Báo cáo thực tập tốt nghiệp “Xác định các virus thuộc chi Begomovirus (họ Geminiviridae) trên cây cà chua và cây khác khu vực Hà Nội và vùng phụ cận"

Chia sẻ: Lê Văn Hải | Ngày: | Loại File: PPT | Số trang:40

lượt xem

Báo cáo thực tập tốt nghiệp “Xác định các virus thuộc chi Begomovirus (họ Geminiviridae) trên cây cà chua và cây khác khu vực Hà Nội và vùng phụ cận"

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Họ Geminiviridae là một trong những họ thực vật lớn nhất (289 loài). Họ virus này có 4 chi trong đó chi Begomovirus là chi quan trọng nhất về số lượng loài (185 loài) (Fauquet et al., 2008), cũng như các bệnh mà chúng gây ra trên cây trồng. Nhiều bệnh nghiêm trọng trên cây trồng được xác định là do begomovirus gây ra. Begomovirus gây bệnh tạo ra các triệu chứng giống nhau trên cây trồng, danh tính của chúng chỉ được xác định dựa trên phân tích phân tử. Begomovirus là các virus có bộ gien DNA sợi vòng...

Chủ đề:

Nội dung Text: Báo cáo thực tập tốt nghiệp “Xác định các virus thuộc chi Begomovirus (họ Geminiviridae) trên cây cà chua và cây khác khu vực Hà Nội và vùng phụ cận"

  1. BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG NGHIỆP HÀ NỘI KHOA CÔNG NGHỆ SINH HỌC BÁO CÁO THỰC TẬP TỐT NGHIỆP Đề tài: “Xác định các virus thuộc chi Begomovirus (họ Geminiviridae) trên cây cà chua và cây khác khu vực Hà Nội và vùng phụ cận ” ơ Giảng viên hướng dẫn: TS.Hà Viết Cường Bộ môn: Bệnh cây - khoa Nông học Sinh viên thực hiện: Lê Văn Hải Lớp: Công nghệ sinh học – khóa 50
  2. Phần I. Mở đầu
  3. 1.1. Đặt vấn đề.  Họ Geminiviridae là một trong những họ thực vật lớn nhất (289 loài). Họ virus này có 4 chi trong đó chi Begomovirus là chi quan trọng nhất về số lượng loài (185 loài) (Fauquet et al., 2008), cũng như các bệnh mà chúng gây ra trên cây trồng.  Nhiều bệnh nghiêm trọng trên cây trồng được xác định là do begomovirus gây ra.  Begomovirus gây bệnh tạo ra các triệu chứng giống nhau trên cây trồng, danh tính của chúng chỉ được xác định dựa trên phân tích phân tử .  Begomovirus là các virus có bộ gien DNA sợi vòng đơn, kích thước khoảng 2.6 – 2.8 kb. Begomovirus có thể có bộ gien đơn (gồm một phân tử DNA-A) hoặc có bộ gen kép (gồm hai phân tử DNA-A và DNA- B).
  4. Triệu chứng của bệnh xoăn vàng lá cà chua và vector truyền bệnh Hình 1. Triệu chứng bệnh xoăn Hình 2. Vector truyền bệnh là Bọ vàng lá cà chua (msucares.com) phấn (tabaci). (www.aaas.org)
  5. 1 2 3 4 5 6 Hình 3: triệu chứng do begomovirus gây ra trên một số đối tượng cây trồng và cây dại. (1) Cotton leaf curl virus (www.padil.gov.au), (2) Ludwigia yellow vein Vietnam virus & Ludwigia yellow vein; (3) African cassava mosaic virus (eastafrica.usaid.gov); (4) Siegesbeckia yellow vein Guangxi virus (www.bspp.org.uk); (5) Dolichos yellow mosaic virus (www.bspp.org.uk); (6) Okra
  6. CR = common region AV2 • Cảm ứng triệu chứng AC4 • Di chuyển hệ thống CR • Cảm ứng triệu chứng • Tích lũy DNA virus • Di chuyển hệ thống DNA-A AV1 (CP) 2.6-2.8kb AC1 (Rep) • Vỏ protein • Lan truyền qua vector • Tái bản • Xâm nhập nhân tế bào • Tương tác với protein ký chủ điều khiển chu kỳ tế bào AC3 (REn) AC2 (TrAP) • Tăng cường tái bản • Hoạt hóa phiên mã • Tương tác với protein ký chủ • Ức chế phản ứng phòng điều khiển chu kỳ tế bào thủ của cây. Hình 4. Tổ chức bộ gen phân tử DNA-A của begomovirus
  7.  Trên thế giới đã có 50 loài begomovirus được xác định gây hại trên cà chua.  Tại Việt Nam, bệnh xoăn vàng lá được xem là bệnh virus quan trọng nhất trên cà chua. Có 3 begomovirus được phát hiện gây ra bệnh xoăn vàng lá cà chua ở Việt Nam gồm tomato yellow leaf curl Kanchanaburi virus (TYLCKaV) và 2 virus được phát hiện ở miền Bắc là tomato leaf curl Vietnam virus (ToLCVV), tomato yellow leaf curl Vietnam virus (TYLCVNV).  Việt Nam dường như là trung tâm đa dạng của begomovirus. Nhưng hiện tại số lượng begomovirus phát hiện được mới 19 loài, trong đó chủ yếu là các loài cây dại. Điều đó gợi ý rằng có nhiều loài begomovirus đang gây hại trên cà chua và các cây khác của Việt nam cần phải được xác định. Chính vì vậy chúng tôi tiến hành đề tài: “Xác định các virus thuộc chi Begomovirus (họ Geminiviridae) trên cây cà chua và cây khác khu vực Hà Nội và vùng phụ cận”
  8. Claude Fauquet, 2006
  9. ́ ̣ ̉ Hình 6: Tam trung tâm đa dang cua geminivirus. Trung tâm Đông Nam Á là vong tron C (Nawaz-ul-Rehman & Fauquet, 2009). ̀ ̀
  10. 1.2. Mục đích và yêu cầu 1.2.1. Mục đích  Xác định các virus thuộc chi Begomovirus trên cây cà chua và cây khác khu vực Hà Nội và vùng phụ cận. 1.2.2. Yêu cầu 1. Điều tra, thu mẫu và xử lý mẫu, bệnh virus với triệu chứng điển hình do nhóm begomovirus gây ra trên cây cà chua và một một số cây khác . 2. Xác định sự có mặt của các begomovirus bằng PCR dùng mồi chung DNA-A BegoAFor1 & BegoAReV1 . 3. Xác định thành phần loài đã tìm ra ở miền Bắc Việt Nam sử dụng hai cặp mồi đặc hiệu ToLCVV (ToLCVV-sp-F2 & ToLCVV-sp-R2) và TYLCVNV(TYLCVNV-sp-F1 & TYLCVNV-sp-R1). 4. Xác định sự có mặt của vệ tinh DNA-β virus bằng cặp mồi đặc hiệu BetaFor2 & BetaRev2. 5. Giải trình tự sản phẩm PCR của 1 - 2 mẫu cây cà chua. 6. Giải trình tự sản phẩm của 1 cây khác. 7. Phân tích trình tự có được sau giải trình tự.
  11. Phần II: Vật liệu và phương pháp nghiên cứu
  12. 2.1. Vật liệu nghiên cứu  Các mẫu cà chua, các mẫu cây khác có triệu chứng nhiễm bệnh xoăn vàng lá thu thập tại khu vực Hà Nội và vùng phụ cận.  Các thiết bị và hóa chất cần thiết.  Sử dụng các cặp mồi đặc hiệu cho begomovirus, tomato yellow leaf curl Vietnam virus (TYLCVNV), tomato leaf curl Vietnam virus (ToLCVV) (Bảng 1).  Sử dụng cặp mồi đặc hiệu DNA-β là BetaFor2 & BetaRev2. BetaFor2 : 5’ TAGCTACGCCGGAGCTTAGCTCG 3’
  13. Bảng 1: Các cặp mồi sử dụng trong nghiên cứu (trên phân tử DNA-A) Mồi Trình tự (5’ – 3’) Vị trí Kích thước Tham khảo (bp) TYLCVNV-Sp-F1 TGTGTTACATATTCTGTGTTTTCC 1094-1117 1386 Mã Genebank DQ641697 TYLCVNV-Sp-R1 AAATACATCAAAATCTGCAGAGAGC 2456-2480 ToLCVV-Sp-F2 GACCAGTCTGAAGGTGTGAGTTC 1254-1276 454 Mã Genebank DQ641705 ToLCVV-Sp-R2 ACTCAAGCTATAAAGAATACCTAGAC 1683-1708 BegoAFor1 TGYGARGGiCCiTGYAARGTYCARTC* Xem hình 4 ~1200 Ha et al., 2006 al., BegoARev1 ATHCCMDCHATCKTBCTiTGCAATCC* * Y (C / T), R (G / A), H (A / C / T), M (A / C), B (C / G / T), D (A / G / T), K (G / T) và i = inosine AC2 AC4 AV2 AC3 AC1 AV1
  14. 2.2. Phương pháp nghiên cứu. 1. Thu mẫu và xử lý mẫu. 2. Chiết tách DNA tổng số từ mô lá cà chua bằng phương pháp NaOH (Wang et al., 1993), Phương pháp chiết dùng CTAB (Doyle & Doyle (1987)). 3. Tiến hành kiểm tra PCR các mẫu cà chua và cây khác thu thập được, sử dụng các cặp mồi trong bảng 1, cặp mồi đặc hiệu DNA-β và điện di sản phẩm PCR. DNA- 4. Tinh chiết sản phẩm PCR từ gel Agarose (Invitrogen) 5. Định lượng sản phẩm tinh chiết. 6. Giải trình tự gen. 7. Phân tích trình tự bằng các phần mềm tin sinh học ClustalX 1.83, BioEdit 7.0.0, MEGA 4.0 và gói phần mềm thương mại DNASTAR.
  15. Phần III. Kết quả nghiên cứu
  16. 3.1. Kết quả điều tra thu mẫu 3.1.1. Kết quả điều tra bệnh trên cà chua Bảng 2: Kết quả điều tra tỉ lệ bệnh xoăn vàng lá trên cây cà chua TT Thời gian Địa điểm Giai đoạn Tỉ lệ sinh trưởng bệnh 1 18/09/2008 Nam Hồng – Đông Anh – Hà Nội Ra quả non 1.00% 2 21/09/2008 Cổ Bi – Gia Lâm – Hà Nội Ra hoa đợt 1 3.96% 3 24/09/2008 Tiên Sơn – Bắc Ninh Ra hoa đợt 1 0.52% 4 27/09/2008 Đa Tốn – Gia Lâm – Hà Nội Ra hoa đợt 1 0.77% 5 30/09/2008 Yên Phú – Yên Mỹ – Hưng Yên Ra hoa đợt 1 4.00% 6 05/10/2008 Duyên Hà – Thanh Trì – Hà Nội Ra hoa đợt 1 0.50% 7 05/10/2008 Yên Mỹ – Thanh Trì – Hà Nội Ra hoa đợt 1 1.30% 8 28/10/2008 Đại học Nông nghiệp Hà Nội Cây non 4.00%
  17. Hình 8: triệu chứng điển hình cà chua mắc bệnh xoăn vàng lá thu thập được Cổ Bi – Gia Lâm – Hà Nội Tiên Sơn – Bắc Ninh ĐHNN HN Đa Tốn – Gia Lâm – Hà Nội Thanh Trì – Hà Nội Yên Mỹ - Hưng Yên Thanh Trì – Hà Nội
  18. 3.1.2. Kết quả thu thập và xử lý mẫu  Đối với cà chua:  Thu được 50 mẫu thông tin đầy đủ của các mẫu được trình bày ở (phụ lục 1).  Đối với các cây khác:  Thu được 64 mẫu có triệu chứng điển hình của bệnh do begomovirus gây ra.  Đặc biệt chúng tôi thu được mẫu đu đủ có triệu chứng cuốn lá, cuống lá xoắn vặn.  Tất cả các mẫu thu thập được đều được bảo quản cẩn thận. Các mẫu này sau đó được chiết tách DNA tổng số bằng hai phương pháp và được bảo quản ở -20o C để sử dụng cho các bước sau này.
  19. Hình 9:Triệu chứng xoăn lá trên mẫu đu đủ ((Yên Phú – Yên Mỹ - Hưng Yên(1, 2, 3)) và triệu chứng cây đu dủ nhiễm begomovirus của Trung Quốc (4) 1 2 3 4
  20. 3.2. Kết quả kiểm tra PCR các mẫu cây dại và đu đủ  Sử dụng cặp mồi BegoAFor1 & BegoAReV1 để phát hiện sự có mặt của begomovirus nhiễm mẫu đu đủ và các cây dại. M 1 2 3 4 1200bp Hình 10: : Kết quả điện di sản phẩm PCR của đu đủ và các mẫu cây dại thu được. M: Là thang DNA (GeneRuler 1 kb, Fermentas). 1: Đu đủ; 2: rau mương; 3: Lữ Đằng; 4: Ké hoa vàng.  Các mẫu kiểm tra đều nhiễm begomovirus trong đó 3 các virus nhiễm 3 mẫu rau mương, lữ đằng, ké hoa vàng đã được phát hiện tại Việt Nam (Cuong Ha et al., 2008)  Đặc biệt begomovirus nhiễm mẫu đu đủ lần đầu tiên được phát hiện ở Việt Nam sẽ được giải trình tự để làm rõ nguồn gốc phân loại virus này.


Đồng bộ tài khoản