Báo cáo Sinh viên nghiên cứu khoa học

Chia sẻ: Lê Văn Hải | Ngày: | Loại File: DOC | Số trang:13

0
242
lượt xem
123
download

Báo cáo Sinh viên nghiên cứu khoa học

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Cây cà chua bị tấn công bởi rất nhiều loài virus. Trong số bệnh virus hại cà chua ở vùng nhiệt đới và cận nhiệt đới, bệnh xoăn vàng lá được xem là bệnh quan trọng nhất (Pico et al., 1996). Nguyên nhân gây bệnh xoăn vàng lá cà chua khá phức tạp. Bệnh được xem là một bệnh phức, có nghĩa là một bệnh nhưng do nhiều virus thuộc chi Begomovirus, họ Geminiviridae gây ra (Moriones & Navas-Castillo, 2000). Các begomovirus có hình thái phân tử dạng hình cầu kép (hình chuỳ), không truyền qua hạt giống nhưng lan truyền...

Chủ đề:
Lưu

Nội dung Text: Báo cáo Sinh viên nghiên cứu khoa học

  1. I. MỞ ĐẦU 1.1. Đặt vấn đề Cây cà chua bị tấn công bởi rất nhiều loài virus. Trong số bệnh virus hại cà chua ở vùng nhiệt đới và cận nhiệt đới, bệnh xoăn vàng lá được xem là bệnh quan trọng nhất (Pico et al., 1996). Nguyên nhân gây bệnh xoăn vàng lá cà chua khá phức tạp. Bệnh được xem là một bệnh phức, có nghĩa là một bệnh nhưng do nhiều virus thuộc chi Begomovirus, họ Geminiviridae gây ra (Moriones & Navas-Castillo, 2000). Các begomovirus có hình thái phân tử dạng hình cầu kép (hình chuỳ), không truyền qua hạt giống nhưng lan truyền trên đồng ruộng bằng bọ phấn (Bemisia tabaci) theo kiểu bền vững tuần hoàn (Pico et al., 1996). Begomovirus là các virus có bộ gien DNA sợi vòng đơn, kích thước khoảng 2.6 – 2.8 kb. Begomovirus có thể có bộ gien đơn (gồm một phân tử DNA-A) hoặc có bộ gen kép (gồm hai phân tử DNA-A và DNA-B). Cấu trúc của một phân tử DNA-A điển hình gồm có 6 gien được sắp xếp theo hai chiều ngược nhau (Hình 1). Theo chiều kim đồng hồ có hai gien AV1 và AV2. Gen AV1(CP) mã hóa vỏ protein, qui định tính đặc hiệu vector và nhập nhân tế bào. Gen AV2 mã hóa 1 protein có chức năng cảm ứng triệu chứng, di chuyển hệ thống và tích lũy DNA của virus. Ngược chiều kim đồng hồ có 4 gien AC1, AC2, AC3 và AC4. Gien AC1 (Rep) mã hóa 1 protein có vai trò quan trọng trong quá trình tái sinh virus và tương tác với các protein ký chủ điều khiển chu kỳ tế bào. Gien AC2 (TrAP) mã hóa 1 protein hoạt hóa phiên mã và ức chế phản ứng phòng thủ của cây. Gien AC4 (REn) mã hóa 1 protein tăng cường sự tái sinh virus và tương tác với các protein ký chủ điều khiển chu kỳ tế bào. Gien AC4 mã hóa 1 protein có chức năng cảm ứng triệu chứng và di chuyển hệ thống (Stanley et al., 2005) AV2 AC4 Hình 1. Tổ chức bộ gien phân tử DNA-A của begomovirus. CP = DNA-A coat protein. REn = replication ~2.7kb AV1 (CP) enhancer. TrAP = transcriptional activator protein. Rep = replication AC1 (Rep) associated protein. (Rep) AC3 (REn) AC2 (TrAP) Hiện nay, có tới hơn 50 begomovirus phân lập từ cà chua (có từ tomato ở đầu tên virus) đã được công bố trên thế giới (Fauquet et al., 2008). Trên cây cà chua, các begomovirus tạo triệu chứng giống nhau, điển hình là: cuốn lá (cong lại hình thìa); mép lá (đặc biệt ở lá non) biến vàng; lá nhỏ hẹp; cây nhiễm sớm còi cọc với tỷ lệ đậu quả rất thấp. Danh tính virus gây bệnh chỉ có thể biết được dựa vào các phân tích phân tử (Moriones & Navas-Castillo, 2000). Tại Việt Nam, bệnh xoăn vàng lá được xem là bệnh virus quan trọng nhất trên cà chua với tỉ lệ nhiễm bệnh trên các ruộng trồng cà chua thường rất cao, có khi tới 100 %. Bệnh đã được phát hiện thấy trên cà chua từ những năm 80. Một số nghiên cứu về tạo kháng huyết thanh chẩn đoán, lây nhiễm nhân tạo đã được thực hiện trong thời gian này nhưng bản chất thật sự của virus vẫn chưa rõ. Gần đây, dựa vào các phân tích phân tử, có ít nhất 3 begomovirus được phát hiện gây ra bệnh xoăn vàng lá cà chua ở Việt Nam gồm tomato leaf curl Vietnam virus 1
  2. (ToLCVV) (Green et al. 2001), tomato yellow leaf curl Vietnam virus (TYLCVNV) và tomato yellow leaf curl Kanchanaburi (TYLCKaV) (Hà et al. 2008). Trong số 3 virus trên, 2 virus được phân lập trên mẫu cà chua gây bệnh xoăn vàng lá ở miền Bắc là ToLCVV và TLCVNV. Cũng dựa trên các phân tích phân tử, Việt Nam dường như là trung tâm đa dạng của begomovirus (Ha et al. 2006, 2008). Mặc dù vậy số lượng begomovirus được xác định trên thực vật của Việt Nam vẫn còn ít, chỉ gồm 19 virus được phân lập từ nhiều loài cây, trong đó nhiều loài là cây dại (Green et al., 2001; Revill et al., 2003; Ha et al., 2006, 2008). Kết quả trên gợi ý rằng nhiều begomovirus nữa đang gây hại trên cà chua và các cây trồng khác ở Viêt Nam và cần phải được xác định. Việc phòng trừ begomovirus trên cà chua nhìn chung là khó và chủ yếu hiện nay dựa vào các chiến lược sau: (i) tạo giống kháng bệnh dựa vào nguồn gen kháng bệnh có nguồn gốc từ cà chua dại; (ii) tạo giống kháng bệnh dựa vào gen của tác nhân gây bệnh, trong đó gen của begomovirus được chuyển vào cây và thông qua cơ chế siRNA để tạo tính kháng; và (iii) phòng chống tổng hợp, trong đó thành phần chủ chốt là tiêu diệt bọ phấn, cắt nguồn ký chủ của virus, nhổ bỏ cây bệnh, sử dụng giống kháng (Czosnek, 2007). Việc xác định đầy đủ thành phần begomovirus trên cà chua luôn cần thiết cho bất cứ chiến lược phòng chống nào 1.2. Mục đích và yêu cầu Mục đích: Xác định thành phần loài Begomovirus hại cà chua tại Hà Nội và phụ cận. Yêu cầu: − Thu mẫu và xử lý mẫu cà chua bị bệnh xoăn vàng lá. − Xác định sự có mặt của các begomovirus bằng PCR dùng mồi chung (degenerate primers) đặc hiệu cho DNA-A của virus . − Xác định thành phần begomovirus tại các điểm điểu tra dùng cặp mồi đặc hiệu với 2 loài virus đã được xác định trước tại miền Bắc là tomato leaf curl Vietnam virus (ToLCVV) và tomato yellow leaf curl Vietnam virus (TYLCVNV). − Giải trình tự sản phẩm PCR của các mẫu virus có khả năng là loài mới. II. VẬT LIỆU VÀ PHƯƠNG PHÁP 2.1. Thu mẫu và xử lý mẫu Mẫu bệnh cây cà chua có triệu chứng điển hình của bệnh xoăn vàng lá được thu thập tại các ruộng trồng thuộc Hà Nội và phụ cận. Mẫu sau khi thu thập được số liệu hóa và xử lý khô bằng silicagel hoặc sấy ở 37 OC. Mẫu sau khi xử lý khô được bảo quản lâu dài trong lọ chứa silicagel ở 4 OC. 2.2. Thời gian và địa điểm nghiên cứu. Nghiên cứu được thực hiện từ 24/06/2008 đến 15/01/2009 tại TT BCNĐ, ĐHNNHN 2.3. Chiết DNA từ mô lá cà chua DNA tổng số từ mô lá được chiết theo 2 phương pháp: Phương pháp chiết nhanh nhanh bằng NaOH (Wang et al., 1993): Cho khoảng 50 mg mô lá cà chua vào tube 1,5 mL. Cho 0,5 mL dung dich NaOH 0,5 M vào tube. Dùng chày nhựa chuyên dụng để nghiền nhuyễn mẫu lá. Hòa loãng dịch nghiền 50 - 100 lần với đệm Tris 0,1 M, pH = 8 (5 μL dịch nghiền hòa loãng với 495 μL đệm Tris). Dịch hòa loãng này được dùng để chạy PCR. 2
  3. Phương pháp chiết dùng CTAB (Doyle & Doyle (1987). Khoảng 100 mg mô lá bệnh tươi (hoặc 20 mg mô lá bệnh khô) được nghiền với 1 mL đệm CTAB. DNA được chiết 2 lần với Chloroform: isoamyl alcohol (24:1). Căn DNA được rửa 2 lần bằng ethanol 70% và hòa trong 50 uL nước cất 2 lần vô trùng. Dịch chiết DNA được giữ ở -20OC 2.4. PCR (Polymerase Chain Reaction) Các phản ứng PCR được thực hiện trong tube 0.5 mL với tổng thể tích phản ứng 25 μL chứa 2.5 μL dung dịch đệm PCR X10 (Fermantas), 0.5 μL dNTPS (10 mM môi loại A, T, G, C, Roche), 0.5 μL mỗi loại mồi đặc hiệu xuôi dòng và ngược dòng hoặc 1 μL cho mỗi mồi chung (đều đươc chuẩn bị ở nồng độ 20 μM), 1.5 µL MgCl2, 0.25 µL Taq polymerase (Fermentas) và 0.5 μL DNA. Phản ứng PCR được thực hiện trên máy PCR PTC-100 (MJ Research Inc.) với điều kiện sau: khởi đầu biến tính ở 94 OC trong 5 phút; tiếp theo là 35 chu trình PCR (biến tính ở 94 OC 30 - 40 giây, gắn mồi ở 50 OC 35 - 45 giây và tổng hợp sợi ở 72 OC 1 – 1.5 phút). Phản ứng được kết thúc với 5 phút ở 72 OC. Sản phẩm PCR được điện di trên gel agarose 1 % đươc chuẩn bị bằng đệm TAE và chứa 0.5 mg/mL ethidium bromide. Gel được chạy trên thiết bị điện di là Mini-Sub Cell (Biorad) với đệm TAE ở điện thế 100 V trong 30 - 40 phút. Bản gel được kiểm tra dưới ánh sáng tử ngoại và được chup bằng máy ảnh số. 2.5. Mồi PCR Ba cặp mồi đã được sử dụng trong nghiên cứu. Chi tiết của các mồi được trình bày ở Bảng 1 và Hình 2. Căp mồi thứ nhất là cặp mồi chung (universal/degenerate primers) BegoAFor1 / BegoARev1. Cặp mồi này được thiết kế trên vùng bảo thủ của gien CP và Rep và đã được chứng minh có khả năng phát hiện DNA-A của nhiều begomovirus (Ha et al., 2006, 2008) Hai cặp mồi còn lại là các mồi đặc hiệu cho TYLCVNV (TYLCVNV-sp-F1 / TYLCVNV- sp-R1) và ToLCVV (ToLCVV-sp-F2 / ToLCVV-sp-R2). Các mồi này đã được thiết kế dựa trên trình tự chuỗi gien đã công bố của 2 virus này. Bảng 1. Các mồi được sử dụng trong nghiên cứu Kích Mồi Trình tự (5’ – 3’) Vị trí thước Tham khảo (bp) TYLCVNV-Sp- TGTGTTACATATTCTGTGTTTTC 1094-1117 Mã F1 C 1386 GeneBank TYLCVNV-Sp- AAATACATCAAAATCTGCAGAG DQ641697 2456-2480 R1 AGC GACCAGTCTGAAGGTGTGAGTT ToLCVV-Sp-F2 1254-1276 Mã C 454 GeneBank ACTCAAGCTATAAAGAATACCT DQ641705 ToLCVV-Sp-R2 1683-1708 AGAC TGYGARGGiCCiTGYAARGTYCA BegoAFor1 RTC* Ha et al., Hình 2 ~1200 ATHCCMDCHATCKTBCTiTGCAA 2006 BegoARev1 TCC* * Y (C / T), R (G / A), H (A / C / T), M (A / C), B (C / G / T), D (A / G / T), K (G / T) và i = 3
  4. inosine AC2 AC4 AV2 AC3 AC1 AV1 (CEGPCKVQS) (IPT/A/SIF/VLCNP) DNA-A BegoAFor1 ~ 1.2 kb BegoARev1 Hình 2. Sơ đồ tổ chức bộ gien DNA-A (biểu diễn dưới dạng mạch thẳng) của begomovirus và vị trí tương đối của cặp mồi BegoAFor1 và BegoARev1. Mũi tên dạng hộp biểu diễn vị trí và hướng của các ORF. Dãy chữ trong 2 ngoặc kép là các chuỗi axit amin bảo thủ tương ứng với 2 mồi BegoAFor1 và BegoARev1. 2.6. Giải trình tự Sản phẩm PCR được tinh chiết từ gel agarose dùng kít tinh chiết PureLink TM Quick Gel Extraction Kit (Invitrogen) theo hướng dẫn của nhà sản xuất. Hàm lượng DNA được ước lượng bằng điện di agarose với lượng DNA tham khảo là 2µl, 1µl, 0.5µl tương ứng với 1µg, 0.5 µg, 0.25 µg DNA (marker GeneRuler, Fermantas). Sản phẩm PCR tinh chiết được giải trình tự trực tiếp cả 2 chiều bằng mồi PCR tại Viện Công nghệ sinh học (Hà Nội) 2.7. Phân tích trình tự và xây dựng cây phả hệ. Các chuỗi mẫu được xác định danh tính khi so sánh với các chuỗi đã công bố từ trước nhờ phần mềm tìm kiếm BLAST tại NCBI (the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/BLAST/). Phân tích chuỗi và xây dựng cây phả hệ được thực hiện với các phần mềm miễn phí BioEdit 7.0, ClustalX1.83, Mega 4.0 và gói phần mềm thương mại DNASTAR. III. KẾT QUẢ NGHIÊN CỨU 3.1. Điều tra thu thập mẫu bệnh Chúng tôi đã tiến hành điều tra bệnh xoăn vàng lá trên các ruộng trồng cà chua thuộc Hà Nội, Bắc Ninh và Hưng Yên. Tổng số 50 mẫu cà chua đã được thu thập, số liệu hóa và xử lý khô để bảo quản lâu dài. Các mẫu này đều tạo triệu chứng đặc trưng của bệnh xoăn vàng lá. 3.2. Kiểm tra PCR dùng mồi đặc hiệu begomovirrus Do số lượng mẫu thu thập khá lớn nên chúng tôi đã chọn 19 mẫu bệnh đại diện cho các địa điểm khác nhau để kiểm tra PCR. Đầu tiên, chúng tôi sử dụng cặp mồi chung đặc hiệu cho DNA-A của nhiều loài begomovirus (BegoaFor1/BegoARev1) nhằm phát hiện sự có mặt của virus trong mẫu cây bệnh. Phản ứng PCR đều tạo ra 1 sản phẩm có kích thước khoảng 1200 bp trên tất cả 19 mẫu thử, chứng tỏ sự có mặt của begomovirus trong mẫu (Hình 3A, Bảng 2) 3.3. Kiểm tra PCR dùng mồi đặc hiệu ToLCVV và TYLCVNV Hiện nay, tại miền Bắc Việt Nam mới chỉ công bố sự có mặt của 2 begomovirus gây bệnh xoăn vàng lá cà chua là ToLCVV và TYLCVNV. Để kiểm tra sự có mặt của 2 virus này trên 19 4
  5. mẫu cà chua nhiễm begomovirus, chúng tôi đã sử dụng 2 cặp mồi đặc hiệu cho mỗi virus (phần 2.5). Kiểm tra PCR với cặp mồi ToLCVV-sp-F2 / ToLCVV-sp-R2 (đặc hiệu ToLCVV) cho thấy 10/19 mẫu thử tạo các băng đơn và rõ với kích thước khoảng 450 bp (Hình 3B, Bảng 2), xác nhận sự có mặt của ToLCVV. Kiểm tra PCR với cặp mồi TYLCVNV-sp-R1 / TYLCVNV-sp-F1 (đặc hiệu TYLCVNV) cho thấy 8/19 mẫu tạo ra tạo các băng đơn và rõ với kích thước khoảng 1386 bp (Hình 3C, Bảng 2), xác nhận sự có mặt của TYLCVNV. Kiểm tra PCR đã phát hiện thấy mẫu số 12 (mẫu thu tại Yên Mỹ - Thanh Trì - Hà Nội) có kết quả (+) với cả hai cặp mồi chứng tỏ mẫu này đã nhiễm cả 2 virus ToLCVV và TYLCVNV. Quan trọng nhất là chúng tôi đã phát hiện 2 mẫu (mẫu số 9, thu tại Đa Tốn – Gia Lâm – Hà Nội và mẫu số 14, thu tại Yên Mỹ – Thanh Trì – Hà Nội) có phản ứng PCR (–) với cả hai cặp mồi. Kết quả này gợi ý rằng các begomovirus nhiễm trên 2 mẫu này có thể không phải là ToLCVV hay TYLCVNV. Tuy nhiên danh tính của chúng chỉ thể được xác định dựa trên phân tích trình tự chuỗi gien virus. M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 1200 bp A 454 bp B 1386 bp C Hình 3. Kết quả điện di sản phẩm PCR của các mẫu cà chua bị bệnh xoăn vàng lá thu thập được. A) PCR với cặp mồi chung đặc hiệu DNA-A của begomovirus. B) PCR với cặp mồi đặc hiệu DNA-A của ToLCVV. C) PCR với cặp mồi đặc hiệu DNA-A của TYLCVNV. M là thang DNA (GeneRuler 1 kb, Fermentas). Các số từ 1 đến 19 là các mẫu cà chua (danh tính mẫu được trình bày ở bảng 2). Kích thước sản phẩm PCR cũng được chỉ rõ. Bảng 2. Kiểm tra PCR các mẫu cà chua bị bệnh xoăn vàng lá PCR đặc hiệu TT Mã Địa điểm thu mẫu Begomoviru * mẫu ToLCVV TYLCVNV s 1 CC1 Nam Hồng – Đông Anh – Hà Nội. + – + 2 CC2 Nam Hồng – Đông Anh – Hà Nội. + + – 3 CC 3 Cổ Bi – Gia Lâm – Hà Nội. + + – 4 CC 4 Cổ Bi – Gia Lâm – Hà Nội. + + – 5 CC 5 Cổ Bi – Gia Lâm – Hà Nội. + + – 6 CC 6 Từ Sơn – Bắc Ninh. + + – 5
  6. 7 CC 7 Từ Sơn – Bắc Ninh. + + – 8 CC 8 Đa Tốn – Gia Lâm – Hà Nội + + – 9 CC 9 Đa Tốn – Gia Lâm – Hà Nội + – – 10 CC 10 Đa Tốn – Gia Lâm – Hà Nội + + – 11 CC 11 Duyên Hà – Thanh Trì – Hà Nội. + – + 12 CC 12 Yên Mỹ – Thanh Trì – Hà Nội. + + + 13 CC 13 Yên Mỹ – Thanh Trì – Hà Nội. + – + 14 CC 14 Yên Mỹ – Thanh Trì – Hà Nội + – – 15 CC 15 Yên Phú – Yên Mỹ – Hưng Yên. + – + 16 CC 16 Yên Phú – Yên Mỹ – Hưng Yên. + – + 17 CC 17 Yên Phú – Yên Mỹ – Hưng Yên. + – + Ngô Xuyên – Như Quỳnh – Hưng 18 CC 18 + + – Yên 19 CC 19 Đại học Nông nghiệp Hà Nội + - + * Số thứ tự trong bảng này cũng là số thứ tự các mẫu ở Hình 3 3.4. Kết quả giải trình tự mẫu PCR Vì danh tính của begomovirus chỉ có thể được xác định chính xác dựa trên phân tích trình tự gien nên đối với 2 mẫu có PCR (-) đối với ToLCVV và TYLCVNV (mẫu số 9 và 14, Hình 3B, 3C, Bảng 2) chúng tôi đã giải trình tự trực tiếp sản phẩm PCR được khuyếch đại bằng cặp mồi BegoAFor1/BegoARev1. Sản phẩm PCR được tinh chiết từ gel agarose dùng kít tinh chiết (PureLinkTM Quick Gel Extraction Kit, Invitrogen) và được ước lượng nồng độ bằng điện di agarose trước khi được giải trình tự cả 2 chiều bằng mồi PCR tại Viện Công nghệ sinh học tại Hà Nội. Kết quả cho thấy tất cả 4 sản phẩm giải trình tự đều có chất lượng tốt, không bị nhiễu, các dâu hiệu nucleotide đều rõ ràng (ngoại trừ phần ở 2 đầu mỗi sản phẩm). Các trình tự được lắp ráp, biên tập và loại bỏ các đoạn có chất lượng kém ở 2 đầu (do giải trình tự trực tiếp) dùng phần mềm BioEdit và SeqMan (DNASTAR).Cuối cùng chúng tôi thu được đoạn trình tự của 2 mẫu với chiều dài mỗi đoạn là 819 nts. Cả 2 đoạn này này đều chứa toàn bộ ORF AC3 với kích thước 402 nts (Hình 4). Mẫu số 9 (Đa Tốn – Gia Lâm – Hà Nội) 5’CACAGGATTTTGGTCAGGTGTTTAACATGTATGATAACGAGCCAAGTACAGCCAC AGTGAAGAACGATAACAGAGATCGCTTTCAAGTTCTACGGCGTTTTCAGGCGACTG TTACTGGTGGTCAGTATGCAAGTAAGGAGCAAGCAATAGTTAGGAAGTTTATGAA GGTGAACAACCATGTGACGTATAATCATCAAGAAGCTGCGAAGTATGACAATCAC ACAGAGAATGCTCTTTTGTTGTATATGGCATGTACTCATGCTAGTAATCCTGTGTAT GCTACTTTGAAAATCAGAATCTATTTCTATGATTCTGTTCAGAATTAATAAAGATTG AATTTTATTATATTTGAATGTGTTACATATTCTGTCTTTTCCAATACATCCCATAATA CATGATCACATGCTCTAATTACATTGTTAATACTAATTACACCCAAATTATCTAAAT ATTTCATACATTGAACCCTAAATACTCTTAAGAAACGCCAAGTCTGAGGACGTAAA CGAGTCCAGATTTGGAATATTAGAAAACATTGGTGTATTCCCAACGCTTTCCTCAG GTTGTAATTGAATTGGACTTGTATTGTGATGATGTCGTTGTTCATCAGAAATGGTCT CTCGTCGTGGCTGATTATCTTGAAATATAGGGGATTTTTGACCGTCCAGATATATAC 6
  7. GCCACTCTCTGCTTGAGCTGCAGTGATAGCTTCCCCTGTGCGAGAATCCATGATTGT GACAGCCTAGTGCAATGAAGTATGAACAGCCACAAGGAAGATCAACTCTCCGTCT CCTCGTTGCTTTCTTGGCGTTGCGGTGTTGC 3’ Mẫu số 14 (Yên Mỹ - Thanh Trì – Hà Nội) 5’CCCAGGATTTTGGCCAGGTGTTTAACATGTATGATAATGAGCCGAGTACAGCTAC TGTGAAGAATGACAACAGGGATCGTTTTCAAGTTCTCCGCCGTTTTCAAGCCACTG TTACTGGTGGCCAGTATGCAAGTAAGGAGCAAGCAATAGTCAGGAAATTCATGAA GGTGAATAACCATGTAACTTATAACCATCAAGAGGCTGCGAAGTATGATAACCAC ACAGAAAATGCTTTGTTATTGTATATGGCATGTACTCATGCTAGTAATCCAGTGTAT GCTACTTTGAAGATCAGGATCTATTTCTACGATTCTGTTCAGAATTAATAAAGATTA AATTTTATTATACTTGAATCTTCTGTATCAATTGTGCCTTCTAATACATTGTACAAT ACATGAGACATTGCTCTAATTACATTATTGATGCTAATAACTCCTAAATTGTCTAAA TACTTAATACATTGATATTTAAATACTCTTAAGAAACGCGAGGTCTGAGGATGTAA ACGAGTCCAAACTCGGCAGATTAGAAAACATTGGTGTATCCCCAATGCTTTCCTCA GGTTGTAATTGAATTGGACTTGTATTGTGATGATGTCGTGGTTCGTCAGAAATGGT CTCTCGTCGTGGCTGGTTATCTTGAAATATAGGGGATTTTTGACCGTCCAGATATAT ACGCCACTCTCTGCTTGAGCTGCAGTGATAGCTTCCCCTGTGCGAGAATCCATGATT GTGACAGCCTAGTGCAATGAAGTATGAACATCCACAAGGGAGATCAACTCTCCGTC TCCTCGTAGCTTTCTTGGCGTTGCGGTGTTGC 3’ Hình 4. Trình tự nucleotide của sản phẩm PCR dùng mồi BegoAFor1/BegoARev1 sau khi được biên tập. Đoạn ORF AC3 mã hóa protein REn được bôi đậm với vị trí khởi đầu dịch mã cũng như hướng dịch mã được chỉ bằng mũi tên vuông. 3.5. Kết quả tìm kiếm các trình tự tương đồng trên GeneBank Sử dụng công cụ tìm kiếm trực tuyến BLAST trên NCBI, chúng tôi đã tìm các chuỗi gien có quan hệ với các chuỗi số 9 và số 14. Kết quả tìm kiếm dựa trên toàn bộ trình tự chuỗi (819 nts) cho thấy chuỗi trên GeneBank gần gũi nhất với chuỗi số 9 là một isolate của p apaya leaf curl China virus (PaLCuCNV, isolate FQ1, có nguồn gốc từ Trung Quốc, mã số AM691554). Tương tự, chuỗi trên GeneBank gần gũi nhất với chuỗi số 14 là một isolate của Tomato yellow leaf curl Vietnam virus (TYLCVNV, nguồn gốc Việt Nam, mã số DQ641697). Kết quả tìm kiếm dựa trên trình tự gien AC3 cho thấy, virus trên GeneBank gần gũi nhất với cả 2 chuỗi số 9 và 14 đều là PaLCuCNV. 3.6. Kết quả so sánh mức độ tương đồng trình tự nucleotide Để đánh giá mức độ tương đồng, trình tự nucleotide của 2 mẫu virus trong nghiên cứu này được so sánh với trình tự nucleotide của nhiều virus trên GeneBank. Các chuỗi virus trên GeneBank bao gồm (i) 5 chuỗi (không tính cùng hay khác virus) có quan hệ gần gũi nhất từ tìm kiếm BLAST, (ii) các virus được phân lập từ trước tại Việt Nam, (iii) nhiều mẫu virus phân lập từ cà chua thuộc cựu thế giới và (iv) một virus đại diện nhóm tân thế giới (sweet potato leaf curl virus, SPLCV). Ngoài ra, để đánh giá mức độ tương đồng giữa các isolate khác nhau của cùng 1 virus, 11 chuỗi papaya leaf curl China virus (PaLCuCNV) cũng được so sánh. Đầu tiên, các chuỗi được “nắn” (aligned) dùng phần mềm Clustal X; tiếp theo phần trăm tương đồng nucleotide của các chuỗi được tính từ lệnh “sequence identity matrix” của phần mềm Bioedit. Danh tính virus, mã GeneBank, nguồn gốc của 41 chuỗi virus trên GeneBank được trình bày ở Bảng 3. Kết quả so sánh dựa trên đoạn 819 nts cho thấy mẫu virus số 14 có mức tương đồng cao nhất với Ageratum leaf curl virus (ALCV, AJ851005, nguồn gốc Trung Quốc) với phần trăm tương đồng là 97 % (Bảng 3). 7
  8. Trong khi đó, mẫu virus số 9 có mức tương đồng cao nhất với 2 isolate của PaLCuCNV (AM691554, AM691552) có nguồn gốc từ Trung Quốc và với TYLCVNV (DQ641697) của Việt Nam. Tuy nhiên, phần trăm tương đồng của mẫu virus số 9 thấp hơn nhiều và đều bằng 89.7 % đối với cả 3 chuỗi trên (Bảng 3). Cả 2 mẫu virus, số 9 và 14, đều chia sẻ mức tương đồng nucleotide khá thấp đối với mẫu SPLCV, một đại diện của nhóm Tân thế giới (phần trăm tương đồng lần lượt là 0.52 và 0.508 (Bảng 3). 3.7. Kết quả phân tích phả hệ Để đánh giá mối quan hệ phả hệ của 2 mẫu begomovirus từ nghiên cứu này với các begomovirus khác, phần mềm MEGA đã được sử dụng để tính khoảng cách di truyền và xây dựng cây phả hệ dựa trên các chuỗi đã được nắn trước bằng phần mềm ClustalX. Tương tự như kết quả so sánh chuỗi, cây phả hệ (Hình 5) cho thấy virus mẫu số 14 và ALCV hình thành một cụm riêng rẽ với giá trị boostrap tới 100 % phản ánh mức độ tương đồng trình tự nucleotide rất cao giữa chúng. Trái lại mẫu virus số 9 hình thành một cụm riêng rẽ so với các chuỗi hoặc cụm chuỗi khác (Hình 5) 8
  9. Bảng 3. Mức tương đồng nucleotide dựa trên so sánh đoạn 819 nts của 2 mẫu begomovirus từ nghiên cứu này với đoạn tương ứng của 41 chuỗi virus trên GeneBank Mã Nguồn Mẫ Mẫ Stt Tên virus Ký hiệu Genbank gốc u 9 u 14 AM69155 Papaya leaf curl China virus PaLCuCNV- Trung 0.89 0.83 1 4 [FQ1] FQ1 Quốc 7 3 AM69155 Papaya leaf curl China virus PaLCuCNV- Trung 0.89 0.83 2 2 [F25] F25 Quốc 7 3 Papaya leaf curl China virus PaLCuCNV- Trung 0.89 0.83 3 EU874386 [ ZM1] ZM1 Quốc 4 3 Papaya leaf curl China virus Trung 0.89 0.82 4 AJ558123 PaLCuCNV-G2 [G2] Quốc 4 9 Papaya leaf curl China virus PaLCuCNV- Trung 0.89 0.83 5 AJ558117 [G30] G30 Quốc 4 3 Papaya leaf curl China virus Trung 0.89 0.82 6 AJ811914 PaLCuCNV-G4 [G4] Quốc 4 9 AM69155 Papaya leaf curl China virus PaLCuCNV- Trung 0.89 0.83 7 3 [LC1-2] LC1-2 Quốc 2 0 Papaya leaf curl China virus PaLCuCNV- Trung 0.88 0.82 8 AJ704604 [G22] G22 Quốc 8 7 Papaya leaf curl China virus PaLCuCNV- Trung 0.88 0.83 9 AJ558125 [G10] G10 Quốc 3 5 Papaya leaf curl China virus Trung 0.87 0.84 10 AJ558124 PaLCuCNV-G8 [G8] Quốc 9 0 DQ64170 Papaya leaf curl China virus PaLCuCNV- 0.87 0.84 11 Việt Nam 0 [VN] VN 9 7 DQ64169 Tomato yellow leaf curl Vietnam 0.89 0.82 12 TYLCVNV Việt Nam 7 virus 7 6 Trung 0.89 0.97 13 AJ851005 Ageratum leaf curl virus ALCV Quốc 3 0 DQ64169 0.84 0.86 14 Erectites yellow mosaic virus EYMV Việt Nam 8 5 0 AY60216 Tomato yellow leaf curl Trung 0.83 0.85 15 TYLCGDV 6 Guangdong virus Quốc 8 7 Trung 0.83 0.84 16 AJ810156 Stachytarpheta leaf curl virus SLCV Quốc 6 7 0.75 0.74 17 AJ437618 Ageratum enation virus AEV Nepal 6 3 9
  10. 0.82 0.77 18 X74516 Ageratum yellow vein virus AYVV Singapo 7 4 0.69 0.69 19 AF363011 Cotton leaf curl Rajasthan virus CLCuRV Ấn Độ 6 5 0.71 0.71 20 AJ438936 Eupatorium yellow vein virus EpYVV Nhật Bản 1 1 0.71 0.70 21 AJ314739 Indian cassava mosaic virus ICMV Ấn Độ 2 1 Mungbean yellow mosaic India 0.62 0.62 22 AF126406 MYMIV Ấn Độ virus 5 9 0.67 0.67 23 AF509739 Luffa yellow mosaic virus LYMV Việt Nam 7 0 0.63 0.62 24 D14703 Mungbean yellow mosaic virus MYMV Thái Lan 0 1 Pepper leaf curl Bangladesh Banglades 0.76 0.74 25 AF314531 PepLCBV virus h 0 5 AB05078 0.81 0.77 26 Soybean crinkle leaf virus SCLV Nhật Bản 1 7 4 0.69 0.68 27 AF509743 Squash leaf curl China virus SLCCNV Việt Nam 0 9 Trung 0.80 0.75 28 AJ566744 Tobacco leaf curl Yunnan virus TbLCuYNV Quốc 0 6 0.80 0.81 29 AF195782 Tomato leaf curl Laos virus ToLCLV Lào 5 6 0.81 0.78 30 AF264063 Tomato leaf curl Vietnam virus ToLCVNV Việt Nam 3 2 Tomato yellow leaf curl 0.73 0.72 31 AF189018 ToLCInV Indonesia Indonesia virus 4 3 AY51463 Tomato yellow leaf curl 0.78 0.80 32 TYLCTHV Thái Lan 0 Thailand virus 5 2 0.78 0.79 33 AF327436 Tomato leaf curl Malaysia virus TLCMaLV Malaysia 5 1 0.82 0.84 34 AF414287 Pepper leaf curl virus PepLCV Malaysia 9 1 Tomato leaf curl Philippines 0.80 0.80 35 EU487040 ToLCPV Philippin virus 2 5 DQ64170 Lindernia anagallis yellow vein 0.70 0.70 36 LaYVV Việt Nam 1 virus 3 0 AM05073 Alternanthera yellow vein virus Trung 0.73 0.72 37 AlYVV 6 isolate quốc 7 3 0.52 0.50 38 AF104036 Sweet potato leaf curl virus SPLCV Mỹ 4 8 0.68 0.67 39 AJ223191 Chayote yellow mosaic virus CYMV Nigeria 6 2 AM98050 Tomato yellow leaf curl China TYLCuCNV- Trung 0.76 0.78 40 9 virus-[Y278] Y278 Quốc 2 5 10
  11. AM18168 Tomato yellow leaf curl China TYLCuCNV- Trung 0.77 0.77 41 3 virus-[Y322] Y322 Quốc 4 8 PaLCuCNV.LC1-2.TrungQuoc 73 PaLCuCNV.G4.TrungQuoc 100 PaLCuCNV.F25.TrungQuoc 77 PaLCuCNV.FQ1.TrungQuoc PaLCuCNV.G2.TrungQuoc 98 PaLCuCNV.G22.TrungQuoc PaLCuCNV.ZM1.TrungQuoc 100 PaLCuCNV.G30.TrungQuoc 57 60 PaLCuCNV.VietNam 84 PaLCuCNV.G8.TrungQuoc 77 PaLCuCNV.G10.TrungQuoc 40 TbLCuYNV.Y61.TrungQuoc 71 80 AYVV.Singapo 99 SCLV.NhatBan 46 TYLCVNV.VietNam 12 ►mẫu số 9 ToYLCV.VietNam 9 TYLCGDV.G3.TrungQuoc TLCPV.P118.Philippines 26 59 ToLCLV.Lao 94 TLCMaLV.Malaysia SLCV.Hn30.TrungQuoc 100 ALCV.G52.TrungQuoc 94 55 ►mẫu số 14 55 EYMV.VietNam 99 PLCV-MaL.Malaysia TYLCThLV.ThaiLan 24 96 TYLCuCNV.Y278.TrungQuoc 100 TYLCuCNV.Y322.TrungQuoc 100 MYMIV.Ando 23 MYMV.ThaiLan TYLCInV.LB.Iandonexia 28 CYMV.nigeria 37 39 ICMV.AnDo 92 AEV.Nelpan 78 PepLCBV.Bangladesh 54 CLCuRV.Ando 83 LYMV.VietNam 100 SLCCNV.ViệtNam LiAYVV.VietNam 61 AlYVV.VietNam EpYVV.NhatBan SPLCV.My 0.05 Hình 5. Cây phả hệ dựa trên phân tích đoạn 819 nts của 2 mẫu virus phân lập từ nghiên cứu này và đoạn tương ứng của 41 chuỗi virus trên GenBank. Các chuỗi được nắn bằng phần mềm Clustal X. Khoảng cách di truyền và cây phả hệ được xây dựng dùng phần mềm 11
  12. MEGA. Giá trị bootraps (%) với 1000 lần lặp lại được chỉ rõ ở gốc các nhánh. Thanh bar thể hiện khoảng cách di truyền bằng 0.05. Danh tính virus được trình bày ở Bảng 3. 4. THẢO LUẬN 4.1. Tính đặc hiệu của cặp mồi đặc hiệu ToLCVV và TYLCVV Cả 2 cặp mồi đặc hiệu đã chứng tỏ khả năng phát hiện và phân biệt 2 virus ToLCVV và TYLCVNV gây bệnh xoăn vàng lá cà chua. Kết quả PCR với 2 cặp mồi đặc hiệu đã cho thấy cả 2 virus đều khá phổ biến tại địa bàn điều tra (10/19 mẫu nhiễm ToLCVV và 8/19 mẫu nhiễm TYLCVNV). Đáng chú ý là dùng 2 cặp mồi này, chúng tôi đã phát hiện một mẫu nhiễm cả 2 virus. Kết quả này không ngạc nhiên vì nhiễm bệnh hỗn hợp 2 hay nhiều begomovirus trên cùng một cây là hiện tượng khá phổ biến đối với begomovirus (Fauquet et al., 2005). Nhiễm bệnh hỗn hợp có thể gây hậu quả lớn về tiến hóa của begomovirus vì chúng có thể tái sinh thông qua cơ chế tái tổ hợp (Jeske et al., 2001) dẫn tới hình thành các loài begomovirrus mới. Thực tế là virus TYLCVNV đã được phân lập từ một cây cà chua nhiễm hỗn hợp với cả ToLCVV và cả 2 virus này chia sẻ một vùng gần như đồng nhất khoảng 1000 nts ở vùng bên phải của bộ gien (Ha et al., 2008). 4.2. Đã lần đầu tiên phát hiện được sự có mặt của Ageratum leaf curl virus (ALCV) trên cà chua tại Việt Nam Kết quả so sánh trình tự nucleotide và phân tích phả hệ dựa trên đoạn 819 nts cho thấy begomovirus nhiễm trên mẫu cà chua số 14 có lẽ là một isolate của ALCV. ALCV là một virus được phân lập trên cây ageratum (hoa ngũ sắc) ở tỉnh Quảng Tây – Trung Quốc, một tỉnh giáp với Việt Nam, vào năm 2003 (AJ851005). Cây ageratum là một cây ký chủ ưa thích của nhiều begomovirus. Cho tới nay (2008), 5 begomovirus đã được công bố là phân lập đầu tiên trên cây ageratum (có từ đầu tiên của tên virus là ageratum) (Fauquet et al., 2008). Cũng cần chú ý rằng giả thiết trên chỉ có thể được khẳng định chắc chắn khi toàn bộ bộ gien của virus mẫu số 14 được giải mã toàn bộ vì begomovirus có khả năng tái tổ hợp rất cao, thậm chí 2 virus thuộc 2 loài khác nhau có thể chia sẻ đoạn tái tổ hợp có kích thước rất lớn như đã được chứng minh ở TYLCVNV và ToLCVV (Ha et al., 2008). 4.3. Đã phát hiện được một loài begomovirus mới trên cà chua Cũng từ kết quả so sánh trình tự nucleotide và phân tích phả hệ dựa trên đoạn 819 nts, chúng tôi đã phát hiện được một begomovirus mới trên cà chua (virus nhiễm mẫu số 9). Kết luận này dựa trên 2 bằng chứng sau đây. Thứ nhất, mức độ tương đồng trình tự nucleotide (đoạn 819 nts) của virus mẫu số 9 với 2 virus gần gũi nhất trên GeneBank (PaLCuCNV và TYLCVNV) khá thấp, tối đa chỉ 89.7% (Bảng 2). Vì không có một ngưỡng phân biệt loài dựa trên đoạn 819 nts nên chúng tôi đã so sánh mức tương đồng trình tự nucleotide của đoạn này trong số 11 isolate khác nhau của cùng một loài PaLCuCNV (danh tính của các virus này trình bày ở Bảng 3). Kết quả so sánh cho thấy 11 isolate này có mức tương đồng nucleotide dựa trên đoạn 819 nts trung bình 96.2 %, thấp nhất 93.7 % và cao nhất 99.7 % (số liệu không trình bày trong báo cáo này). Rõ ràng mức tương đồng tối đa giữa virus mẫu số 9 với PaLCuCNV (89.7 %) còn thấp hơn mức tương đồng giữa 2 isolate cách xa nhau nhất của PaLCuCNV (93.7 %). Thứ hai, trên cây phả hệ, virus mẫu số 9 tạo thành một nhánh độc lập với TYLCVNV và cụm PaLCuCNV (2 virus gần gũi nhất khi so sánh trình tự nucleotide). So sánh khoảng cách di truyền tương đối cũng cho thấy rõ ràng virus mẫu số 9 khác biệt hoàn toàn với 2 virus trên. 12
  13. Dựa vào triệu chứng điển hình của cây nhiễm virus và địa điểm thu thập mẫu, theo hướng dẫn cách đặt tên virus thuộc họ Geminiviridae của ICTV (Fauquet & Stanley (2005)), chúng tôi đặt tên virus là tomato leaf curl Gialam virus viết tắt là (ToLCGLV). 13

CÓ THỂ BẠN MUỐN DOWNLOAD

Đồng bộ tài khoản