Chương 2: Cấu trúc, đặc tính, chức năng của các đại phân tử sinh học (ADN, ARN và protein)

Chia sẻ: thuynguyen_2009

Mục tiêu: Nắm được các vấn đề và trả lời các câu hỏi sau: Các bằng chứng nào khẳng định vai trò mang thông tin di truyền của ADN và ARN ở một số virut? Cấu trúc, đặc tính, chức năng của các axit nucleic? Các chức năng ngày càng biết đầy đủ hơn về ARN? Cấu trúc, đặc tính, chức năng của protein?

Bạn đang xem 20 trang mẫu tài liệu này, vui lòng download file gốc để xem toàn bộ.

Nội dung Text: Chương 2: Cấu trúc, đặc tính, chức năng của các đại phân tử sinh học (ADN, ARN và protein)

DI TRUY N H C
PHÂN T VÀ T BÀO


CHƯƠNG 2
C u trúc, c tính, ch c năng c a
các i phân t sinh h c
(ADN, ARN và protein)


inh oàn Long B môn DI TRUY N H C, Trư ng HKHTN, HQGHN
Ch−¬ng 2. C u trúc, c tính, ch c năng c a ADN, ARN, Protein

Môc tiªu kiÕn thøc
N m ư c các v n và tr l i các câu h i sau:
Các b ng ch ng nào kh ng nh vai trò mang thông tin
di truy n c a ADN (và ARN m t s virut)?
C u trúc, c tính, ch c năng c a các axit nucleic
Các ch c năng ngày càng bi t y hơn v ARN
C u trúc, c tính, ch c năng c a protein
Các nhóm protein ch c năng cơ b n
Th o lu n, suy ng m, t tìm hi u thêm
M i quan h và s phù h p gi a c u trúc và ch c năng
c a các i ph n t sinh h c.
T i sao nhi u gi thi t g n ây có xu hư ng cho r ng
ARN là i phân t xu t hi n u tiên trong ti n hóa?
Néi dung

LƯ C S DI TRUY N H C

CÁC B NG CH NG CH NG MINH ADN LÀ
V T CH T MANG THÔNG TIN DI TRUY N

C U TRÚC, C TÍNH, CH C NĂNG C A ADN


C U TRÚC, C TÍNH, CH C NĂNG C A ARN


C U TRÚC, C TÍNH, CH C NĂNG C A PROTEIN


Q&A
Néi dung

LƯ C S DI TRUY N H C

CÁC B NG CH NG CH NG MINH ADN LÀ
V T CH T MANG THÔNG TIN DI TRUY N

C U TRÚC, C TÍNH, CH C NĂNG C A ADN


C U TRÚC, C TÍNH, CH C NĂNG C A ARN


C U TRÚC, C TÍNH, CH C NĂNG C A PROTEIN


Q&A
L−îc sö di truyÒn häc
• Di truy n h c là ngành khoa h c nghiên c u v c u
trúc, ch c năng, cơ ch ho t ng và v n ng c a v t
ch t (thông tin) di truy n t th h sang th h khác (
các m c khác nhau c a h th ng sinh v t, như
phân t , t bào, cơ th , qu n th ).

• ây là m t dòng chó thu n ch ng ư c sinh ra t m t
c p b , m có ki u gen g n gi ng nhau hoàn toàn
(dòng thu n).
– T n s m c các b nh lý
(r i lo n) di truy n thư ng
g p r t cao trong các
dòng thu n.


inh oàn Long B môn DI TRUY N H C
L−îc sö di truyÒn häc

• ây là m t àn chó con ư c sinh ra t m t c p b ,
m có ngu n g c t các dòng khác nhau.
– T p tính và các ki u hình
c a các con trong àn
r t khác nhau do ki u gen
c a chúng ư c t h p ng u
nhiên t h gen (v n khác
nhau) c a các t bào sinh d c
có ngu n g c t b và m .
– Tuy v y ph n l n các tính
tr ng c a chúng là gi ng,
ho c g n gi ng, ho c là
ki u hình trung gian c a
c a các ki u hình tìm th y
b và m .

inh oàn Long B môn DI TRUY N H C
L−îc sö di truyÒn häc

• Cơ ch nào ã gây nên nh ng hi n tư ng nêu trên?
• M c dù các hi n tư ng di truy n h c ư c quan tâm và
ng d ng ngay t th a sơ khai c a xã h i loài ngư i
(nh t là trong tr ng tr t và chăn nuôi), nhưng n t n
th th XX, ph n l n các nhà sinh h c (m t cách sai
l m) cho r ng:
– M i tính tr ng (k c các tính tr ng thu nh n
m i trong th i gian s ng) c a m t cá th có th
truy n ư c sang th h sau.
– Các c tính c a b , m ư c tr n l n (và
không phân tách tr l i ư c) trong th h con.

inh oàn Long B môn DI TRUY N H C
L−îc sö di truyÒn häc




Gregor Mendel (1822-1884), ng−êi ®−îc coi lµ
cha ®Î cña ngµnh Di truyÒn häc hiÖn ®¹i


inh oàn Long B môn DI TRUY N H C
L−îc sö di truyÒn häc
• Di truy n h c hi n i ư c ánh d u b t u b ng các thí
nghi m phân tích s lư ng (t l phân ly) c a các tính tr ng trong
các phép lai cây u Hà lan c a Gregor Mendel




NhÞ

Nhôy



inh oàn Long B môn DI TRUY N H C
L−îc sö di truyÒn häc 1 C t b nh
Hoa tr ng

(hoa c) t
các cây có
hoa màu tím

• Mendel ti n hành
lai gi a các cây
u thu c các Nh (hoa c)

dòng thu n khác Noãn (hoa cái)
2 Th ph n gi a
nh c a hoa
nhau b i t ng c p B ,M Hoa tím
tr ng v i noãn
c a hoa tím
tính tr ng tương (P)

ph n và theo dõi 3 Noãn sau khi th ph n,
s lư ng (t l ) phát tri n thành qu

phân ly c a các
tính tr ng trong
các th h con.

4 Cây ư c
• Hình nh này mô Th h con
tr ng t h t

t k thu t lai (F1)

cây u Hà Lan.

inh oàn Long B môn DI TRUY N H C
B ,M
(P) x




Th h con
(F1) x




Th h con
(F2)

inh oàn Long B môn DI TRUY N H C
L−îc sö di truyÒn häc MÀU HOA
Tím Tr ng



• Mendel ti n hành thí nghi m
v i 7 c p tính tr ng tương V TRÍ HOA

ph n khác nhau, t ó ưa ra nách nh


ba quy lu t: quy lu t ng tính MÀU H T
Vàng Xanh
(I), quy lu t phân tính (II) và
quy lu t phân ly c l p (III). D NG H T
Trơn Nhăn




• Trên cơ s ó, Mendel ưa ra
D NG QU
Tóp Ph ng

khái ni m v y u t di truy n
(inheritant factor), là ơn v di MÀU QU
Xanh Vàng

truy n. Ngày nay chúng ta ã
bi t y u t này là gen n m
trong các phân t axit nucleic. CHIÈU DÀI
THÂN

Cao Th p

inh oàn Long B môn DI TRUY N H C
L−îc sö di truyÒn häc
13.000 - 15.000 năm trư c: Phát tri n tr ng tr t
Thí nghi m c a Mendel (1986)
1869: Miescher l n u tiên tách chi t ư c ADN
Mô t nhi m s c th (1902 - 1904)
1929: Mô t ư c thành ph n c u t o ADN
Avery cung c p b ng ch ng cho th y ADN mang
1953: Watson và Crick mô t c u trúc chu i thông tin di truy n trong bi n n p vi khu n (1949)
xo n kép ADN, ch y u d a trên hình nh Mô t t bi n t bào h ng c u hnh li m (1956)
nhi u x tia X (c a Franklin và Wilkins)
Kornberg phát hi n ADN polymerase (1957)
Ch ng minh cơ ch sao chép ADN (1958)
1961 - 1966: Gi i mã các mã b ba (codon)
Phát hi n th y s t n t i c a enzym gi i h n (1962)
1967: Gellert phát hi n ra ADN ligase, enzym
n i các phân o n ADN v i nhau
Kh i u các nghiên c u công ngh ADN tái t h p c a
Boyer và cs. t i H Standford và Califonia (1972)
1975: Southern phát tri n k thu t th m tách
Southern cho phép xác nh trình t ADN c thù Sanger & Barrell, Maxam & Gilbert phát tri n các k thu t
gi i mã trình t ADN (1975 - 1977)
1980: Thi t l p ư c b n sơ b u tiên các
d u chu n ADN h gen ngư i Palmiter & Brinser t o ư c Chu t chuy n gen, Sprading &
Rubin t o ư c Ru i d m chuy n gen (1981 - 1982)
1985: Mullis và cs. phát minh ra k thu t PCR
xu t ý tư ng “D án h gen ngư i” (1986)
1987: Phát hi n gen gây b nh teo cơ Duchene
Phát hi n gen gây b nh xơ nang (1989)
1990: Kh i ng D án H gen ngư i (HGP)
Phát hi n gen gây b nh Huntington (1993)
1995: Phát minh ra chip ADN H gen u tiên ư c gi i mã - H. influenza (1995)
1999: Nhi m s c th ngư i u tiên ư c gi i mã
2006: Chính th c hoàn thành gi i trình t NST Hoàn thành gi i mã hai b n sao sơ b h gen ngư i (2003)
cu i cùng c a h gen ngư i (NST s 1)

inh oàn Long B môn DI TRUY N H C
Néi dung

LƯ C S DI TRUY N H C

CÁC B NG CH NG CH NG MINH ADN LÀ
V T CH T MANG THÔNG TIN DI TRUY N

C U TRÚC, C TÍNH, CH C NĂNG C A ADN


C U TRÚC, C TÍNH, CH C NĂNG C A ARN


C U TRÚC, C TÍNH, CH C NĂNG C A PROTEIN


Q&A
B ng ch ng v ADN là v t ch t di truy n
a)
Thí nghi m
c a Griffith (1928)
a) Vi khu n Streptoccoccus pneumoniae, S Tiêm
ch ng S c; chu t ch t khi b tiêm ch ng này b) Ch t



b) D ng t bi n R không gây ch t
t bi n
S Tiêm
R S ng
c)
c) D ng S b b t ho t (ch t) b i nhi t không
gây ch t khi tiêm vào chu t


S Gây ch t b i nhi t Tiêm
S ng
d) H n h p g m d ng S b b t ho t và d ng R d)
khi tiêm vào chu t làm chu t ch t


Phân tích
Gây ch t H n mô
S b i nhi t h p
Tiêm Ch t


R Dòng S ph c h i


inh oàn Long B môn DI TRUY N H C
B ng ch ng v ADN là v t ch t di truy n
Thí nghi m c a Griffith (1928)
d)
d) Griffith k t lu n r ng ã
có y u t truy n gen (bi n
n p) t ch ng S chuy n
sang ch ng R, và chuy n Phân tích
Gây ch t H n mô
ch ng R → S.
S b i nhi t h p
Tiêm Ch t

Dòng S ph c h i
R

Thí nghi m c a Avery, MacLeod và McCarty (1944)
e) Avery và cs. tinh s ch ADN
e)
t ch ng S và cùng ch ng
R r i tiêm cho chu t. Chu t
ch t. i u này cho th y ADN
chính là y u t ư c truy n Phân tích
t S → R trong thí nghi m H n mô
Gây ch t b i nhi t
c a Griffith h p
S
Tiêm
Ch t


ADN Dòng S ph c h i
R


inh oàn Long B môn DI TRUY N H C
B ng ch ng v ADN là v t ch t di truy n
Thí nghi m c a Avery, MacLeod và McCarty (1944)




inh oàn Long B môn DI TRUY N H C
B ng ch ng v ADN là v t ch t di truy n
Thí nghi m c a Hershey và Chase (1953)
a) Protein 1. Phagơ g n vào t bào
v b) vi khu n ch
a) & b) C u trúc và chu
ADN
trình s ng c a phagơ T2. 5. T bào vi
khu n b phân
gi i và gi i
phóng phagơ



2. Phagơ tiêm h
gen c a nó vào t
Lõi bào vi khu n
Thành t
bào ch
4. óng gói h t phagơ m i 3. H gen phagơ sao chép và
Phagơ T2 d ch mã trong t bào ch
Không
phát x
Ly
tâm

Phát x
Phagơ T2 Gây nhi m E. coli và ADN phagơ ư c Gây nhi m
nuôi c y trên môi ánh d u v i 32P vi khu n
trư ng ch a 32P Phát x



Ly
tâm

Không
Gây nhi m E. coli và nuôi Protein v phagơ Gây nhi m
Phagơ T2 phát x
trên môi trư ng ch a 35S ư c ánh d u 35P vi khu n

inh oàn Long B môn DI TRUY N H C
B ng ch ng v ADN là v t ch t di truy n
Thí nghi m c a Hershey và Chase (1953)




inh oàn Long B môn DI TRUY N H C
Néi dung

LƯ C S DI TRUY N H C

CÁC B NG CH NG CH NG MINH ADN LÀ
V T CH T MANG THÔNG TIN DI TRUY N

C U TRÚC, C TÍNH, CH C NĂNG C A ADN


C U TRÚC, C TÍNH, CH C NĂNG C A ARN


C U TRÚC, C TÍNH, CH C NĂNG C A PROTEIN


Q&A
Thành ph n c u t o c a các axit nucleic

’ ’

’ ’ ’ ’
’ ’ ’ ’

a) Ribose b) Deoxyribose Thymine (T) Cytosine (C) Uracil (U)

Baz¬ nit¬ cña ADN Baz¬ nit¬ cña ARN






’ ’
’ ’ Adenine (A) Guanine (G)
c) Deoxyribose monophosphate Baz¬ nit¬ cña ADN vµ ARN
−êng ribose cña c¸c nucleotide. CÊu tróc baz¬ nit¬ cña c¸c nucleotide. DÉn xuÊt cña
a) −êng ribose cã nhãm –OH ë vÞ pyrimidine gåm thymine (T), cytosine (C) vµ uracil (U);
trÝ C-2’, b) −êng deoxyribose cã dÉn xuÊt cña purine gåm adenine (A) vµ guanine (G).
gèc –H ë vÞ trÝ C-2’, c) ®−êng ADN ®−îc cÊu t¹o tõ dA, dT, dG vµ dC, trong khi ARN
deoxyribose mang nhãm phosphate ®−îc cÊu t¹o tõ A, U, G vµ C.
inh oàn Long B môn DI TRUY N H C
Thành ph n c u t o c a các axit nucleic
Tên g i các nucleotide là thành ph n c a ADN và ARN
Bazơ nitơ Nucleoside Nucleotide

Adenine (A) Adenosine Deoxyadenosine 5’- monophosphate

Guanine (G) Guanosine Deoxyguanosine 5’- monophosphate

Thymine (T) Thymidine Deoxythymidine 5’- monophosphatea

Cytosine (C) Cytidine Deoxycytidine 5’- monophosphate

Uracil (U) Uridine Uridine 5’- monophosphateb

a Có ADN, nhưng không có ARN
b Có ARN, nhưng không có ADN



inh oàn Long B môn DI TRUY N H C
Thành ph n c u t o c a ADN
M i bazơ nitơ u có 2 d ng h bi n




inh oàn Long B môn DI TRUY N H C
C u trúc hóa h c c a ADN
Các bazơ nitơ
u 5’




Các liên k t
phosphodieste




u 3’
inh oàn Long B môn DI TRUY N H C
C u trúc hóa h c c a ADN
Nguyên t c Chargaff
THÀNH PH N CÁC NUCLEOTIDE THEO T L PH N TRĂM (%) M TS LOÀI

Lo i Adenine Guanine Cytosine Tymine
Virót
Thùc khuÈn thÓ T2 32,6 18,1 16,6 32,6
Herpes simplex 18,8 37,7 35,6 12,8
Phag¬ λ 26,0 23,8 24,3 25,8
Pseudorables 13,2 37,0 36,3 13,5
Vi khuÈn
Escherichia coli 26,0 24,9 25,2 23,9
Diplococcus pneumoniae 29,8 20,5 18,0 31,6
Micrococcus hysodeikticus 14,4 37,3 34,6 13,7
Ramibacterium ramosum 35,1 14,9 15,2 34,8
NÊm men
Neurospora crassa 23,0 27,1 26,6 23,3
Aspergillus niger 25,0 25,1 25,0 24,9
Saccharomyces cerevisiae 31,7 18,3 17,4 32,6
Sinh vËt nh©n chuÈn
Arachis hypogaea (®Ëu) 32,1 17,6 18,0 32,2
Bombyx mori (t»m) 30,7 18,9 19,4 31,1
Drosophila melanogaster 30,7 19,6 20,2 29,4
Homo sapiens (ng−êi)
TÕ bµo gan 30,3 19,5 19,9 30,3
Tinh trïng 29,8 20,2 18,2 31,8
TuyÕn gi¸p 30,5 19,9 20,6 28,9
Nicotinana tabacum 29,3 23,5 16,5 30,7
Rana pipiens (Õch) 26,3 23,5 23,8 26,4
Zea mays (ng«) 25,6 24,5 24,6 25,3


inh oàn Long B môn DI TRUY N H C
C u trúc hóa h c c a ADN
Mô hình Watson - Crick




inh oàn Long B môn DI TRUY N H C
C u trúc hóa h c c a ADN




ư ng

ư ng



Liên k t hydro không hình thành (ho c
ch hình thành y u) gi a các c p bazơ
nitơ k t c p không úng; ho c khi các
nucletide trên hai m ch m c dù k t c p
úng, nhưng không quay ngư c chi u.



Các liên k t hydro
inh oàn Long B môn DI TRUY N H C
C u trúc hóa h c c a ADN
1 vòng xo n = 34Å = 10,5 nucleotide Liên k t hydro

Bazơ nitơ

Khung ư ng - Khe
phosphate ph




Khe
chính




H O C trong C và N trong P
chu i este các bazơ

inh oàn Long B môn DI TRUY N H C
C u trúc hóa h c c a ADN
Khe chính Khe chính




Khe ph Khe ph


Khe chính Khe chính




Khe ph Khe ph

inh oàn Long B môn DI TRUY N H C
C u trúc hóa h c c a ADN
ADN có nhi u d ng c u hình, trong ó ph bi n là d ng B




A - ADN B - ADN C - ADN D - ADN Z - ADN

M TS D NG C U HÌNH KHÔNG GIAN C A ADN
D¹ng ADN
§Æc tÝnh
A B Z
ChiÒu quay cña chuçi xo¾n VÒ phÝa ph¶i VÒ phÝa ph¶i VÒ phÝa tr¸i
Nång ®é muèi cao,
§iÒu kiÖn h×nh thµnh §é Èm ~ 75% §é Èm ~ 92%
hoÆc methyl hãa ADN
§−êng kÝnh (Å) 26 Å 20 Å 18 Å
Sè cÆp baz¬ nit¬ trªn mét vßng xo¾n 11 10 12
O O
Gãc nghiªng gi÷a hai cÆp baz¬ nit¬ kÕ tiÕp 33 36 60O
§é cao theo trôc chuçi xo¾n cña mét cÆp baz¬ nit¬ (Å) 2,6 Å 3,4 Å 3,7 Å
§é cao theo trôc chuçi xo¾n cña mét vßng xo¾n (Å) 28 Å 34 Å 45 Å
§Æc ®iÓm khe chÝnh HÑp vµ s©u Réng vµ s©u Ph¼ng
§Æc ®iÓm khe phô Réng vµ n«ng HÑp vµ s©u HÑp vµ s©u

inh oàn Long B môn DI TRUY N H C
Tính ch t bi n tính và h i tính c a ADN
S i ADN xo n kép




NHI T TĂNG
Bi n tính
hoàn toàn Vùng giàu A:T
Tm = Nhi t
bi n tính trư c
bi n tính
h p th UV




Bi n tính
m t ph n

NHI T TĂNG THÊM




Nhi t tăng



Các m ch ADN bi n tính hoàn toàn


inh oàn Long B môn DI TRUY N H C
Tính ch t bi n tính và h i tính c a ADN
Công th c ư c tính Tm

Công th c c a Wallace (1989) v i các
phân o n ADN ng n hơn 25 bp
Tm = 2oC x (A + T) + 4oC x (G + C)



Công th c c a Meinkoth - Wahl (1989)
v i các phân o n ADN dài hơn 25 bp

Tm = 81,5oC + 16,6(log10[Na+]) + 0,41(%[G+C]) – (500/n) – 0,61(%FA)

inh oàn Long B môn DI TRUY N H C
M t s tính ch t c a ADN
ADN có th t n t i d ng m ch th ng …
S i ADN
xo n kép
Các i m
kh i u sao chép

Các m ch
ADN m i

Các ơn v
sao chép

ơn v
sao chép
m r ng



Các m ch
ADN m i


SAO CHÉP (TÁI B N) ADN H GEN NHÂN EUKARYOTE
… ho c …
inh oàn Long B môn DI TRUY N H C
M t s tính ch t c a ADN
… m ch vòng



S i ADN
xo n kép




M ch
ADN m i


i m kh i u sao chép
(ch có 1 ơn v tái b n)

SAO CHÉP (TÁI B N) ADN H GEN PROKARYOTE




inh oàn Long B môn DI TRUY N H C
M t s tính ch t c a ADN
Các bazơ nitơ có th văng ra ngoài chu i xo n kép




Bazơ nitơ
"văng ra"




inh oàn Long B môn DI TRUY N H C
M t s tính ch t c a ADN
ADN và các c u trúc siêu cu n




inh oàn Long B môn DI TRUY N H C
Ch c năng sinh h c c a ADN
ph n l n sinh v t (ch tr m t s virut), ADN có ch c năng
là v t ch t mang thông tin di truy n. m nhi m ch c
năng này, ADN có b n c tính cơ b n sau:
1. Có kh năng lưu gi thông tin d ng b n v ng c n cho
vi c c u t o, sinh s n và ho t ng c a t bào.
2. Có kh năng sao chép chính xác thông tin di truy n
có th ư c truy n t th h này sang th h k ti p
thông qua quá trình phân bào hay quá trình sinh s n.
3. Thông tin ch a ng trong v t ch t di truy n ph i ư c
dùng t o ra các phân t c n cho c u t o và các ho t
ng c a t bào.
4. V t li u di truy n có kh năng bi n i, nhưng nh ng
thay i này ( t bi n) ch x y ra t n s th p.
inh oàn Long B môn DI TRUY N H C
Ch c năng sinh h c c a ADN
Ch c năng c a ADN bi u hi n qua “Nguyên lý trung tâm”




inh oàn Long B môn DI TRUY N H C
Ch c năng sinh h c c a ADN
Ch c năng c a ADN bi u hi n qua “Nguyên lý trung tâm”




inh oàn Long B môn DI TRUY N H C
Néi dung

LƯ C S DI TRUY N H C

CÁC B NG CH NG CH NG MINH ADN LÀ
V T CH T MANG THÔNG TIN DI TRUY N

C U TRÚC, C TÍNH, CH C NĂNG C A ADN


C U TRÚC, C TÍNH, CH C NĂNG C A ARN


C U TRÚC, C TÍNH, CH C NĂNG C A PROTEIN


Q&A
Thành ph n và c u trúc hóa h c c a ARN
ARN thư ng có c u trúc m ch ơn polynucleotide, ư c hình thành
t liên k t c ng hóa tr gi a b n lo i ribonucleotide A, G, C và U.
Có nhi u lo i ARN v i ch c năng khác nhau, trong ó 3 lo i quan
tr ng và ph bi n nh t là mARN, tARN và rARN.
Thu c tính các lo i ARN E. coli
Lo i ARN H s l ng (S) MW (x1000) S nucleotit % trong t bào
trung bình
mARN 6 – 25 25 – 1000 75 – 300 ~2

tARN ~4 23 – 30 73 – 95 ~ 16

rARN 5 ~ 35 ~ 100

16 ~ 550 ~ 1500 82%

23 ~ 1100 ~ 3100

inh oàn Long B môn DI TRUY N H C
Thành ph n và c u trúc hóa h c c a ARN
V mARN




inh oàn Long B môn DI TRUY N H C
Thành ph n và c u trúc hóa h c c a ARN
V tARN
OH
3’
A
C
P C
5’

(A) VÞ trÝ g¾n axit amin


Vßng TΨC
Vßng D

Vßng TΨC
5’
T Ψ C 3’

Vßng hay
biÕn ®æi
Vßng Vßng D
§èi m·

(B)
Bé ba ®èi m




H×nh 1.6. CÊu tróc phæ biÕn cña tARN.
(A) CÊu tróc m¹ch polyribonucleotit d¹ng l¸
ph©n nh¸nh, (B) CÊu tróc kh«ng gian h×nh thµnh Bé ba ®èi m
do chuçi polyribonucleotit gÊp nÕp vµ xo¾n l¹i

inh oàn Long B môn DI TRUY N H C
Thành ph n và c u trúc hóa h c c a ARN
V rARN
Th nh phÇn cÊu t¹o cña c¸c ribosome
VÞ trÝ ho¹t ®éng cña ribosome C¸c tiÓu phÇn Lo¹i rARN Sè protein
TÕ bµo chÊt ®éng vËt * 40S 18S 33
60S 28S - 5,8S - 5S 49
Ti thÓ ®éng vËt 28S 12S 31
39S 16S 48
TÕ bµo chÊt thùc vËt * 40S 18 ~35
60S 28S - 5,8S - 5S ~50
Ti thÓ thùc vËt 30S 18S > 25
50S 26S - 5S > 30
L¹p thÓ thùc vËt 30S 16S 22-31
50S 23S - 5S - 4,5S 32-36
Vi khuÈn (prokaryote) * 30S 16S 21
50S 23S - 5S 31
Vi khuÈn cùc ®oan (archaea) 30S 16S 26-27
50S 23S - 5S 30-31

inh oàn Long B môn DI TRUY N H C
Ch c năng sinh h c c a ARN
Khác v i ADN, trong t bào có nhi u lo i ARN; m i lo i m
nh n m t ch c năng sinh h c riêng bi t. Nhìn chung, có th
tóm t t các ch c năng cơ b n c a ARN như sau:

1. Ch c năng v n chuy n thông tin di truy n: ây là vai trò
ch y u c a mARN. Phân t này là b n phiên mã c a
gen (ADN), ng th i là khuôn t ng h p protein.

2. Ch c năng tham gia t ng h p protein: ch c năng này
bi u hi n qua vai trò c a tARN là phân t nh n bi t và
l p ghép chính xác các axit amin tương ng v i b ba
i mã trên phân t mARN; và vai trò c a rARN là thành
ph n c u trúc nên ribosome là nơi t ng h p protein.



inh oàn Long B môn DI TRUY N H C
Ch c năng sinh h c c a ARN
3. Ch c năng hoàn thi n các ARN: các snARN là thành
ph n hình thành nên spliceosome là ph c h p có vai trò
trong vi c c t các intron và n i các exon trong quá trình
hoàn thi n mARN sinh v t nhân th t. Các snoARN
tham gia vào quá trình hoàn thi n các phân t rARN t
các phân t ti n thân (ti n-rARN) t i h ch nhân. sinh
v t nhân sơ, M1 ARN là thành ph n c a ribonuclease P
có ch c năng hoàn thi n tARN t ti n-tARN. trùng
mũi khoan, gARN có vai trò trong biên t p mARN.
4. Ch c năng xúc tác: m t s ARN có kích thư c nh có
tính ch t xúc tác gi ng enzym, còn g i là các ribozyme.
B n thân m t s snoARN và M1 ARN tham gia vào các
quá trình hoàn thi n rARN và tARN ư c nêu trên
cũng có ho t tính xúc tác.
inh oàn Long B môn DI TRUY N H C
Ch c năng sinh h c c a ARN
5. Ch c năng i u hòa ho t ng c a gen: m c dù m i ch
ư c phát hi n g n ây (Fire và Mellor, 1998), song s
có m t ph bi n c a các lo i ARN tham gia i u hòa
ho t ng c a gen tìm th y h u h t các loài sinh v t
nhân th t ư c nghiên c u n nay cho th y, ây có l
là m t ch c năng cơ b n c a ARN v n ã hình thành t
lâu trong quá trình ti n hóa. Nhóm các ARN có ch c
năng này ư c g i chung là ARN can thi p (ARNi,
interfering RNA), ư c chia làm hai nhóm nh có hình
th c ho t ng tương i khác bi t là siARN (small
intefering RNA) và miARN (micro RNA).




inh oàn Long B môn DI TRUY N H C
Ch c năng sinh h c c a ARN
Lo¹i ARN Chøc n¨ng sinh häc
mARN th«ng tin TruyÒn th«ng tin qui ®Þnh tr×nh tù axit amin cña protein tõ ADN tíi ribosome
tARN DÞch c¸c m· bé ba trªn ph©n tö mARN thµnh c¸c axit amin trªn ph©n tö protein
rARN CÊu tróc ribosome vµ cã vai trß xóc t¸c (ribozyme) h×nh thµnh liªn kÕt peptide
TiÒn-ARN S¶n phÈm trùc tiÕp cña qu¸ tr×nh phiªn m·; lµ ph©n tö tiÒn th©n h×nh thµnh nªn
mARN, tARN vµ rARN hoµn thiÖn. ë eukaryote, mét sè ph©n ®o¹n ARN intron
cã vai trß xóc t¸c (ribozyme) ph¶n øng c¾t chÝnh nã
snARN (ARN nh©n kÝch Cã vai trß xóc t¸c vµ cÊu tróc trong phøc hÖ c¾t intron (spliceosome) tõ c¸c
th−íc nhá) ph©n tö tiÒn-mARN ®Ó t¹o thµnh mARN hoµn thiÖn
SRP ARN Lµ thµnh phÇn cña phøc hÖ ARN-protein lµm nhiÖm vô nhËn biÕt c¸c peptide tÝn
(ARN nhËn biÕt tÝn hiÖu) hiÖu trong ph©n tö protein míi ®−îc tæng hîp, gióp "gi¶i phãng" c¸c ph©n tö
protein nµy khái m¹ng l−íi néi chÊt
sno ARN (ARN h¹ch Tham gia hoµn thiÖn rARN tõ ph©n tö tiÒn-rARN vµ ®ãng gãi ribosome t¹i h¹ch
nh©n kÝch th−íc nhá) nh©n
Telomerase-ARN Thµnh phÇn cña enzym telomerase; lµm khu«n ®Ó tæng hîp tr×nh tù ADN lÆp l¹i
t¹i c¸c ®Çu mót nhiÔm s¾c thÓ ë eukaryote
gARN Tham gia vµo qu¸ tr×nh "biªn tËp" ADN ti thÓ ë thùc vËt vµ nguyªn sinh ®éng
vËt, vµ ADN l¹p thÓ ë thùc vËt
tmARN ARN tÝch hîp chøc n¨ng cña tARN vµ mARN, gióp gi¶i phãng ribosome khái sù
"t¾c nghÏn" khi dÞch m· c¸c ph©n tö mARN bÞ mÊt bé ba m· kÕt thóc (stop
codon).
M1 ARN Thµnh phÇn ARN cã vai trß xóc t¸c cña ARNase P, tham gia hoµn thiÖn c¸c
ph©n tö tARN ë prokaryote
C¸c lo¹i ARN can thiÖp Tham gia ®iÒu hßa biÓu hiÖn gen ë eukaryote
(siARN vµ miARN)

inh oàn Long B môn DI TRUY N H C
Ch c năng sinh h c c a ARN
mARN
guide ARN (gARN)
iÓm c¾t

AGA


gARN 5’



3’ C i thªm mét sè nucleotide U




UUU
AGA



5’



3’

Biªn tËp mARN ë trïng mòi khoan
(Trypanosome). gARN kÕt cÆp víi ®o¹n trình tù
®Æc tr−ng trªn mARN. o¹n trình tù bæ sung
(AGA) ë gARN ®−îc dïng lµm khu«n ®Ó cµi thªm
mét sè nucleotide U vµo mARN. Trong vÝ dô trªn
®©y, cã mét liªn kÕt "láng lÎo" G-U gi a hai ARN.

inh oàn Long B môn DI TRUY N H C
Ch c năng sinh h c c a ARN
tmARN
a) CÊu tróc mARN ë vi khuÈn E. coli b) C¬ chÕ kh«i phôc v kÕt thóc dÞch m bëi tmARN
MiÒn gièng
tARN tmARN


Thïy mang
axit amin Ribosome bÞ "¸ch tmARN nhËn ra vµ tmARN kh«i phôc l¹i
t¾c" do thiÕu m· liªn kÕt vµo vÞ trÝ A qu¸ tr×nh tæng hîp
Thïy TΨC kÕt thóc (sù kÕt cña ribosome protein
Thïy DHU
thóc dÞch m·
kh«ng thÓ diÔn ra) mARN ®ét biÕn mÊt m· kÕt
thóc t¸ch khái ribosome vµ bÞ
ph©n hñy ngay




C¸c protein ®−îc
"®¸nh dÊu" (mang "tÝn tmARN "g¾n" tr×nh tù axit amin "tÝn hiÖu";
hiÖu") bÞ ph©n hñy DÞch m· kÕt thóc t¹i m· kÕt thóc cña tmARN
ngay
MiÒn gièng mARN


A
CGUC C A
CGACAU U U C¸c m· kÕt
A thóc dÞch m·
UAGUCGCAAACGAAAACUACGCUUUAACCGCAG C U U A

vÞ trÝ kh«i phôc tæng hîp protein


CÊu tróc bËc hai (gi¶n l−îc) v m« h×nh c¬ chÕ ho¹t ®éng cña tmARN ë E. coli.



inh oàn Long B môn DI TRUY N H C
Néi dung

LƯ C S DI TRUY N H C

CÁC B NG CH NG CH NG MINH ADN LÀ
V T CH T MANG THÔNG TIN DI TRUY N

C U TRÚC, C TÍNH, CH C NĂNG C A ADN


C U TRÚC, C TÍNH, CH C NĂNG C A ARN


C U TRÚC, C TÍNH, CH C NĂNG C A PROTEIN


Q&A
Protein là s n ph m c a quá trình d ch mã
a) Prokaryote b) Eukaryote

Mµng tÕ bµo Sinh chÊt
nh©n
ADN
Nh©n
tiÒn-
TÕ bµo chÊt mARN
mARN vËn chuyÓn

Ribosome

Protein
(polypeptide)

DÞch m ë prokaryote v eukaryote. a) ë prokaryote, mARN ®−îc ARN pol
tæng hîp kh«ng cÇn söa ®æi mµ cã thÓ ®−îc dïng ngay ®Ó dÞch m·. Do kh«ng
cã mµng nh©n, dÞch m· cã thÓ b¾t ®Çu ngay c¶ khi phiªn m· ch−a kÕt thóc (sù
kÕt cÆp phiªn m· - dÞch m·). b) ë eukaryote, b¶n phiªn m· ®Çu tiªn (tiÒn-
mARN) ph¶i qua qu¸ tr×nh hoµn thiÖn (gåm l¾p mò m7G, g¾n ®u«i polyA vµ c¾t
bá c¸c intron) míi ®−îc dïng ®Ó dÞch m·; chØ khi mARN hoµn thiÖn ®−îc vËn
chuyÓn ra tÕ bµo chÊt sù dÞch m· míi diÔn ra.

inh oàn Long B môn DI TRUY N H C
C u trúc hóa h c c a protein
C u trúc b c 1 C u trúc b c 2
Protein có 4 b c c u trúc
C u trúc b c 3 Chu i xo n α




M t ph ng β
Mi n ch c năng

C u trúc b c 4




inh oàn Long B môn DI TRUY N H C
C u trúc hóa h c c a protein
C U TRÚC B C 1




u amino u carboxyl
( u N) ( u C)

Liên k t
peptit




Liên k t
peptit

inh oàn Long B môn DI TRUY N H C
C u trúc hóa h c c a protein
C U TRÚC B C 2 M tc t ng

uN




uN uC
3,6 aa / vòng xo n
M t c t ngang




uC
C u trúc d ng chu i xo n α C u trúc d ng m t ph ng β

inh oàn Long B môn DI TRUY N H C
C u trúc hóa h c c a protein
C U TRÚC B C 3



Ph n lõi

óng gói protein

NƯ C
Bi n tính


B m t


Protein d ng chu i Phân tprotein óng gói d ng
polypeptit (b c 1) c u trúc b c 3
(hình thành m t s mi n ch c năng)




inh oàn Long B môn DI TRUY N H C
C u trúc hóa h c c a protein
S t óng gói c a
protein ph thu c
vào tính ch t c a
các axit amin là
thành ph n c u trúc
lên chu i polypeptit
C u trúc hóa h c c a protein
C U TRÚC B C 4




inh oàn Long B môn DI TRUY N H C
Các nhóm protein ch c năng cơ b n
Nhãm pr«tªin Ho¹t tÝnh vµ chøc n¨ng sinh häc VÝ dô
Pr«tªin vËn chuyÓn C¸c ph©n tö di chuyÓn bªn trong vµ gi a c¸c tÕ bµo Albumin, hemoglobulin,
hoÆc gi a m¹ch m¸u vµ hÖ b¹ch huyÕt lipoprotein, transferin, v.v...
Enzym Lµ c¸c chÊt xóc t¸c h u c¬ thóc ®Èy c¸c ph¶n øng ho¸ Alcohol dehydrogenaza,
häc nh−ng b¶n th©n chóng kh«ng mÊt ®i trong qu¸ trình hexokinaza, proteaza, v.v...
ph¶n øng
G-protein TruyÒn tÝn hiÖu tõ bªn ngoµi tÕ bµo vµo bªn trong tÕ bµo Transductin, Gs, αi
b»ng viÖc kÝch thÝch s¶n xuÊt c¸c chÊt truyÒn tÝn hiÖu
thø hai
Pr«tªin mang th«ng tin Bao gåm c¸c hormon vµ c¸c pr«tªin kh¸c, mµ khi ho¹t Insulin, glucagon, hormon,
(chÊt chñ vËn, chÊt ®èi ®éng, chóng t¹o ra c¸c ho¹t ®éng sinh lý vµ trao ®æi prolactin, v.v...
vËn) chÊt ë c¸c m«, tÕ bµo ®Æc thï cña chóng
Pr«tªin vËn ®éng (pr«tªin T−¬ng t¸c cña actin vµ myosin t¹o nªn c¸c ho¹t ®éng Actin, myosin
c¬) co vµ duçi c¬
Pr«tªin b¶o vÖ Cã chøc năng b¶o vÖ chèng l¹i sù x©m nhËp cña vi Kh¸ng thÓ, interferon,
khuÈn vµ c¸c hîp chÊt ®éc interleukin, v.v...
Pr«tªin thô thÓ C¸c pr«tªin xuyªn mµng lµ ph©n tö truyÒn th«ng tin C¸c thô thÓ insulin vµ
trung gian tõ c¸c hãcm«n hoÆc c¸c chÊt dÉn truyÒn adrenalin trªn bÒ mÆt tÕ
thÇn kinh trong c¸c ho¹t ®éng sinh lý néi bµo bµo
Pr«tªin ®iÒu ho iÒu hoµ ho¹t ®éng cña gen vµ tÕ bµo C¸c chÊt kìm h·m hoÆc øc
chÕ ho¹t ®éng phiªn m·,
dÞch m· trong tÕ bµo
Pr«tªin cÊu tróc T¹o nªn cÊu tróc hình d¹ng cña c¸c c¬ quan tö bªn Cytochrom, cytoskeleton,
trong tÕ bµo, còng nh− b¶n th©n tÕ bµo. histon, ribosom, v.v...
C¸c lo¹i pr«tªin kh¸c Bao gåm c¸c lo¹i pr«tªin t¹o kªnh trªn mµng tÕ bµo cho C¸c pr«tªin kªnh xuyªn
phÐp c¸c ion ra vµo tÕ bµo theo ph−¬ng thøc chñ ®éng, mµng ion Cl-, K+, Na+, v.v...
vµ c¸c lo¹i pr«tªin ®Æc biÖt liªn quan ®Õn sù trao ®æi tÝn
hiÖu gi÷a c¸c tÕ bµo

inh oàn Long B môn DI TRUY N H C
Th th là m c tiêu tác d ng c a thu c
(A)

Renin
Angiotensinogen (MW 57000)


Angiotensin I
ACE


Angiotensin II


(B) Angiotensin Angiotensin II
Receptor TÕ bµo c¬ tr¬n thµnh m¹ch
Pho spholipaza (bÊt
G-pr«tªin ho¹t)
(bÊt ho¹t )
G- pr«tªin (ho¹t Phosph olipaza (ho¹t
®éng) ® én g)



Co c¬


HuyÕt ¸p t¨ng


HÖ thèng renin - angiotensin trong qu¸ tr×nh ®iÒu hoµ huyÕt ¸p.

A) Anginotensinogen ®−îc c¾t b»ng renin ®Ó thu ®−îc angiontensin I. ChÊt nµy sau ®ã ®−îc c¾t
b»ng ACE ®Ó thu ®−îc angiontensin II. B) angiotensin II t¸c ®éng lªn hÖ angiotensin receptor trªn
mµng tÕ bµo c¬ tr¬n thµnh m¹ch m¸u, qua ®ã lµm t¨ng hµm l−îng Ca2 + trong tÕ bµo chÊt, vµ v× vËy
thµnh m¹ch m¸u co, huyÕt ¸p t¨ng.

inh oàn Long B môn DI TRUY N H C
Ví d v protein th th và ch t iv n
(A)
Histamine

Thµnh tÕ bµo mµng nhµy d¹ dµy



Ph¶n øng: tiÕt axÝt chlohydric (HCl) LoÐt d¹ d y


(B)




Receptor histamine H2 t×m thÊy trªn tÕ bµo mµng nhµy d¹ dµy, liªn quan ®Õn sù tiÕt
ra HCl vµo trong d¹ dµy. HCl cã vai trß quan träng trong qu¸ tr×nh tiªu ho¸ vµ kh¸ng
khuÈn, nh−ng lµ t¸c nh©n g©y loÐt d¹ dµy.
A) S¬ ®å m« t¶ vai trß cña H2-receptor trong bÖnh loÐt d¹ dµy. B) Cimetidine lµ chÊt ®èi
vËn trªn H2-receptor, vµ lµ d−îc chÊt ch÷a loÐt d¹ dµy theo c¬ chÕ ®èi vËn receptor
histamine H2 ®−îc sö dông ®Çu tiªn trong l©m sµng.



inh oàn Long B môn DI TRUY N H C
CHƯƠNG 2. C U TRÚC, C TÍNH, CH C NĂNG C A
CÁC I PHÂN T SINH H C – ADN, ARN & PROTEIN




Q&A
Đề thi vào lớp 10 môn Toán |  Đáp án đề thi tốt nghiệp |  Đề thi Đại học |  Đề thi thử đại học môn Hóa |  Mẫu đơn xin việc |  Bài tiểu luận mẫu |  Ôn thi cao học 2014 |  Nghiên cứu khoa học |  Lập kế hoạch kinh doanh |  Bảng cân đối kế toán |  Đề thi chứng chỉ Tin học |  Tư tưởng Hồ Chí Minh |  Đề thi chứng chỉ Tiếng anh
Theo dõi chúng tôi
Đồng bộ tài khoản