là 11(chiếm 31%), số chủng có tinh thể hình khối lập
phương là 10 (chiếm 28%), số chủng tinh thể có hình
vuông và hình chữ nhật là 6 (chiếm 17%), số chủng có tinh
thể không đều đặn là 4 (chiếm 10%) số chủng có tinh thể
hình cầu là 2 (chiếm 5%) và chủng có thể vùi nhỏ là 3
(chiếm 8%). Tần suất B. thuringiensis phân bố cao nhất từ
nguồn đất là 35%, trên mùn thóc là 30% và thấp nhất ở trên
lá cây là 16%.


Chúng tôi chọn 11 chủng có tinh thể hình quả trám trên đây
để phục vụ cho các mục đích nghiên cứu tiếp theo của đề
tài.


II.2. Phân loại các chủng B. thuringiensis có tinh thể
hình quả trám bằng các phản ứng kháng huyết thanh.


Phân loại B. thuringiensis bằng phương pháp định typ
huyết thanh của Ohba và Aizawai [3]. Kết quả trong số 11
chủng B. thuringiensis phân lập có tinh thể hình quả trám
có 10 chủng thuộc loài phụ aizawai và 1 chủng thuộc loài
phụ kurstaki.


II.3. Thử sinh học hoạt tính diệt sâu các chủng B.
thuringiensis phân lập.


Kết quả thử hoạt tính diệt sâu của các chủng B.
thuringiensis có tinh thể hình vuông và hình chữ nhật (dự
đoán thường mang gen cry3 diệt bộ côn trùng cánh cứng)
với ba loài côn trùng cánh cứng, kết quả cho thấy: không
chủng nào trong số các chủng phân lập có tinh thể hình
vuông và hình chữ nhật là có hoạt tính với mọt bột đỏ
(Tribolium castaneum), mọt ngô (Sytophylus zeamays), mọt
gạo (Sytophylus oryzae). Hoạt tính diệt sâu ngài gạo
Corrcyra cephalonica thuộc côn trùng bộ cánh vảy cho
thấy: một trong số 6 chủng có tinh thể hình vuông có hoạt
tính diệt C. cephalonica.


Chúng tôi cho rằng các chủng B. thuringiensis mang gen
cry3 diệt côn trùng bộ cánh cứng phân lập từ Việt Nam là
hiếm. Điều lý thú là chủng B. thuringiensis có tinh thể hình
vuông ký hiệu (H1.1) nhưng lại có hoạt tính diệt sâu C.
cephalonica bộ cánh vảy.


Thử sinh học hoạt tính diệt sâu của 10 chủng B.
thuringiensis var. kurstaki phân lập có tinh thể hình quả
trám đối với một số côn trùng phổ biến thuộc bộ cánh vảy.
Kết quả ở bảng 1 cho thấy: các chủng B. thuringiensis var.
kurstaki phân lập có hiệu quả diệt đặc hiệu cao (100%) trên
các loài sâu ngài gạo, và (90%-100%) đối với sâu tơ, sâu
keo. Hiệu quả diệt giảm hơn đối với sâu khoang (80-90%)
và giảm hơn nữa trên đối tượng sâu bông (50-60%).

Bảng 1: Hoạt tính diệt sâu của các chủng B. thuringiensis
var. kurstaki phân lập đối với sâu tơ (Plutella xylostella),
sâu keo (Spodoptera exiqua), sâu khoang (Spodoptera
litura), sâu bông (Helicoverpa armigera) và sâu ngài gạo
(Corrcyra cephalonica)




Kết quả thử sinh học cho thấy sâu bông là loài rất khó diệt.
Chúng tôi cho rằng cần phải có những nghiên cứu sâu hơn
về mặt sinh học phân tử đối với 6 chủng B. thuringiensis
var. kurstaki có hiệu lực diệt sâu bông nói trên như: phân
tích sự tồn tại các gen cry, tạo dòng và xác định trình tự các
gen cry mã hoá protein tinh thể độc tố có hiệu lực diệt sâu
bông, từ đó tạo ra chủng B. thuringiensis tái tổ hợp mới có
hiệu lực diệt sâu bông là rất cần thiết và có ý nghĩa thực
tiễn cho công nghệ sản xuất thuốc trừ sâu B. thuringiensis
diệt trừ sâu bông H. armigera tại Việt nam.


Kết quả thử sinh học của các chủng B. thuringiensis có tinh
thể hình quả trám trên đây là những số liệu có giá trị trong
việc tìm kiếm các chủng B. thuringiensis có hoạt tính diệt
sâu cao đối với các loài sâu cánh vảy ngoài đồng như sâu
tơ, sâu keo, sâu khoang và sâu ngài gạo hại nông sản trong
kho. Những kết quả này góp phần bổ sung vào bộ sưu tập
chủng giống phục vụ cho công nghệ sản xuất thuốc trừ sâu
vi sinh B. thuringiensis.


II.4. Phân tích protein tinh thể và bào tử của các chủng
B. thuringiensis var. kurstaki phân lập bằng phương
pháp điện di protein.




Hình 1. Điện di đồ protein trên gel 10% polyacrylamid
(SDS-PAGE) của các chủng
B. thuringiensis var. kurstaki phân lập và chủng chuẩn.
Chú thích: Kênh 1: Marker có MW từ trên xuống: (97,4,
66, 42,7; 31, 21,5; 14,4 kDa); Kênh (2-12): lần lượt theo
thứ tự : chủng chuẩn B. thuringiensis var. kurstaki A1 và
các chủng B. thuringiensis var. kurstaki phân lập (S28;
T58; H3; H15; S50;H8; 29S; H13; H22; S47).


Kết quả cho thấy cả 10 chủng B. thuringiensis var. kurstaki
phân lập đều có thành phần protein với trọng lượng phân tử
(MW) vào khoảng 130-138kDa và 70-71 kDa giống với
chủng B. thuringiensis var. kurstaki chuẩn. Ngoài ra chúng
còn có các protein khác nhau, trên cơ sở này có thể chia
thành các nhóm như sau: Nhóm 1 gồm 4 chủng B.
thuringiensis var. kurstaki phân lập có khuôn mẫu protein
giống nhau và gần giống với chủng B. thuringiensis var.
kurstaki chuẩn gồm: T58, H15, H8, H22 ở các kênh (4, 6,
8, 11), chúng đều có thành phần protein với các MW: 130,
71, 55 và 28kDa. Nhóm 2 gồm các chủng S28, H3, S50, ở
các kênh (3, 5, 7) có khuôn mẫu protein giống nhau, chúng
có các băng protein với các MW là: 130, 71, 55 kDa. Nhóm
3 gồm hai chủng 29S, 47S, ở các kênh (9, 12) có khuôn
mẫu protein giống nhau và có các băng protein với MW là:
130, 71kDa. Nhóm 4 chỉ có riêng chủng B. thuringiensis
H13 (kênh 10) có khuôn mẫu protein gồm các băng với
MW : 130, 70, 28 kDa.


II.5. Xác định sự tồn tại gen cry1Ab và cry1C của 10
chủng B. thuringiensis var. kurstaki phân lập


Tiến hành sử dụng cặp mồi: TY6 và TY14 để nhân bản
đoạn ADN đặc hiệu nằm trong gen cry1Ab của 10 chủng B.
thuringiensis var. kurstaki phân lập và hai chủng chuẩn B.
thuringiensis var. kurstaki A1 và B. thuringiensis var.
aizawai M1.


Hình 3. Điện di đồ sản phẩm PCR đặc hiệu của gen cry1Ab
của các chủng B. thuringiensis phân lập và chủng B.
thuringiensis chuẩn.


Chú thích: Kênh (1-2): chủng chuẩn B. thuringiensi var.
aizawai M1, B. thuringiensis var. kurstaki A1; Kênh 3: chỉ
thị phân tử (ADN  cắt bằng Hind III và EcoR I) từ trên
xuống (21226, 5148, 4973, 4277, 3530, 2027, 1904, 1584,
1330, 983, 831, 564 bp); kênh(4-13) các chủng phân lập
theo thứ tự (47S, 50S, H22, H15, 29S, T58, H8, H3, 28S,
H13 ).


Kết quả ở hình 3 cho thấy: sản phẩm PCR thu được rất đặc
hiệu, không có sản phẩm phụ. Ở cả 10 chủng Bt. kurstaki
phân lập có duy nhất một sản phẩm PCR đặc hiệu vào
khoảng 238 bp theo lý thuyết giống với sản phẩm PCR của
chủng Bt. kurstaki chuẩn (kênh 2, 4-13). Riêng chủng
chuẩn Bt. aizawai M1 không có sản phẩm PCR. Như vậy
10 chủng Bt. kurstaki phân lập đã mang gen cry1Ab, chủng
chuẩn Bt. var aizawai H1 không mang gen này.


Một điều rất lý thú là chủng B. thuringiensis var. kurstaki
28S mặc dù mang gen cry1Ab, nhưng lại không có hiệu lực
diệt sâu tơ và sâu keo. Theo Kalman và cs [9] thì chủng B.
thuringiensis mang gen cry1Ab có hoạt lực diệt sâu tơ rất
đặc hiệu. Chúng tôi cho rằng chủng B. thuringiensis 28S
mang gen cry1Ab có lẽ không nằm trên plasmit mà nằm
trên nhiễm sắc thể ở dạng bất hoạt và không được biểu
hiện. Chính vì thế mà chủng B. thuringiensis 28S không có
hoạt lực diệt sâu tơ.


Bằng cách tiến hành tương tự, chúng tôi sử dụng cặp mồi
TYIC và TYIUNI để nhân bản đoạn ADN đặc hiệu nằm
trong gen cry1C của 10 chủng B. thuringiensis var. kurstaki
phân lập và các chủng chuẩn B. thuringiensis var. aizawai
M1, B. thuringiensis var. kurstaki A1 và B. thuringiensis
var. kurstaki T1. Kết quả được thể hiện ở hình 4.




Hình 4. Điện di đồ sản phẩm PCR đặc hiệu của gen cry1C
của các chủng B. thuringiensis var. kurstaki phân lập và
chủng B. thuringiensis chuẩn
Chú thích: Kênh 1-3: Chủng chuẩn B. thuringiensis var.
aizawai M1, B. thuringiensis var. kurstaki A1, B.
thuringiensis var. kurstaki T1; Kênh 4: Chỉ thị phân tử
(ADN  cắt bằng Hind III và EcoR I) từ trên xuống (21226,
5148, 4973, 4277, 3530, 2027, 1904, 1584, 1330, 983, 831,
564 bp). Kênh 5-14: các chủng B. thuringiensis var.
kurstaki phân lập theo thứ tự (47S, 50S, H22, H15, 29S,
T58, H8, H3, 28S, H13 ).




Kết quả điện di sản phẩm PCR ở hình 4 cho thấy: Chỉ riêng
chủng chuẩn B. thuringiensis var. azaiwai M1 có duy nhất
1 sản phẩm PCR rất đặc hiệu vào khoảng 285bp là kích
thước đoạn ADN đặc hiệu của gen cry1C. Cả 2 chủng B.
thuringiensis var. kurstaki chuẩn (kênh 2, 3) và 10 chủng
B. thuringiensis var. kurstaki phân lập (từ kênh 5-14) đều
không có sản phẩm PCR đặc hiệu tương ứng. Như vậy cả
hai chủng B. thuringiensis var. kurstaki chuẩn và các chủng
B. thuringiensis var. kurstaki phân lập đã không mang gen
cry1C.
Kết quả điện di sản phẩm PCR ở hình 3 và 4 cho thấy: 10
chủng B. thuringiensis var. kurstaki phân lập ở Việt Nam
đã mang gen cry1Ab nhưng không mang gen cry1C


III. KẾT LUẬN


Đã phân lập được 36 chủng B. thuringiensis trong đó 11
chủng có tinh thể hình quả trám, 6 chủng có tinh thể hình
vuông và hình chữ nhật, 10 chủng có tinh thể hình khối lập
phương, 4 chủng có tinh thể không đều đặn, 2 chủng có
tinh thể hình cầu, 3 chủng có dạng thể vùi nhỏ.
Trên cơ sở khuôn mẫu protein thu được bằng điện di trên
gel SDS-polyacrylamid của các chủng B. thuringiensis
phân lập, có thể chia 10 chủng B. thuringiensis var.
kurstaki ra thành 4 nhóm.


Đã thử nghiệm hoạt tính diệt sâu của 10 chủng B.
thuringiensis var. kurstaki phân lập có tinh thể hình quả
trám, trong đó 9/10 chủng có hoạt tính diệt 90 - 100% đối
với sâu tơ P. xylostella và sâu keo S. exiqua; 7/10 chủng có
hiệu quả diệt 80-90% đối với sâu khoang S. litura; 6/10
chủng có hoạt tính diệt 50-60% đối với sâu bông H.
armigera. 10/10 chủng có hiệu quả diệt 100% đối với sâu
ngài gạo C. cephalonica.


10 chủng B. thuringiensis var. kurstaki phân lập ở Việt nam
đều mang gen cry1Ab, không mang gen cry1C


TÀI LIỆU THAM KHẢO


1. Alecxander. B and Priest, F.G. (1990), “Numerical
classification and identification of Bacillus Sphaericus
including some strains pathogenic for mosquito larvae”,
Microbial. 136: p.367-376.
2. Bajac.D & E. Frachon, (1990). “Classification of
Bacillus thuringiensis strains” Enthomophaga 35(2): p.
233-240.
3. Bacillus thuringiensis an environment
biopesticides.(1986), Theory & Practice.
4. Ballester V; F. Granero, R.A.de Maagd, D. Bosch, J.L.
Mensua, J. Ferre. (1999), “Role of Bacillus thuringiensis
toxin domains in toxicity and receptor binding in the
Diamondback moth”, Applied and Environmental
Microbiology, p.1900-1903.
5. Carozzi, N. B., V. C. Kramer, G. W. Warren, S. Evola,
and M. G. Koziel. (1991), “Prediction of Insecticidal
Activity of Bacillus thuringiensis Strains by Polymerase
Reaction Product Profiles”. Applied and Environmental
Microbiology, p.3057-3061.
6. Ceron, J., A. Ortiz., R. Quintero, L. Guereca, and A.
Bravo. (1995), “Specific PCR Primers Directed To Identify
cryI and cryIII Genes within a Bacillus thuringiensis Strain
Collection”. Applied and Environmental Microbiology, p.
3826-3821.
7. Chau, N.T; L.H.Hieu, T.T. Binh, N. T. Lam,
N.M.Thanh, L. V. Truong, N.A Tuan. (1996), “Study on
the Bacillus thuringiensis as insecticide to control stored-
grain insects in Vietnam”, Proceeding of the second Pacific
Rim Conference on Biotechnology of Bacillus thuringiensis
and its impact to the environment, November 4-8, p. 379-
392.
8. Chau N. T; B. T. Huong, T. V. Tuan, D. T. N. Huyen, N.
D. Tien, N. N. Huyen, N. H. Ha. (2001), “Production
technology of Bacillus thuringiensis bioinsecticide in the
fermentation system 1500l and application to control
insects in vegetable, fruit and stored products”. A
manuscript sumitted to the 4 the Pacific Rim Conference on
the Biotechnology of Bacillus thuringiensis in Canberra,
Australia, 11-15 November, 2001.
9. Kalman, S., K. L Kiehne, K. J. Libs, ADN T.
Yamatomo. (1993), “Cloning of a Novel cryIC-Type Gene
from a Strain of Bacillus thuringiensis subsp–galleriae”.
Applied ADN Environmental Microbiology, p.1131-1137.
10. Maniatis, T; E.F. Fritisch, and Sambrook. (1989),
Molecular cloning: a laboratory manual. Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y.
11. Park S. H., B. T. Koo, B. S. Shin, S. K. Choi, Y. M.
Jeong, J. G Pan, and J. I. Kim. (1997), “Characterization of
1925 Bacillus thuringiensis isolates from plants in Korea”.
Kor. J. Appl. Microbiol. Biotechnol. Vol. 25, No. 2, p.159-
165.
SUMMARY


ISOLATION AND CHARACTERIZATION SOME
BACILLUS THURINGIENSIS KURSTAKI STRAINS
IN VIET NAM


Bui Thi Huong1, Đo Thi Ngoc Huyen1, Nguyen Tuan1,
Đinh Duy Khang2, Nguyen Thuy Chau1


1. Microbiology Department, Post Harvest Technology
Institute.
2. Molecular Microbiology Department, Institue of
BioTechnology,
National Centre for Natural Science and Technology.


We collected 56 leaf samples and 55 soil samples and 26
paddy humus samples from many provinces in Northern
Vietnam. Total of 36 Bacillus thuringiensis isolates were
obtained and characterized. The microscopic observation
showed that 11 isolates having bipyramidal shape crystals,
10 isolates having square shape crystals, 6 isolates of flat
rectangular and square crystals, 2 isolates of spherical
shape crystals and other having small inclusions. The
insecticidal activities of the spore-crystal mixture of
isolates were tested against Lepidopteran insects including:
Corrcyra cephalonica, Plutella xylostella, Spodoptera
exiqua, Spodoptera litura and Helicoverpa armigera; and
Coleopteran insects including Tribolium castaneum,
Sytophylus zeamays, and Sytophylus oryzae. The results
showed that: eleven isolates having bipyramidal shape
crystals were highly toxic to Lepidopteran insects: They
gave 100% mortality to Corrcyra cephalonica, 90-100%
mortality to Plutella xylostella and Spodoptera exiqua, 80-
90% mortality to Spodoptera litura and 50-60% mortality
to Helicoverpa armigera. They have no insecticidal
activities to above Coleopteran insects. The isolates having
square shape crystals, flat rectangular crystals, and small
inclusions have no insecticidal activities to both mentioned
Lepidopteran insects and Coleopteran insects.
Serologically of 11 mentioned isolates having bipyramidal
shape crystals, 10 isolates belong to the serovar kurstaki (H
3abc) and one belong to the serovar aizawai (H7). SDS-
PAGE of parasporal inclusions of the ten kurstaki isolates
showed two core fragments, 130 kDa and 70 kDa, and
several other minor proteins. Ten B. thuringiensis kurstaki
isolates were screened for cry1Ab and cry1C genes by PCR
method. Total DNA of these B. thuringiensis strains were
isolated then analyzed by electrophoresis on 1% agaroza
gel. The result showed that total DNA isolated was not
broken, it could be used as DNA template for the PCR.
Oligonucleotit primer pairs of TY6 and TY14, TYIC and
TYIUNI respectively were used to amplified the specific
DNA fragments of cry1Ab gene as well as of cry1C gene
by PCR. The PCR conditions were: denaturation at 940C
for 3 min, followed by 30 amplification cycles (940C, 50
sec; 600C, 50 sec; 720C, 1min and 20sec) and extension at
720C for 8 min The content of 5l of PCR products were
analyzed by electrophoresis on 1% agaroza gel. The result
showed that all ten isolated B. thuringiensis var. kurstaki
strains produced only one PCR product of about 236 bp.
This result indicated that all of them harboured cry1Ab
gene, but no cry1C gene. Interestingly, B. thuringiensis var.
kurstaki 28S strain inspire of habouring cry1Ab gene but it
has no insecticidal activities to Plutella xylostella and
Spodoptera exiqua. We supposed that this strain contain
“silent” cry1C crystal toxin gene which is carried on the
genome and it was not expressed. Because of this, we are
interested in screening B. thuringiensis strains at the
molecular level for their gene content.


Người thẩm định nội dung khoa học: TS. Lê Quang Huấn.

Top Download Báo Cáo Khoa Học

Xem thêm »

Đề thi vào lớp 10 môn Toán |  Đáp án đề thi tốt nghiệp |  Đề thi Đại học |  Đề thi thử đại học môn Hóa |  Mẫu đơn xin việc |  Bài tiểu luận mẫu |  Ôn thi cao học 2014 |  Nghiên cứu khoa học |  Lập kế hoạch kinh doanh |  Bảng cân đối kế toán |  Đề thi chứng chỉ Tin học |  Tư tưởng Hồ Chí Minh |  Đề thi chứng chỉ Tiếng anh
Theo dõi chúng tôi
Đồng bộ tài khoản