BÁO CÁO KHOA HỌC: "PHÂN LẬP CÁC CHỦNG BACILLUS THURINGIENSIS KURSTAKI Ở VIỆT NAM"

Chia sẻ: Linh Ha | Ngày: | Loại File: PDF | Số trang:23

0
91
lượt xem
35
download

BÁO CÁO KHOA HỌC: "PHÂN LẬP CÁC CHỦNG BACILLUS THURINGIENSIS KURSTAKI Ở VIỆT NAM"

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Ngày nay các chế phẩm sinh học an toàn cho phòng trừ sâu hại cây trồng và nông sản bảo quản đã được khuyến khích, ứng dụng để thay thế dần các thuốc trừ sâu hoá học, trong đó thuốc trừ sâu vi sinh Bacillus thuringiensis (gọi tắt là Bt) được dùng rộng rãi nhất.

Chủ đề:
Lưu

Nội dung Text: BÁO CÁO KHOA HỌC: "PHÂN LẬP CÁC CHỦNG BACILLUS THURINGIENSIS KURSTAKI Ở VIỆT NAM"

  1. PHÂN LẬP CÁC CHỦNG BACILLUS THURINGIENSIS KURSTAKI Ở VIỆT NAM Bùi Thị Hương, Đỗ Thị Ngọc Huyền, Nguyễn Tuấn, Nguyễn Thuỳ Châu Bộ môn Vi Sinh, Viện Công Nghệ Sau Thu hoạch Đinh Duy Kháng Phòng Vi Sinh Phân tử, Viện Công Nghệ Sinh học Ngày nay các chế phẩm sinh học an toàn cho phòng trừ sâu hại cây trồng và nông sản bảo quản đã được khuyến khích, ứng dụng để thay thế dần các thuốc trừ sâu hoá học, trong đó thuốc trừ sâu vi sinh Bacillus thuringiensis (gọi tắt là Bt) được dùng rộng rãi nhất. Trong những năm gần đây các nhà khoa học đã có rất nhiều cố gắng để phân lập vi khuẩn này từ môi trường của nhiều nước trên thế giới với hy vọng tìm ra những chủng B. thuringiensis có phổ gây bệnh mới và khoảng vật chủ rộng hoặc nâng cao hoạt tính các chủng B.thuringiensis đối với các nhóm côn trùng mới, hay tìm kiếm nguồn gen từ những chủng phân lập cho các kỹ thuật
  2. di truyền tiếp theo. Với sự phát triển mạnh mẽ của công nghệ sinh học hiện đại, đặc biệt là công nghệ gen đã mở ra những tiềm năng hết sức to lớn cho việc phát triển thuốc trừ sâu sinh học B. thuringiensis. Việc làm giàu thêm bộ sưu tập các chủng B. thuringiensis phân lập ở Việt Nam và nguồn gen quý từ những chủng này nhằm tạo ra các chủng tái tổ hợp mới có phổ diệt sâu rộng hơn đối với một số loài côn trùng quan trọng là rất cần thiết. Chúng tôi đã tiến hành phân lập, phân loại các chủng B. thuringiensis có hoạt tính diệt sâu từ nguồn tự nhiên của Việt Nam, sử dụng một số kỹ thuật sinh hoá và sinh học phân tử để xác định tính chất của các chủng B. thuringiensis var. kurstaki phân lập được. I. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU: I.1. Thu thập mẫu để phân lập các chủng B. thuringiensis Tiến hành thu thập 137 mẫu gồm có 55 mẫu đất nông nghiệp, 56 mẫu lá, 26 mẫu mùn thóc từ các nguồn khác nhau của một số tỉnh có sinh thái khác nhau ở miền Bắc Việt nam.
  3. I.2. Phân lập các chủng B. thuringiensis: Cắt một phần của lá (2-3 cm2) nghiền với 0,5 ml dịch nước muối. Đối với các mẫu đất và mùn thóc cân 0,5 gam trộn với 5 ml môi trường T3 lỏng chứa 0,25 M đệm natri acetate (pH = 6,8) và lắc trong 4 giờ ở 150 vòng/phút, nhiệt độ 30 0 C. Mẫu được xử lý nhiệt ở 800C trong 3 phút. Lấy 0,2 ml dịch nổi trải trên đĩa petri có môi trường T3 nuôi ở 30 0C trong 3 ngày. Quan sát hình dạng tinh thể của các chủng B. thuringiensis phân lập bằng kính hiển vi đối pha Olympus. I.3. Thử sinh học hoạt tính diệt sâu: Tiến hành theo phương pháp của S.H.Park [10]: Đối tượng sâu được thử là sâu tơ (Plutella xylostella), sâu keo (Spodoptera exiqua) và sâu khoang (Spodoptera litura): lá bắp cải tươi được cắt thành các khoanh tròn có đường kính 3cm vào hỗn dịch bào tử tinh thể B. thuringiensis có nồng độ 5x107 bào tử/ml, sau đó đặt vào đĩa petri và cho vào mỗi đĩa 10 con sâu; mỗi mẫu thử với 30 con sâu. Đối với
  4. sâu bông (Helicoverpa armigera) cũng được tiến hành tương tự trên lá bông. Hoạt tính diệt sâu ngài gạo (Corrcyra cephalonia) được đánh giá như sau: bỏ 30 con sâu ngài gạo vào bình thuỷ tinh 400g gạo đã được nhiễm bào tử và tinh thể của B. thuringiensis với liều 5x107 bào tử/gam gạo, nuôi ở 300C với độ ẩm 70-80%. I.4. Xác định tính chất 10 chủng B. thuringiensis kurstaki phân lập. Điện di protein (SDS-PAGE) bào tử và tinh thể của các chủng B. thuringiensis. Chủng B. thuringiensis phát triển trên môi trường thạch T3 đã được tạo hỗn dịch trong 5 ml dịch 0,02% Triton X-100. Ly tâm trong 1 phút. Cặn được hoà tan với 30 l đệm SDS (1x SDS gel- loading buffer). Các mẫu được đun sôi trong 5 phút, ly tâm ở 8000vòng/phút trong 5 phút, lấy dịch nổi và chạy điện di trên gel polyacryamide 10% ở 30 mA theo phương pháp của Sambrook và Maniatis. I.5. Phát hiện gen cry1Ab, cry1C bằng kỹ thuật PCR.
  5. Phản ứng PCR được tiến hành với tổng thể tích 25l đựng trong ống Eppendorf bao gồm các thành phần: nước khử ion 13,6l, dNTP 2,5l, buffer 2,5l, primer 2l, enzim Tag-polymeraza 0,4l, MgCl2: 2l, ADN 2l ( nồng độ 50ng/l). Sử dụng cặp mồi TY6(5’- GGTCGTGGCTATATCCTTCGTGTCACAGC-3’) và TY14(5’-GAATTGCTTTCATAGGCTCCGTC-3’); TYIC (5’-CAAC CT CTAT TT G GTGCAGGTTC-3’) và TYIUNI (5’- ATCACTGAGTCGCTTCGCATGTTTGACTTT CTC-3’) theo thứ tự, để nhân bản đoạn ADN đặc hiệu nằm trong gen cry1Ab và cry1C. Các sản phẩm PCR được phân tích bằng điện di trên gel agaroza 1%. II. KẾT QUẢ VÀ THẢO LUẬN: II.1. Phân lập các chủng B. thuringiensis
  6. Trong số 137 mẫu từ các nguồn khác nhau gồm: 55 mẫu đất, 56 mẫu lá, 26 mẫu mùn thóc, đã phân lập được 36 chủng B. thuringiensis. Số chủng tinh thể có hình quả trám là 11(chiếm 31%), số chủng có tinh thể hình khối lập phương là 10 (chiếm 28%), số chủng tinh thể có hình vuông và hình chữ nhật là 6 (chiếm 17%), số chủng có tinh thể không đều đặn là 4 (chiếm 10%) số chủng có tinh thể hình cầu là 2 (chiếm 5%) và chủng có thể vùi nhỏ là 3 (chiếm 8%). Tần suất B. thuringiensis phân bố cao nhất từ nguồn đất là 35%, trên mùn thóc là 30% và thấp nhất ở trên lá cây là 16%. Chúng tôi chọn 11 chủng có tinh thể hình quả trám trên đây để phục vụ cho các mục đích nghiên cứu tiếp theo của đề tài. II.2. Phân loại các chủng B. thuringiensis có tinh thể hình quả trám bằng các phản ứng kháng huyết thanh. Phân loại B. thuringiensis bằng phương pháp định typ
  7. huyết thanh của Ohba và Aizawai [3]. Kết quả trong số 11 chủng B. thuringiensis phân lập có tinh thể hình quả trám có 10 chủng thuộc loài phụ aizawai và 1 chủng thuộc loài phụ kurstaki. II.3. Thử sinh học hoạt tính diệt sâu các chủng B. thuringiensis phân lập. Kết quả thử hoạt tính diệt sâu của các chủng B. thuringiensis có tinh thể hình vuông và hình chữ nhật (dự đoán thường mang gen cry3 diệt bộ côn trùng cánh cứng) với ba loài côn trùng cánh cứng, kết quả cho thấy: không chủng nào trong số các chủng phân lập có tinh thể hình vuông và hình chữ nhật là có hoạt tính với mọt bột đỏ (Tribolium castaneum), mọt ngô (Sytophylus zeamays), mọt gạo (Sytophylus oryzae). Hoạt tính diệt sâu ngài gạo Corrcyra cephalonica thuộc côn trùng bộ cánh vảy cho thấy: một trong số 6 chủng có tinh thể hình vuông có hoạt tính diệt C. cephalonica. Chúng tôi cho rằng các chủng B. thuringiensis mang gen
  8. cry3 diệt côn trùng bộ cánh cứng phân lập từ Việt Nam là hiếm. Điều lý thú là chủng B. thuringiensis có tinh thể hình vuông ký hiệu (H1.1) nhưng lại có hoạt tính diệt sâu C. cephalonica bộ cánh vảy. Thử sinh học hoạt tính diệt sâu của 10 chủng B. thuringiensis var. kurstaki phân lập có tinh thể hình quả trám đối với một số côn trùng phổ biến thuộc bộ cánh vảy. Kết quả ở bảng 1 cho thấy: các chủng B. thuringiensis var. kurstaki phân lập có hiệu quả diệt đặc hiệu cao (100%) trên các loài sâu ngài gạo, và (90%-100%) đối với sâu tơ, sâu keo. Hiệu quả diệt giảm hơn đối với sâu khoang (80-90%) và giảm hơn nữa trên đối tượng sâu bông (50-60%). Bảng 1: Hoạt tính diệt sâu của các chủng B. thuringiensis var. kurstaki phân lập đối với sâu tơ (Plutella xylostella), sâu keo (Spodoptera exiqua), sâu khoang (Spodoptera litura), sâu bông (Helicoverpa armigera) và sâu ngài gạo
  9. (Corrcyra cephalonica) Kết quả thử sinh học cho thấy sâu bông là loài rất khó diệt. Chúng tôi cho rằng cần phải có những nghiên cứu sâu hơn về mặt sinh học phân tử đối với 6 chủng B. thuringiensis var. kurstaki có hiệu lực diệt sâu bông nói trên như: phân tích sự tồn tại các gen cry, tạo dòng và xác định trình tự các gen cry mã hoá protein tinh thể độc tố có hiệu lực diệt sâu bông, từ đó tạo ra chủng B. thuringiensis tái tổ hợp mới có hiệu lực diệt sâu bông là rất cần thiết và có ý nghĩa thực tiễn cho công nghệ sản xuất thuốc trừ sâu B. thuringiensis diệt trừ sâu bông H. armigera tại Việt nam. Kết quả thử sinh học của các chủng B. thuringiensis có tinh thể hình quả trám trên đây là những số liệu có giá trị trong
  10. việc tìm kiếm các chủng B. thuringiensis có hoạt tính diệt sâu cao đối với các loài sâu cánh vảy ngoài đồng như sâu tơ, sâu keo, sâu khoang và sâu ngài gạo hại nông sản trong kho. Những kết quả này góp phần bổ sung vào bộ sưu tập chủng giống phục vụ cho công nghệ sản xuất thuốc trừ sâu vi sinh B. thuringiensis. II.4. Phân tích protein tinh thể và bào tử của các chủng B. thuringiensis var. kurstaki phân lập bằng phương pháp điện di protein. Hình 1. Điện di đồ protein trên gel 10% polyacrylamid (SDS-PAGE) của các chủng B. thuringiensis var. kurstaki phân lập và chủng chuẩn.
  11. Chú thích: Kênh 1: Marker có MW từ trên xuống: (97,4, 66, 42,7; 31, 21,5; 14,4 kDa); Kênh (2-12): lần lượt theo thứ tự : chủng chuẩn B. thuringiensis var. kurstaki A1 và các chủng B. thuringiensis var. kurstaki phân lập (S28; T58; H3; H15; S50;H8; 29S; H13; H22; S47). Kết quả cho thấy cả 10 chủng B. thuringiensis var. kurstaki phân lập đều có thành phần protein với trọng lượng phân tử (MW) vào khoảng 130-138kDa và 70-71 kDa giống với chủng B. thuringiensis var. kurstaki chuẩn. Ngoài ra chúng còn có các protein khác nhau, trên cơ sở này có thể chia thành các nhóm như sau: Nhóm 1 gồm 4 chủng B. thuringiensis var. kurstaki phân lập có khuôn mẫu protein giống nhau và gần giống với chủng B. thuringiensis var. kurstaki chuẩn gồm: T58, H15, H8, H22 ở các kênh (4, 6, 8, 11), chúng đều có thành phần protein với các MW: 130, 71, 55 và 28kDa. Nhóm 2 gồm các chủng S28, H3, S50, ở các kênh (3, 5, 7) có khuôn mẫu protein giống nhau, chúng có các băng protein với các MW là: 130, 71, 55 kDa. Nhóm 3 gồm hai chủng 29S, 47S, ở các kênh (9, 12) có khuôn
  12. mẫu protein giống nhau và có các băng protein với MW là: 130, 71kDa. Nhóm 4 chỉ có riêng chủng B. thuringiensis H13 (kênh 10) có khuôn mẫu protein gồm các băng với MW : 130, 70, 28 kDa. II.5. Xác định sự tồn tại gen cry1Ab và cry1C của 10 chủng B. thuringiensis var. kurstaki phân lập Tiến hành sử dụng cặp mồi: TY6 và TY14 để nhân bản đoạn ADN đặc hiệu nằm trong gen cry1Ab của 10 chủng B. thuringiensis var. kurstaki phân lập và hai chủng chuẩn B. thuringiensis var. kurstaki A1 và B. thuringiensis var. aizawai M1. Hình 3. Điện di đồ sản phẩm PCR đặc hiệu của gen cry1Ab của các chủng B. thuringiensis phân lập và chủng B. thuringiensis chuẩn. Chú thích: Kênh (1-2): chủng chuẩn B. thuringiensi var. aizawai M1, B. thuringiensis var. kurstaki A1; Kênh 3: chỉ
  13. thị phân tử (ADN  cắt bằng Hind III và EcoR I) từ trên xuống (21226, 5148, 4973, 4277, 3530, 2027, 1904, 1584, 1330, 983, 831, 564 bp); kênh(4-13) các chủng phân lập theo thứ tự (47S, 50S, H22, H15, 29S, T58, H8, H3, 28S, H13 ). Kết quả ở hình 3 cho thấy: sản phẩm PCR thu được rất đặc hiệu, không có sản phẩm phụ. Ở cả 10 chủng Bt. kurstaki phân lập có duy nhất một sản phẩm PCR đặc hiệu vào khoảng 238 bp theo lý thuyết giống với sản phẩm PCR của chủng Bt. kurstaki chuẩn (kênh 2, 4-13). Riêng chủng chuẩn Bt. aizawai M1 không có sản phẩm PCR. Như vậy 10 chủng Bt. kurstaki phân lập đã mang gen cry1Ab, chủng chuẩn Bt. var aizawai H1 không mang gen này. Một điều rất lý thú là chủng B. thuringiensis var. kurstaki 28S mặc dù mang gen cry1Ab, nhưng lại không có hiệu lực diệt sâu tơ và sâu keo. Theo Kalman và cs [9] thì chủng B. thuringiensis mang gen cry1Ab có hoạt lực diệt sâu tơ rất đặc hiệu. Chúng tôi cho rằng chủng B. thuringiensis 28S mang gen cry1Ab có lẽ không nằm trên plasmit mà nằm
  14. trên nhiễm sắc thể ở dạng bất hoạt và không được biểu hiện. Chính vì thế mà chủng B. thuringiensis 28S không có hoạt lực diệt sâu tơ. Bằng cách tiến hành tương tự, chúng tôi sử dụng cặp mồi TYIC và TYIUNI để nhân bản đoạn ADN đặc hiệu nằm trong gen cry1C của 10 chủng B. thuringiensis var. kurstaki phân lập và các chủng chuẩn B. thuringiensis var. aizawai M1, B. thuringiensis var. kurstaki A1 và B. thuringiensis var. kurstaki T1. Kết quả được thể hiện ở hình 4. Hình 4. Điện di đồ sản phẩm PCR đặc hiệu của gen cry1C của các chủng B. thuringiensis var. kurstaki phân lập và chủng B. thuringiensis chuẩn
  15. Chú thích: Kênh 1-3: Chủng chuẩn B. thuringiensis var. aizawai M1, B. thuringiensis var. kurstaki A1, B. thuringiensis var. kurstaki T1; Kênh 4: Chỉ thị phân tử (ADN  cắt bằng Hind III và EcoR I) từ trên xuống (21226, 5148, 4973, 4277, 3530, 2027, 1904, 1584, 1330, 983, 831, 564 bp). Kênh 5-14: các chủng B. thuringiensis var. kurstaki phân lập theo thứ tự (47S, 50S, H22, H15, 29S, T58, H8, H3, 28S, H13 ). Kết quả điện di sản phẩm PCR ở hình 4 cho thấy: Chỉ riêng chủng chuẩn B. thuringiensis var. azaiwai M1 có duy nhất 1 sản phẩm PCR rất đặc hiệu vào khoảng 285bp là kích thước đoạn ADN đặc hiệu của gen cry1C. Cả 2 chủng B. thuringiensis var. kurstaki chuẩn (kênh 2, 3) và 10 chủng B. thuringiensis var. kurstaki phân lập (từ kênh 5-14) đều không có sản phẩm PCR đặc hiệu tương ứng. Như vậy cả hai chủng B. thuringiensis var. kurstaki chuẩn và các chủng B. thuringiensis var. kurstaki phân lập đã không mang gen cry1C.
  16. Kết quả điện di sản phẩm PCR ở hình 3 và 4 cho thấy: 10 chủng B. thuringiensis var. kurstaki phân lập ở Việt Nam đã mang gen cry1Ab nhưng không mang gen cry1C III. KẾT LUẬN Đã phân lập được 36 chủng B. thuringiensis trong đó 11 chủng có tinh thể hình quả trám, 6 chủng có tinh thể hình vuông và hình chữ nhật, 10 chủng có tinh thể hình khối lập phương, 4 chủng có tinh thể không đều đặn, 2 chủng có tinh thể hình cầu, 3 chủng có dạng thể vùi nhỏ. Trên cơ sở khuôn mẫu protein thu được bằng điện di trên gel SDS-polyacrylamid của các chủng B. thuringiensis phân lập, có thể chia 10 chủng B. thuringiensis var. kurstaki ra thành 4 nhóm. Đã thử nghiệm hoạt tính diệt sâu của 10 chủng B. thuringiensis var. kurstaki phân lập có tinh thể hình quả trám, trong đó 9/10 chủng có hoạt tính diệt 90 - 100% đối với sâu tơ P. xylostella và sâu keo S. exiqua; 7/10 chủng có
  17. hiệu quả diệt 80-90% đối với sâu khoang S. litura; 6/10 chủng có hoạt tính diệt 50-60% đối với sâu bông H. armigera. 10/10 chủng có hiệu quả diệt 100% đối với sâu ngài gạo C. cephalonica. 10 chủng B. thuringiensis var. kurstaki phân lập ở Việt nam đều mang gen cry1Ab, không mang gen cry1C TÀI LIỆU THAM KHẢO 1. Alecxander. B and Priest, F.G. (1990), “Numerical classification and identification of Bacillus Sphaericus including some strains pathogenic for mosquito larvae”, Microbial. 136: p.367-376. 2. Bajac.D & E. Frachon, (1990). “Classification of Bacillus thuringiensis strains” Enthomophaga 35(2): p. 233-240. 3. Bacillus thuringiensis an environment biopesticides.(1986), Theory & Practice. 4. Ballester V; F. Granero, R.A.de Maagd, D. Bosch, J.L. Mensua, J. Ferre. (1999), “Role of Bacillus thuringiensis
  18. toxin domains in toxicity and receptor binding in the Diamondback moth”, Applied and Environmental Microbiology, p.1900-1903. 5. Carozzi, N. B., V. C. Kramer, G. W. Warren, S. Evola, and M. G. Koziel. (1991), “Prediction of Insecticidal Activity of Bacillus thuringiensis Strains by Polymerase Reaction Product Profiles”. Applied and Environmental Microbiology, p.3057-3061. 6. Ceron, J., A. Ortiz., R. Quintero, L. Guereca, and A. Bravo. (1995), “Specific PCR Primers Directed To Identify cryI and cryIII Genes within a Bacillus thuringiensis Strain Collection”. Applied and Environmental Microbiology, p. 3826-3821. 7. Chau, N.T; L.H.Hieu, T.T. Binh, N. T. Lam, N.M.Thanh, L. V. Truong, N.A Tuan. (1996), “Study on the Bacillus thuringiensis as insecticide to control stored- grain insects in Vietnam”, Proceeding of the second Pacific Rim Conference on Biotechnology of Bacillus thuringiensis and its impact to the environment, November 4-8, p. 379- 392. 8. Chau N. T; B. T. Huong, T. V. Tuan, D. T. N. Huyen, N.
  19. D. Tien, N. N. Huyen, N. H. Ha. (2001), “Production technology of Bacillus thuringiensis bioinsecticide in the fermentation system 1500l and application to control insects in vegetable, fruit and stored products”. A manuscript sumitted to the 4 the Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis in Canberra, Australia, 11-15 November, 2001. 9. Kalman, S., K. L Kiehne, K. J. Libs, ADN T. Yamatomo. (1993), “Cloning of a Novel cryIC-Type Gene from a Strain of Bacillus thuringiensis subsp–galleriae”. Applied ADN Environmental Microbiology, p.1131-1137. 10. Maniatis, T; E.F. Fritisch, and Sambrook. (1989), Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 11. Park S. H., B. T. Koo, B. S. Shin, S. K. Choi, Y. M. Jeong, J. G Pan, and J. I. Kim. (1997), “Characterization of 1925 Bacillus thuringiensis isolates from plants in Korea”. Kor. J. Appl. Microbiol. Biotechnol. Vol. 25, No. 2, p.159- 165.
  20. SUMMARY ISOLATION AND CHARACTERIZATION SOME BACILLUS THURINGIENSIS KURSTAKI STRAINS IN VIET NAM Bui Thi Huong1, Đo Thi Ngoc Huyen1, Nguyen Tuan1, Đinh Duy Khang2, Nguyen Thuy Chau1 1. Microbiology Department, Post Harvest Technology Institute. 2. Molecular Microbiology Department, Institue of BioTechnology, National Centre for Natural Science and Technology. We collected 56 leaf samples and 55 soil samples and 26 paddy humus samples from many provinces in Northern Vietnam. Total of 36 Bacillus thuringiensis isolates were obtained and characterized. The microscopic observation showed that 11 isolates having bipyramidal shape crystals, 10 isolates having square shape crystals, 6 isolates of flat

CÓ THỂ BẠN MUỐN DOWNLOAD

Đồng bộ tài khoản