Luận văn: NGHIÊN CỨU PHÂN LOẠI, KHẢ NĂNG PHÂN HỦY DDT VÀ SINH LACCASE CỦA CHỦNG NẤM SỢI PHÂN LẬP TỪ ĐẤT Ô NHIỄM HỖN HỢP THUỐC TRỪ SÂU

Chia sẻ: carol123

DDT (Dichloro - Trichloroethane Diphenyl) là một trong những thuốc trừ sâu tổng hợp đƣợc biết đến nhiều nhất. DDT đƣợc tổng hợp đầu tiên vào năm 1874, nhƣng thuộc tính thuốc trừ sâu của DDT thì cho đến 1939 mới đƣợc khám phá. Vào những năm đầu của Chiến tranh Thế giới thứ II, DDT đƣợc sử dụng với lƣợng lớn để kiểm soát muỗi truyền bệnh sốt rét, bệnh sốt phát ban, và các bệnh do côn trùng khác trong cả quân đội lẫn dân cƣ. DDT trở thành loại thuốc trừ sâu phổ biến sử dụng trong nông nghiệp. Chúng có mặt ở khắp...

Bạn đang xem 20 trang mẫu tài liệu này, vui lòng download file gốc để xem toàn bộ.

Nội dung Text: Luận văn: NGHIÊN CỨU PHÂN LOẠI, KHẢ NĂNG PHÂN HỦY DDT VÀ SINH LACCASE CỦA CHỦNG NẤM SỢI PHÂN LẬP TỪ ĐẤT Ô NHIỄM HỖN HỢP THUỐC TRỪ SÂU

ĐẠI HỌC THÁI NGUYÊN
TRƢỜNG ĐẠI HỌC SƢ PHẠM
----------------///----------------




Đào Thị Ngọc Ánh




NGHIÊN CỨU PHÂN LOẠI, KHẢ NĂNG PHÂN HỦY DDT
VÀ SINH LACCASE CỦA CHỦNG NẤM SỢI PHÂN LẬP TỪ ĐẤT
Ô NHIỄM HỖN HỢP THUỐC TRỪ SÂU




LUẬN VĂN THẠC SĨ SINH HỌC




Thái Nguyên - 2009


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
ĐẠI HỌC THÁI NGUYÊN
TRƢỜNG ĐẠI HỌC SƢ PHẠM
----------------///----------------




Đào Thị Ngọc Ánh




NGHIÊN CỨU PHÂN LOẠI, KHẢ NĂNG PHÂN HỦY
DDT VÀ SINH LACCASE CỦA CHỦNG NẤM SỢI
PHÂN LẬP TỪ ĐẤT Ô NHIỄM HỖN HỢP THUỐC TRỪ SÂU




: Sinh học thực nghiệm
Chuyên ngành
Mã số : 60.42.30




NGƢỜI HƢỚNG DẪN KHOA HỌC: PGS.TS Đặng Thị Cẩm Hà




Thái Nguyên - 2009



Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
Lời Cảm Ơn !

Trong quá trình nghiên cứu vừa qua, tôi gửi lời cảm ơn chân thành và
sâu sắc đến sự hướng dẫn, chỉ bảo tận tình của PGS.TS. Đặng Thị Cẩm Hà,
và các anh chị trong nhóm nghiên cứu Công nghệ sinh học xử lý khử độc các
chất ô nhiễm hữu cơ khó phân hủy, phòng Công nghệ Sinh học Môi trường,
đặc biệt là Ths. Nguyên Bá Hữu, KS. Đàm Thúy Hằng, KS.Nguyễn Nguyên
Quang, KS. Nguyễn Quang Huy.

Tôi cũng xin bày tỏ lòng biết ơn tới Khoa sau đại học, Khoa Sinh-Kỹ
thuật nông nghiệp – Trường đại học Sư phạm – Đại Học Thái Nguyên và lãnh
đạo Viện Công nghệ sinh học, Viện Khoa học và Công nghệ Việt Nam, đã tận
tình dạy dỗ và tạo mọi điều kiện cho tôi hoàn thành khóa học và thực hiện
luận văn này.

Bên cạnh đó, tôi xin cảm ơn những người thân trong gia đình và bạn bè
đã tạo điều kiện động viên giúp đỡ tôi cả về vật chất và tinh thần để tôi có thể
hoàn thành bản luận văn này.



Hà Nội, ngày 25 tháng 10 năm 2009




Đào Thị Ngọc Ánh




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
BẢNG CHỮ VIẾT TẮT


2,4-D 2,4,- dichlorophenoxyacetic acid
2,4,5-T 2,4,5-trichlorophenoxyacetic acid
2,3,7,8-TCDD 2,3,7,8-Tetraclorodibenzo-p-dioxin
ABTS 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid)
bp Base pair
DDE Dichlorodiphenyldichloroethylene
DDD Dichlorodiphenyldichloroethane
DDT Dichloro - Trichloroethane Diphenyl
DNA Deoxyribonucleic acid
EC Enzyme Commission
EPA U.S. Environmental Protection Agency
HCH Hexacyclohexan
Lac Laccase
LB Luria - Bertani
LiP Lignin peroxidase
MnP Manganese peroxidase
PAH Polycyclic aromatic hydrocarbon
PCB Polychlorinated biphenyl
PCR Polymerase Chain Reaction
POP Persistent Organic Pollutant
RBBR Remazol brilliant blue R
RNA Ribonucleic acid
rRNA Ribosomal ribonucleic acid
5-bromo-4-chloro-3-indodyl- β galactosidase
X-gal




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




M ỤC L ỤC
MỤC LỤC 1
MỞ ĐẦU 4
PHẦN I TỔNG QUAN TÀI LIỆU 6
1 ĐẶC ĐIỂM CẤU TRÚC VÀ TÍNH CHẤT LÝ HÓA CỦA DDT 6
1.1 Cấu trúc của DDT 6
1.2 Tính chất lý hóa của DDT 6
2 ẢNH HƢỚNG ĐẾN MÔI TRƢỜNG VÀ SỨC KHỎE CON NGƢỜI
CỦA DDT 7
2.1 Ảnh hƣởng đến môi trƣờng 7
2.2 Ảnh hƣởng đến sức khỏe con ngƣời 9
3 TÌNH TRẠNG Ô NHIỄM DDT 11
3.1 Nguồn gốc phát sinh 11
3.2 Tình trạng ô nhiễm DDT trên thế giới 13
3.3 Tình trạng ô nhiễm DDT ở Việt Nam 14
4 CÁC PHƢƠNG PHÁP XỬ LÝ Ô NHIỄM DDT 16
4.1 Các phƣơng pháp cơ, hóa lý 16
4.1.1 Phương pháp chôn lấp, cô lập 16
4.1.2 Phương pháp đốt có xúc tác 17
4.1.3 Phương pháp phân hủy bằng kiềm nóng 17
4.2 Phƣơng pháp phân hủy sinh học 18
5 PHÂN HỦY SINH HỌC DDT 20
5.1 Khả năng phân hủy DDT bởi vi sinh vật 20
5.1.1 Loại clo bởi quá trình khử 21
5.1.2 Khoáng hoá DDT bởi nấm thủy phân lignin 22
5.1.3 Phân hủy DDT bởi vi khuẩn trong điều kiện hiếu khí 23
5.2 Các điều kiện môi trƣờng ảnh hƣởng đến phân hủy sinh học DDT và
các dẫn xuất của DDT 26
6 LACCASE 27
6.1 Định nghĩa 27
6.2 Cấu trúc phân tử của laccase 28
6.3 Cơ chế xúc tác của laccase 30
6.4 Tính chất hóa sinh của laccase 32
6.5 Sự phân bố và một số vi sinh vật sinh laccase 33
6.6 Gene mã hóa laccase 34
6.7 Ứng dụng của laccase 36
6.8 Lignin peroxidase và Mangan peroxidase 37
6.8.1 Lignin peroxidase 37
6.8.2. Mangan peroxidase 38
7 PHÂN LOẠI VI SINH VẬT 39
7.1 Phân loại theo phƣơng pháp truyền thống 39
7.2 Phân loại bằng phƣơng pháp xác định và so sánh trình tự gene mã hóa
18S Rrna 39
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
1
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




7.2.1 Một số phương pháp phân loại bằng sinh học phân tử 39
7.2.2 Phân loại dựa vào trình tự gene mã hoá 18S rRNA 40
PHẦN II VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 42
1 VẬT LIỆU 42
1.1 Nguyên liệu 42
1.2 Hóa chất 42
1.3 Thiết bị 42
1.4. Môi trƣờng nuôi cấy 43
2 PHƢƠNG PHÁP NGHIÊN CỨU 45
2.1 Nghiên cứu một số đặc điểm sinh học của các chủng nấm sợi 45
2.2 Sàng lọc khả năng sinh Lac, LiP, MnP 45
2.3 Nghiên cứu khả năng phân hủy DDT của chủng FNA1 45
2.4 Phƣơng pháp xác định hoạt tính enzyme 46
2.4.1 Xác định hoạt tính laccase 46
2.4.2 Xác định hoạt tính LiP 47
2.4.3 Xác định hoạt tính MnP 47
2.5 Khảo sát các điều kiện môi trƣờng ảnh hƣởng đến khả năng phát triển
và sinh laccase của chủng FNA1 48
2.6 Xác định một số tính chất hóa sinh của laccase thô 49
2.7 Phân loại nấm sợi dựa vào xác định và so sánh trình tự gen mã hóa
18S rRNA 50
2.7.1 Tách DNA tổng số từ nấm sợi 50
2.7.2 Nhân đoạn gen bằng kỹ thuật PCR 51
2.7.3 Gắn sản phẩm PCR vào vectơ và biến nạp vào E.coli 53
2.7.4 Tách chiết DNA plasmid 53
2.7.5 Kiểm tra plasmit mang sản phẩm PCR mong muốn 54
2.7.6 Điện di kiểm tra DNA tổng số 55
2.6.8 Xây dựng cây phát sinh chủng loại 55
2.6.7 Xác định trình tự đoạn gene mã hóa 16S rRNA 55
PHẦN 3 KẾT QUẢ VÀ THẢO LUẬN 56
1 MỘT SỐ ĐẶC ĐIỂM HÌNH THÁI KHUẨN LẠC VÀ CUỐNG SINH
BÀO TỬ CỦA CÁC CHỦNG FNA1, FNA2, FNA3 56
2 SÀNG LỌC KHẢ NĂNG SINH TỔNG HỢP Lac, LiP, MnP 57
3 KHẢ NĂNG PHÂN HỦY DDT CỦA CHỦNG FNA1 59
4 CÁC ĐIỀU KIỆN MÔI TRƢỜNG ẢNH HƢỞNG ĐẾN KHẢ NĂNG
SINH TRƢỞNG VÀ SINH TỔNG HỢP LACCASE CỦA CHỦNG FNA1 64
4.1 Ảnh hưởng của nhiệt độ, pH môi trường nuôi cấy, nồng độ NaCl 64
4.1.1 Ảnh hưởng của nhiệt độ 64
4.1.2 Ảnh hưởng của pH môi trường nuôi cấy 65
4.1.3 Ảnh hưởng của nồng độ NaCl 67
4.2 Ảnh hưởng của nồng độ DDT và nồng độ glucose 68
4.2.1 Ảnh hưởng của nồng độ DDT 68
4.2.2 Ảnh hưởng của nồng độ glucose 69
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
2
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




4.3 Ảnh hưởng của các chất cảm ứng 71
4.3.1 Guaiacol, veratyl alcohol, CuSO4 71
4.3.2 Các chất ô nhiễm khác 72
4.4 Ảnh hưởng của chất hoạt động bề mặt 74
4.5 Ảnh hưởng của nguồn carbon, nitơ và môi trường thay thế 76
4.5.1 Ảnh hưởng của nguồn carbon 76
4.5.2 Ảnh hưởng của nguồn nitơ 78
4.5.3 Ảnh hưởng của môi trường thay thế 80
5 MỘT SỐ TÍNH CHẤT CỦA LACCASE THÔ 81
5.1 pH tối ưu và độ bền pH 81
5.1.1 pH tối ưu 81
5.1.2 Độ bền pH 83
5.2 Nhiệt độ thích hợp cho hoạt động của laccase và độ bền nhiệt 84
5.2.1 Nhiệt độ thích hợp cho hoạt động của laccase 84
5.2.2 Độ bền nhiệt 85
6 PHÂN LOẠI CHỦNG NẤM SỢI FNA1 BẰNG PHƢƠNG PHÁP SO
SÁNH TRÌNH TỰ ĐOẠN GEN MÃ HÓA 18S rRNA 86
6.1 Tách chiết DNA tổng số 86
6.2 Nhân đoạn gen 18S rRNA bằng kỹ thuật PCR 87
6.3 Tách dòng gen 18S rRNA trong vectơ pTZ57R/T 88
6.4 So sánh trình tự đoạn gen mã hóa 18S rRNA của chủng FNA1 91
KẾT LUẬN 94
KIẾN NGHỊ 95
TÀI LIỆU THAM KHẢO 96
PHỤ LỤC 103




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
3
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




MỞ ĐẦU

DDT (Dichloro - Trichloroethane Diphenyl) là một trong những thuốc
trừ sâu tổng hợp đƣợc biết đến nhiều nhất. DDT đƣợc tổng hợp đầu tiên vào
năm 1874, nhƣng thuộc tính thuốc trừ sâu của DDT thì cho đến 1939 mới
đƣợc khám phá. Vào những năm đầu của Chiến tranh Thế giới thứ II, DDT
đƣợc sử dụng với lƣợng lớn để kiểm soát muỗi truyền bệnh sốt rét, bệnh sốt
phát ban, và các bệnh do côn trùng khác trong cả quân đội lẫn dân cƣ. DDT
trở thành loại thuốc trừ sâu phổ biến sử dụng trong nông nghiệp. Chúng có
mặt ở khắp mọi nơi, trong không khí, đất, nƣớc do một lƣợng lớn đã đƣợc giả i
phóng ra khi phun trên các cánh đồng và rừng để diệt muỗi và côn trùng.

Ngày nay DDT đã bị cấm sử dụng do tính độc của nó nhƣ có khả năng
gây ung thƣ tiềm tàng, gây đột biến và gây ô nhiễm môi trƣờng nghiêm trọng.
Để bảo vệ môi trƣờng và sức khỏe con ngƣời, cần phải xử lý khử độc DDT
trong môi trƣờng đất cũng nhƣ trong các môi trƣờng khác. DDT ở trong đất
có thể giảm đi do sự bay hơi, sự xói mòn đất, sự hấp thu của động vật, thực
vật và sự phân hủy sinh học của các vi sinh vật có sẵn trong đất nhƣng vớ i
thời gian tƣơng đối lâu.

Trên thế giới cũng nhƣ ở Việt Nam, đã có một số phƣơng pháp khử độc
khác nhau đƣợc nghiên cứu và áp dụng. Trong đó phƣơng pháp xử lý sinh học
nhờ các vi sinh vật và hệ enzyme do chúng tiết ra là một hƣớng đi mới có
nhiều triển vọng. Hệ enzyme sử dụng trong xử lý sinh học chủ yếu là các
enzyme ngoại bào, chúng có khả năng phá vỡ các liên kết trong các hợp chất
hữu cơ hoặc xúc tác chuyển hóa chúng thành các chất ít độc hơn và các dạng
dễ bị phân hủy hơn. Nhóm enzyme có vai trò lớn trong quá trình phân hủy
DDT cũng nhƣ các chất thuộc POPs khác gồm có laccase (Lac), mangan

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
4
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




peroxidase (MnP) và lignin peroxidase (LiP), trong đó laccase có vai trò quan
trọng và đang bắt đầu đƣợc quan tâm nghiên cứu trên thế giới và Việt Nam.

Tại Nhóm nghiên cứu Công nghệ sinh học xử lý khử độc các chất ô
nhiễ m hữu cơ khó phân hủy (Persistent Organic Pollutants – POPs), phòng
Công nghệ Sinh học Môi trƣờng, Viện CNSH, Viện Khoa học và Công nghệ
Việt Nam đã có những nghiên cứu bƣớc đầu về khả năng phân hủy DDT,
DDD, DDE và sinh enzyme ngoại bào Lac, MnP, LiP [4,5,6]. Để làm rõ bả n
chất sinh học và khả năng sinh enzyme của các chủng nấ m sợi phân lập từ đất
ô nhiễm DDT phục vụ cho các nghiên cứu ứng dụng enzyme ngoại bào vào
xử lý các chất ô nhiễm khó phân hủy POPs, chúng tôi đã thực hiện đề tài với
tên là: “Nghiên cứu phân loại, khả năng phân hủy DDT và sinh laccase
của chủng nấm sợi phân lập từ đất ô nhiễm hỗn hợp thuốc trừ sâu”.

Nội dung bao gồm:

1. Phân loại và định tên chủng nấm sợi dựa vào đặc điểm hình thái và
trình tự đoạn gene mã hoá 18S rRNA.

2. Nghiên cứu khả năng phân hủy DDT của chủng nấ m sợi FNA1.

3. Nghiên cứu khả năng sinh laccase của chủng nấm sợi FNA1.




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
5
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




PHẦN I TỔNG QUAN TÀI LIỆU


1 ĐẶC ĐIỂM CẤU TRÚC VÀ TÍNH CHẤT LÝ HÓA CỦA DDT

1.1 Cấu trúc của DDT

DDT là một trong các thuốc diệt côn trùng, chúng là một nhóm các hợp
chất hữu cơ có hai vòng thơm và có chứa Clo, bao gồ m 14 hợp chất hữu cơ,
trong đó: 71% là p,p,- DDT, 14.9% là o,p,- DDT, 0.3%p,p,- DDD, 0.1% là
o,p,-DDD, 4% là p,p,- DDE, 0.1% là o,p,-DDE, sản phẩm khác là 3.5% (Hình
1.1).




p-p DDT p-p DDE p-p DDD




o-p DDT o-p DDE o-p DDD

Hình 1.1. Công thức cấu tạo của một số đồng phân DDT



1.2 Tính chất lý hóa của DDT

Tất cả các đồng phân của DDT đều là dạng tinh thể màu trắng, không
mùi, không vị, có công thức tổng quát là C14H9Cl5, khối lƣợng phân tử là
354.5. Nhiệt độ nóng chảy khoảng 108.5 - 1090C, áp suất bay hơi là 2.53 x10 -
Pa (1.9 x10 -7mmHg) tại 200C. DDT tan ít trong nƣớc (1 g/l) nhƣng có khả
5


năng giữ nƣớc, tan tốt trong các hợp chất hữu cơ đặc biệt là mỡ động vật. Khả

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
6
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




năng hoà tan của DDT trong nƣớc là thấp (hệ số hấp phụ cao) nên DDT có xu
hƣớng bị hấp phụ trong cặn bùn, đất đá, trầm tích. Điều này có vai trò đặc biệt
trong phân hủy sinh học DDT. Một số đặc tính cơ bản của D DT và các đồng
phân đƣợc trình bày ở phụ lục 1 [59].


2 ẢNH HƢỚNG ĐẾN MÔI TRƢỜNG VÀ SỨC KHỎE CON NGƢỜI
CỦA DDT

2.1 Ảnh hƣởng đến môi trƣờng

DDT [ 1,1,1-trichloro-2,2-bis-(p-chlorophenyl)ethane] đã đƣợc tổng
hợp vào năm 1874, nhƣng mãi đến 1930, Bác sĩ Paul Muller (Thụy Sĩ ) mớ i
xác nhận DDT là một hóa chất hữu hiệu trong việc trừ sâu rầy và từ đó đƣợc
xem nhƣ là một thần dƣợc và không biết có ảnh hƣởng nguy hại đến con
ngƣời. Khám phá trên mang lại cho ông giải Nobel về y khoa năm 1948 và
DDT đã đƣợc sử dụng rộng rãi khắp thế giới cho việc khử trùng và kiểm soát
mầ m mống gây bệnh sốt rét. Nhƣng chỉ hai thập niên sau đó, một số chuyên
gia thế giới đã khám phá ra tác hại của DDT trên môi trƣờng và sức khỏe
ngƣời dân. Do đó, tại Hoa Kỳ từ năm 1972 DDT đã bị cấm sử dụng hẳn. DDT
bị nhiễm vào môi trƣờng không khí, nƣớc, đất trong suốt quá trình sử dụng,
DDT có mặt ở nhiều vị trí ô nhiễm khác nhau, sau đó có thể tiếp tục bị lan
truyền và gây ô nhiễm môi trƣờng. Đặc biệt trong đất, nó giữ nƣớc thành các
phần tử rắn và trở thành dạng bền vững (EPA 1986) và đƣợc EPA Hoa Kỳ
xếp vào danh sách các loại hóa chất phải kiểm soát vì có nguy cơ tạo ra ung
thƣ cho ngƣời và động vật [59]. DDT, DDE (1,1-dichloro-2,2-bis(p-
chlrophenyl)ethylene), DDD (1,1-dichloro-2,2-bis(p-chlrophenyl)ethylene)
cũng có thể đƣợc thải vào không khí khi chúng bay hơi từ đất và nƣớc nhiễm
độc. Một lƣợng lớn DDT đã đƣợc thải vào môi trƣờng nhƣ đi vào không khí,
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
7
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




đất và nƣớc thông qua quá trình tƣới, phun trên các diện tích sản xuất nông
nghiệp và rừng để diệt côn trùng và muỗi [59].DDT và các đồng phân bị
ngấm vào mạch nƣớc ngầm khi nó đƣợc sử dụng để diệt côn trùng ở gần các
cửa sông .v.v. Trong đất, DDT có thể suy giảm nhờ quá trình bốc hơi, quá
trình quang phân và quá trình phân hủy sinh học (hiếu k hí và kị khí) nhƣng
những quá trình này xảy ra rất chậm tạo ra sản phẩm là DDD và DDE có độ
bền tƣơng tự nhƣ DDT. DDD cũng đƣợc sử dụng nhƣ là một loại thuốc trừ
sâu, còn DDE chỉ đƣợc tìm thấy trong môi trƣờng nhiễm bẩn do sự phân hủy
sinh học của DDT.

Quá trình bốc hơi, phân hủy DDT, DDD, DDE có thể đƣợc lặp lại
nhiều lần và kết quả là DDT, DDD, DDE đƣợc tìm thấy ở cả những nơi rất xa.
Những hợp chất hóa học này có thể đƣợc phát hiện ở đầm lầy, tuyết và động
vật ở vùng Bắc Cực & Nam Cực, rất xa so với nơi chúng đƣợc sử dụng, DDT,
DDD, DDE cuối cùng ở trong đất một thời gian dài, hầu hết bị phân hủy chậm
thành DDD và DDE thƣờng là bởi hoạt động của các vi sinh vật. Chu kỳ bán
hủy của những hợp chất này trong khí quyển khi bay hơi đƣợc ƣớc tính 1,5 - 3
ngày. DDT ở trong đất phụ thuộc vào nhiều yếu tố: nhiệt độ, loại đất, độ ẩm
v.v. ở những vùng nhiệt đới DDT bay hơi dễ hơn và vi sinh vật cũng phân
hủy nó nhanh hơn. DDT ở đất ẩm bị phân hủy nhanh hơn ở đất khô. Chúng
làm giảm giá trị của đất và khi bị phân hủy DDT đƣợc chuyển thành DDE
trong cả điều kiện hiếu khí và kị khí. Những hợp chất này có thể bốc hơi trong
không khí hoặc lắng đọng lại ở các vị trí khác nhau và có độc tính rất cao.
Chúng ở sâu trong đất, thấm qua đất và vào các mạch nƣớc ngầm. Trên bề
mặt nƣớc, DDT sẽ liên kết các phần tử ở trong nƣớc, lắng xuống và có thể
lắng đọng trong các trầm tích.



Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
8
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Gần đây DDT là một trong 12 hoá chất đƣợc các nhà khoa học thế giới
xếp vào hạng chất ô nhiễm khó phân hủy (POPs). Năm 1998, đại diện của hơn
92 quốc gia trên thế giới đã tụ họp tại Montreal đã bàn thảo về các biện pháp
nhằm cấm sản xuất và sử dụng các hoá chất trên vì lý do tác hại của chúng do
sự tích luỹ lâu dài trong không khí, lòng đất và nguồn nƣớc, kết tụ vào các mô
động vật- nguồn thực phẩm chính của loài ngƣời [7]. DDT tích trữ một lƣợng
lớn ở trong cá và các động vật biển (ví dụ: hải cẩu, cá heo). Tính độc của
DDT đã đƣợc biết đến thông qua các nghiên cứu rất kỹ lƣỡng ở trên các vi
sinh vật, động vật không xƣơng sống ở dƣới nƣớc, cá, lƣỡng cƣ, động vật
không xƣơng sống ở trên cạn và các loài động vậ t có vú khác (chuột hang, thỏ
v.v.). Trong các động vật này, DDT đƣợc tìm thấy một lƣợng lớn trong các
mô mỡ và sẽ tiếp tục di chuyển đến những cơ quan khác. Ngƣỡng độc của
DDT và các đồng phân của nó đã xác định thông qua chỉ số LC50 (LC50 là
liều gây chết 50% mẫu sinh vật thí nghiệm) ở một số loài động vật thí nghiêm
là: LD50 ở lợn khoảng 1.000mg DDT/kg [12], LD50 ở thỏ là 300mg DDT/kg
và 4.000-5.000 mg DDD/kg [12]. DDT ở trong đất cũng có thể đƣợc hấp t hụ
bởi một số thực vật hoặc trong cơ thể co n ngƣời khi ăn các thực vật đó [57].



2.2 Ảnh hƣởng đến sức khỏe con ngƣời

Những nghiên cứu dịch tễ học đã chỉ ra đƣợc tác hại của DDT và các
hợp chất có liên quan tới một số loài và việc sử dụng nó đã bị cấm hoặ c giảm
trên nhiều nƣớc do những hậu quả độc hại của nó. Nhƣng các số liệu về ảnh
hƣởng trên con ngƣời vẫn chƣa đƣợc biết đến nhiều. Các nghiên cứu về sự
ảnh hƣởng trên ngƣời đƣợc nghiên cứu trên các công nhân làm việc trong các
nhà máy có sản xuất DDT. Các nghiên cứu khác cũng cho những kết quả có


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
9
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




giá trị nhƣng do những hạn chế của các nghiên cứu về dịch tễ học nên chƣa
xác định đƣợc những nguyên nhân gây bệnh từ chúng.

Con ngƣời bị nhiễ m DDT thông qua nhiều cách khác nhau đó là phơi
nhiễ m trực tiếp và gián tiếp. Phơi nhiễ m trực tiếp, có thể xảy ra qua phổi hoặc
qua da. Nhiễ m gián tiếp xảy ra khi ăn các thực phẩm nhƣ ngũ cốc, rau đậu đã
bị nhiễm DDT, cũng nhƣ tôm cá sống trong vùng bị ô nhiễm, DDT sẽ đi vào
cơ thể qua đƣờng tiêu hoa và tích tụ theo thời gian trong các mô mỡ và gan
của con ngƣời.

Nguồn lây nhiễm DDT chính là ở trong thịt, cá, gia cầm và các sản
phẩm từ sữa. Nếu ngƣời ăn các loại lƣơng thực thực phẩm đƣợc phun DDT và
ăn kéo dài thì có nhiều nguy cơ dẫn tới ngộ độc mãn tính, sinh con quái thai.
Mức độ tối thiểu mà con ngƣời có thể chịu đựng và không gây hại là 285
mg/kg. DDT có tác động rõ rệt lên hệ thống thần kinh ngoại biên, gây nên sự
rối loạn hệ thống thần kinh, ức chế các enzyme chức năng đòi hỏi sự dịch
chuyển các ion dẫn đến tê liệt. Những ngƣời bị nhiễm một lƣợng lớn gây ngộ
độc cấp tính, dễ bị kích động, bị rùng mình và gây tai biến mạch máu não.
Chúng cũng gây nên sự đổ mồ hôi, đau đầu, buồn nôn, chóng mặt. Những ảnh
hƣởng nhƣ trên cũng có thể xuất hiện khi hít DDT ở trong không khí ho ặc hấp
thụ một lƣợng lớn qua da [59].

Đối với những ngƣời bị nhiễm DDT ở mức độ thấp (20 mg/ngày) - ví
dụ nhƣ những ngƣời làm việc trong các nhà máy sản xuất DDT, sẽ xuất hiện
những biến đổi nồng độ enzyme có trong gan và trong máu. Nhiều nghiên cứu
đã chỉ ra rằng DDT, DDE, DDD có thể gây bệnh ung thƣ, mà trƣớc tiên là
ung thƣ gan, cũng có thể là ung thƣ vú, ung thƣ tuỷ [59]. Những nghiên cứu
của Garabrant và cộng sự 1992 ở một nhóm công nhân của các nhà máy sản
xuất thuốc hóa học giữa năm 1948 đến năm 1971 đã phát hiện ra DDT có thể
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
10
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




gây ung thƣ tủy và dẫn đế n tử vong vào năm 1953- 1988 [59]. Bên cạnh đó nó
cũng gây nên một số bệnh ung thƣ khác nhƣng vẫn chƣa đƣợc nghiên cứu kỹ
nhƣ: ung thƣ tuyến tiền liệt, ung thƣ tinh hoàn, ung thƣ máu, ung thƣ dạ con
v.v.

Trẻ con bú sữa mẹ hay sữa tƣơi bị nhiễm độc DDT trực tiếp qua sự
hiện diện của DDT trong sữa tƣơi hay gián tiếp vì thức ăn của ngƣời mẹ . Tệ
hại hơn nữa, nhiều bà mẹ đã bị sảy thai trong vùng ảnh hƣởng của DDT . Ở
nƣớc ta, đã có một số công trình nghiên cứu và rút ra nhận xét là tất cả các bà
mẹ dù có tiếp xúc hay không tiếp xúc trực tiếp với DDT đều có lƣợng DDT
trong sữa mẹ rất cao. Vì DDT xâm nhập vào cơ thể chủ yếu qua đƣờng tiêu
hóa, cao hơn rất nhiều lần so với liều lƣợng cho phép của OMS (0.05ppm),
của Liên Xô (0.14ppm) và của Hungari (0.13ppm) [53].



3 TÌNH TRẠNG Ô NHIỄM DDT

3.1 Nguồn gốc phát sinh

DDT (1,1,1-trichloro-2,2-bis (p-chlorophenyl) ethane) đã đƣợc tổng
hợp lần đầu tiên vào năm 1873 bởi nhà khoa học ngƣời Đức Othmar Ziedler.
Tuy nhiên, phải đến 1939 nhà hoá học Thuỵ Sỹ- Paul Hermann Muller mới
khám phá các đặc tính để diệt trừ côn trùng của DDT, chúng có thể phá huỷ
nhanh chóng hệ thần kinh của côn trùng. Năm 1948, Paul Muller đã đƣợc trao
giải thƣởng Nobel về sinh - y học về khám phá này. DDT có hiệu quả chống
lại rận, bọ chét, và muỗi mang các mầm bệnh sốt phát ban, dịch hạch, sốt rét,
và sốt vàng .v.v. DDT đã đƣợc dùng rất rộng rãi hơn 20 năm và đƣợc xem là
nhân tố chính trong việc gia tăng sản lƣợng lƣơng thực thế giới và ngăn chặn
bệnh tật từ côn trùng.

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
11
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




DDT đƣợc tạo thành từ phản ứng của trichloroethanol với chlorobenzen
(Hình 1.2). Tên thƣơng mại hoặc các tên khác của DDT bao gồm Anofex,
Cesarex, Chlorophenothane, Dadelo, p,p-DDT,
dichlorodiphenyltrichloroethane, Dinocide, Didimac , Digmar, ENT 1506,
Genitox, Guesapon, Guesarol, Gexarex, Gyrol, Hildit, Ixodex, Kopsol,
Neocid, OMS 16, Micro DDT 75, Pentachlorin, Rukseam, R50 và Zerdane.




Hình 1.2. Tổng hợp DDT từ trichloroethanol và chlorobenzen


DDT là loại thuốc hóa học diệt cô n trùng đƣợc sử dụng rộng rãi từ
chiến tranh thế giới lần thứ II trên khắp thế giới và hàng triệu tấn đƣợc sản
xuất, sử dụng trƣớc đây hiện đang còn lƣu giữ trong đất và sẽ tiếp tục phân
tán trong môi trƣờng. Một lƣợng lớn DDT đã đƣợc giải phóng vào không khí,
đất và nƣớc khi sử dụng để diệt côn trùng, muỗi ở các địa điểm nhạy cảm nhƣ
cửa sông [59].

Đầu năm 1960, nhà hoạt động ngƣời Mỹ Rachel Carson đã xuất bản
cuốn sách Silent Spring khẳng định DDT là nguyên nhân của bệnh ung thƣ và
nguy hại đến sinh sản của chim do làm mỏng lớp vỏ trứng. Cuốn sách đã gây
ra sự phản đối kịch liệt của công chúng và sự kiện này đã dẫn đến lệnh cấm
sử dụng DDT trong nông nghiệp ở Mỹ. Tiếp theo trong những năm 1970 và
1980, DDT đã bị cấm sử dụng trong nông nghiệp ở hầu hết cá c nƣớc phát
triển do ảnh hƣởng nguy hại của nó đối với môi trƣờng. Mặc dầu vậy, DDT
vẫn đƣợc sử dụng rộng rãi trong một số quốc gia đang phát triển.
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
12
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




3.2 Tình trạng ô nhiễm DDT trên thế giới

Do tác hại của DDT trên môi trƣờng và sức khỏe ngƣời dân tại Hoa Kỳ
từ năm 1972 DDT đã bị cấm sử dụng hẳn. Tuy nhiên, đến nay hóa chất này
vẫn còn gây tác hại ở những vùng nông nghiệp đã sử dụng và những vùng
quanh nơi sản xuất ra DDT trƣớc đây. Hiện tại DDT vẫn còn ngƣng tụ nơi
thềm lục địa vùng Palos Verdas (ngoài khơi vùng biển Los Angeles) vì nhà
máy sản xuất ra DDT Montrose Chemical.co tại Torrance đã thải DDT vào hệ
thống cống rãnh thành phố vào năm 1971. Việc xử lý ô nhiễm DDT cho vùng
này ƣớc tính vào khoảng 300 triệu USD [7].

Cho đến nay ở Mỹ do lợi ích về kinh tế nên vẫn sản xuất DDT để xuất
cảng qua Phi châu và các nƣớc Á châu trong đó có Việt Nam. DDT là một
loại thuốc sát trùng công hiệu mạnh, đặc biệt quan trọng trong việc kiểm soát
bệnh sốt rét nên vẫn đƣợc sử dụng rộng rãi ở các nƣớc đang phát triển bất
chấp nguy cơ gây hại tiề m tàng và lâu dài của nó.

Sự tích tụ nhiều nhất của DDT và các hợp chất có liên quan ở biển phía
Tây của Trung Quốc. ở các bờ biển khác, lƣợng tích tụ của DDT cũng rất lớn
nhƣ: vịnh Bengal, biển Arabian, biển bắc Trung Quốc v.v.Từ nă m 1980-1983,
có rất nhiều phân tích về sự tích tụ DDT ở trong các trầm tích biển ở EPA
[54]. Hàm lƣợng trung bình của DDT, DDE, DDD là: 0.1, 0.1, 0.2 g/kg
(trọng lƣợng khô). Hàm lƣợng DDT và các sản phẩm chuyển hóa của các mẫu
trầm tích đƣợc phân tích ở đáy sông ở vịnh River tại Washington: 0.1 -234
g/kg. Sự tích trữ của DDT, DDE, DDD và tổng lƣợng DDT ở đáy trầm tích
từ sông San Joaquen và các nhánh sông của nó ở California -1992 lần lƣợt
là:1.4 - 115, 0.7 - 14, 0.4 - 39, 2.2 - 170 (ng/l) [45]. Trong đó Orestinba Creat
có hàm lƣợng DDT cao hơn hẳn so với các vị trí khác. Ở Canada, tổng lƣợng
DDT lắng đọng trên bề mặt trầm tích ở 8 hồ khác dọc ngang lục địa vào
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
13
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




khoảng 9.7g/kg. Iwata et al (1993) đã thu thập và phân tích 68 ví dụ về hàm
lƣợng DDT ở nƣớc bề mặt từ một vài đại dƣơng (18 khu vực) đã nêu lên
những ảnh hƣởng chủ yếu do sự lắng đọng khí quyển từ tháng 4/1989-8/1990.

Nhiều nghiên cứu cũng cho thấy sự có mặt của DDT trong các mẫu
trầm tích với nồng độ cao do DDT đƣợc vận chuyển từ khu vực bị ô nhiễm
đến Bắc cực và Nam cực. Tổng lƣợng DDT ở đại dƣơng New Zealand và
Ross Iland, Antarctica giữa tháng 1 và tháng 3 (1990) là: 0.40 và 0.81 pg/m3
[14, 33]. Vùng Gulf của Mexico (1977) chứa trung bình 34pg/m3 DDT với tỉ
lệ 10-78pg/m3 [13]. Lƣợng DDT cao nhất đƣợc tìm thấy ở gần khu vực nơi
mà DDT vẫn đƣợc sử dụng, ví dụ ở bờ biển Arabian của ấn Độ. Các khu vực
mà lƣợng DDT trong không khí cao là eo biển Malacca, bờ biển phía nam
Trung Quốc, vịnh Mexico.



3.3 Tình trạng ô nhiễm DDT ở Việt Nam

DDT đƣợc dùng lầ n đầu tiên ở Việt Nam vào năm 1949 để phòng ngừa
bệnh sốt rét. Tuy nhiên, số lƣợng thuốc DDT đƣợc dùng chỉ có 315 tấn trong
năm 1961 và giảm xuống còn 22 tấn trong năm 1974. Từ năm 1957 đến 1990,
tổng số lƣợng thuốc DDT nhập cảng chỉ có 240.422 tấn. Mặc dù việc sử dụng
thuốc DDT đã bị cộng đồng quốc tế ngăn cấm từ năm 1992, việc nhập cảng
và sử dụng DDT ở Việt Nam vẫn tiếp tục cho đến năm 1994. Trong khoảng từ
năm 1992 đến năm 1994, số lƣợng thuốc DDT nhập cảng từ Nga lên đến
423.358 tấn Tuy không có số liệ u chính xác về số lƣợng DDT đang đƣợc sử
dụng ở Việt Nam, nhƣng tin tức trong nƣớc cho biết thuốc này vẫn còn đang
đƣợc sử dụng rộng rãi đặc biệt ở vùng châu thổ sông Cửu Long vì là vùng có
nhiều sông rạch và nhiều muỗi mồng [8].


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
14
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Tại một kho dã chiến chứa DDT những năm 1967 – 1968 ở Hà Tĩnh
vẫn còn một lƣợng tồn dƣ lớn hóa chất này. Khối lƣợng thuốc DDT ở kho này
ƣớc tính khoảng 4- 5 tấn. Hiện nay số thuốc DDT đã nằm phơi lộ trên mặt
đất, một phần thuốc có thể bị phân hủy song phần lớn vẫn còn đó, chúng c ó
thể khuếch tán vào không khí gây ô nhiễm môi tr ƣờng và phân rã ngấm vào
đất và các mạch nƣớc ngầm gây ô nhiễm đất và nƣớc trong khu vực. Nghệ An
là một trong những tỉnh còn tồn lƣu một lƣợng tƣơng đối lớn hóa chất bảo vệ
thực vật, hiện tại tỉnh có 25 điểm tồn lƣu hóa chất chất bảo vệ thực, trong đó
mới có 5 điểm đƣợc xử lý. Phần lớn những điểm tồn lƣu hóa chất chất bảo vệ
thực đều nằm gần, hoặc nguy hiểm hơn là nằm lọt trong khu dân cƣ. Một kết
quả điều tra khác ở tỉnh Nghệ An cho thấy, DDT vẫn còn trong một nhà kho
từ năm 1965 đến năm 1985. Nồng độ của DDT thay đổi từ 3.38 đến 960.6
mg/kg trong các mẫu đất và từ 0.00012 đến 0.00168 mg/l trong các mẫu
nƣớc. Trong nhiều năm liên tiếp, mùi thuốc DDT nồng nặc bay xa đến 600
mét. Đã có 25 ngƣời chết vì ung thƣ, và 22 trƣờng hợp dị thai đƣợc ghi nhận
[8].

Do sự nguy hiểm của các chất POP nói chung và hóa chất bảo vệ thực
vật nói riêng đối với sức khỏe con ngƣời và môi trƣờng, các nƣớc trên thế
giới cũng nhƣ Việt Nam đã và đang tích cực tiến tới loại trừ và cấm sử dụng
hoàn toàn các chất POP. Cụ thể là Công ƣớc Stockholm về các chất hữu cơ ô
nhiễm khó phân hủy ra đời và 172 quốc gia đã tham gia ký kết, trong đó có
Việt Nam. Ở nƣớc ta công ƣớc Stockholm chính thức có hiệu lực kể từ ngày
14/5/2004. Tham gia công ƣớc này, Việt Nam sẽ xây dựng và hoàn thiện hệ
thống pháp luật để quản lý an toàn hóa chất, giảm thiểu và tiến tới loại bỏ các
chất ô nhiễm hữu cơ khó phân huỷ. Đồng thời, phòng ngừa, kiểm soát và xử
lý an toàn đối với các chất này, tiến tới kiểm soát, xử l ý và tiêu hủy hoàn toàn

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
15
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




các kho thuốc bảo vệ thực vật, những hóa chất rất độc hại đã bị loại bỏ, còn
tồn lƣu.




4 CÁC PHƢƠNG PHÁP XỬ LÝ Ô NHIỄM DDT

DDT là chất có tính độc hại cao, bền vững cao đối với quá trình phân
hủy tự nhiên. Một khi đã phát thải vào môi trƣờng, chất này có thể tồn tại
trong thời gian dài và có thể di chuyển đi xa khỏi nguồn phát thải ban đầu nhờ
gió, nƣớc hay nhờ vào các loài động vật di cƣ. Ngoài ra DDT có thể đƣợc hấp
thụ dễ dàng vào các mô mỡ và tích tụ trong cơ thể của các sinh vật sống, nồng
độ chất này trở nên cao hơn theo chiều tăng của chuỗi thức ăn, đặc biệt là
trong các loài sinh vật lớn và sống lâu. Chính vì những tính chất này mà việc
loại bỏ, tiêu hủy DDT cũng nhƣ các chất bảo vệ thực vật trong danh mục cấm
khác ngày càng trở nên cần thiết và cấp bách không chỉ riêng ở nƣớc ta mà
còn là vấn đề quan tâm của nhiều nƣớc trên thế giới.

Tùy điều kiện địa hình, tính chất, quy mô của vùng ô nhiễm; tùy điều
kiện kinh phí để áp dụng các quy trình xử lý khác nhau, có thể xử dụng các
phƣơng pháp nhƣ phƣơng pháp hóa lý; phƣơng pháp bao vây, cô lập nguồn ô
nhiễm; hay phƣơng pháp sinh học v.v.


4.1 Các phƣơng pháp cơ, hóa lý

Có rất nhiều phƣơng pháp hóa lý đƣợc sử dụng để loại bỏ các chất ô
nhiễm khó phân hủy. Đối với ô nhiễm DDT thì các phƣơng pháp thƣờng đƣợc
sử dụng là chôn lấp, cô lập; phân hủy bằng kiềm nóng và phƣơng pháp đốt có
xúc tác.

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
16
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




4.1.1 Phương pháp chôn lấp, cô lập

Với cấu trúc vòng thơm, DDT rất khó phân hủy trong tự nhiên nên biện
pháp chôn lấp chất thải nguy hại đƣợc áp dụng rộng rãi ở nhiều nƣớc trên thế
giới. Một số nƣớc sử dụng biện pháp chôn lấp cô lập và xi măng hóa chất thải
có độc tính cao ở dạng lỏng hoặc rắn. Phƣơng pháp này đòi hỏi phải chuẩn bị
hố chôn lấp đảm bảo kỹ thuật, không bị rò rỉ, bền vững trong thời gian dài,
địa điểm chôn lấp phải xa khu dân cƣ, không gần mạch nƣớc ngầm.

4.1.2 Phương pháp đốt có xúc tác

Đây là phƣơng pháp vô cơ hoá chuyển c lo hữu cơ thành CO2, H2O và
Cl-. Clo hữu cơ nếu tiếp xúc với kim loại đồng nung đỏ đều bị đồng lấy mất
clo (tạo thành CuCl2) và chúng bị phân huỷ tiếp theo thành CO2 và nƣớc cùng
với các dẫn xuất khác không độc, hoặc ít độc hơn (Hình 1.3).

Cu / 600-7000C
DDT CO2 + H2O + CuCl2
O2 (không khí)

Hình 1.3. Phƣơng pháp đốt có xúc tác


Công nghệ thiêu đốt cũng đã đƣợc sử dụng trên thế giới, phƣơng pháp
xử lý này tƣơng đối triệt để song giá thành lại cao và có khả năng gây ô nhiễm
thứ cấp bởi các sản phẩm phụ tạo trong quá trình vận hành.

Các phƣơng pháp vật lý khác nhƣ sử dụng tia bức xạ, tia c ực tím, hay
áp suất cao cũng mang lại hiệu quả nhất định trong xử lý ô nhiêm DDT.

4.1.3 Phương pháp phân hủy bằng kiềm nóng



Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
17
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Khi xử lý DDT với dung dịch NaOH 20% nóng, xảy ra phản ứng
dehydroclorua hoá tạo nên một olefin. Olefin đƣợc sinh ra bị polime ho á cho
sản phẩm rắn. Sản phẩm rắn này đƣợc tách ra dễ dàng và cho vào bao nilon
rồi chôn vùi dƣới đất.

Mặc dù làm sạch DDT có thể đƣợc tiến hành bằng nhiều biện pháp nhƣ
đã nêu ở trên, nhƣng nhƣợc điểm của các công nghệ đốt và hóa học là gây ô
nhiễm thứ cấp. Chính vì vậy mà xu hƣớng sử dụng các phƣơng pháp hóa lý
ngày càng giảm.

4.2 Phƣơng pháp phân hủy sinh học

Ngày nay do có những hiểu biết sâu sắc về tác hại của DDT nên các
nhà khoa học và công nghệ Việt Nam đang nghiên cứu tìm ra cá c giải pháp để
có thể làm giảm lƣợng DDT còn sót lại trong đó biện pháp xử lý sinh học
đang đƣợc quan tâm nhiều bởi tính ƣu việt của nó là không tạo ra ô nhiễm thứ
cấp cho môi trƣờng. Phân hủy sinh học đã đƣợc các nhà khoa học trên thế
giới nghiên cứu và áp dụng trong những nă m gần đây và cũng đạt đƣợc khá
nhiều thành tựu [63].

Quá trình làm sạch sinh học có thể thực hiện ở quy mô lớn nhỏ khác
nhau, có thể sử dụng thực vật hay vi sinh vật và ở điều kiện hiếu khí hoặc kị
khí. Việc tẩy độc bằng phân hủy sinh học có thể đƣợc tiến hành riêng rẽ hoặc
kết hợp với các phƣơng pháp khác, sau vài tháng hoặc vài năm các chất ô
nhiễm có thể đƣợc hoàn toàn loại bỏ.

Phân hủy sinh học (Bioremediation) thƣờng bao gồm các phƣơng pháp
sau: Kích thích sinh học (augmentation) và làm giàu sinh học (stimulation).

+ Kích thích sinh học (Biostimulation): là quá trình thúc đẩy sự phát
triển và hoạt động trao đổi chất của tập đoàn vi sinh vật bản địa có khả năng
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
18
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




sử dụng các chất độc hại thông qua việc thay đổi các yếu tố môi trƣờng nhƣ:
pH, độ ẩm, nồng độ O2, chất dinh dƣỡng .v.v.

+ Làm giàu sinh học (Bioaugmentation): sử dụng tập đoàn các vi sinh
vật bản địa đã đƣợc làm giàu hoặc vi sinh vật sử dụng các chất độc hại từ nơi
khác, thậm chí vi sinh vật đã đƣợc cải biến về mặt di truyền đƣa vào các địa
điểm ô nhiễm.

+ Sử dụng thực vật (phytoremediation): sử dụng thực vật, hệ enzyme
của thực vật và các quá trình phức tạp khác nhằm hấp thu hoặc chuyển hóa
các chất ô nhiễm.

Kích thích sinh học hiện là khuynh hƣớng đƣợc sử dụng rộng rãi trong
xử lý ô nhiễm theo phƣơng pháp phân hủy sinh học. Đôi khi ngƣời ta cũng kết
hợp hai biện pháp để có thể tăng cƣờng sự phân hủy sinh học. Song song với
việc bổ sung các chủng vi sinh vật nuôi cấy có khả năng phân hủy chất ô
nhiễm, ngƣời ta cũng tạo điều kiện tối ƣu cho tập đoàn vi sinh vật hoạt động.
Nhƣ vậy, cùng với hoạt động của tập đoàn vi sinh vật bản địa và hoạt động
của vi sinh vật ngoại lai sẽ tăng cƣờng hiệu quả của quá trình xử lý.

Hiện nay, tại Viện Công nghệ Sinh học đã tiến hành một số nghiên cứu
về khả năng phân hủy dầu, các chất độc hại khác nhƣ dioxin, 2,4 -D,
hydrocacbon thơm đa nhân (PAH) v.v. bằng công nghệ phân hủy sinh học và
đã mang lại những hiệu quả khả quan [2]. Đối với DDT, những nghiên cứu
bƣớc đầu về khả năng phân hủy bằng vi sinh vật cũng đang bắt đầ u đƣợc
nghiên cứu để góp phần khử độc DDT ở một số địa phƣơng bị ô nhiễm [5].

Ngoài ra trên thế giới việc ứng dụng hệ enzyme ngoại bào của vi sinh
vật vào xử lý ô nhiêm đã có nhiều nghiên cứu, đây cũng là hƣớng có nhiều
triển vọng do rút ngắn đƣợc thời gian xử lý và hiệu quả xử lý cao hơn so với
khử độc bằng phân hủy sinh học thông thƣờng. Những nghiên cứu bƣớc đầu
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
19
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




về hệ enzyme ngoại bào ứng dụng vào xử lý khử độc đã đƣợc tiến hành tạo cơ
sở cho việc thiết kế công nghệ xử lý các chất ô nhiễm hóa học trong tƣơng lai
[4,5,6]. Hệ enzyme ngoại bào đƣợc quan tâm là hệ enzyme xúc tác với các đại
diện là laccase (oxidoreductase), mangan peroxidase và lignin peroxidase
(peroxidase). Đây là những enzyme có khả năng phân hủy nhiều loại chất ô
nhiễm hữu cơ có cấu trúc đa vòng thơm khác nhau do tính đặc hiệu cơ chất
không cao. Trong đó laccase đƣợc tập trung nghiên cứu, enzyme này xúc tác
quá trình oxy hóa các hợp chất phenolic mạnh nhất trong nhóm enzyme phân
hủy lignocellucose, laccase đƣợc ứng dụng rộng rãi trong côn g nghệ tẩy độc
các hợp chất phenol, các dẫn xuất clo biphenyl, các loại thuốc nhuộm và các
loại nƣớc thải v.v.



5 PHÂN HỦY SINH HỌC DDT

5.1 Khả năng phân hủy DDT bởi vi sinh vật

Các nhà khoa học cũng đã phân lập và nghiên cứu nhiều chủng vi sinh
vật có khả năng phân hủy DDT và các sản phẩm chuyển hóa của nó. Các
nghiên cứu đã chỉ ra rằng số lƣợng các vi sinh vật có khả năng phân hủy DDT
tại các vùng ô nhiễm nhiều hơn so với các vùng không ô nhiễm. Các loài vi
sinh vật trong vùng ô nhiễm có xu hƣớng thíc h nghi, sau đó thay đổi cấu trúc
về di truyền để hƣớng đến việc phân hủy DDT. Các vi sinh vật tiềm năng
tham gia vào quá trình phân huỷ sinh học DDT chủ yếu là vi khuẩn, vi nấm.
Các vi sinh vật này chuyển hoá DDT thông qua quá trình khử loại clo, vi nấm
thủy phân và vi khuẩn phân huỷ chlorobiphenyl thực hiện cắt vòng DDT
trong điều kiện hiếu khí. Ngoài ra vi sinh vật phân huỷ DDT có thể đƣợc thiết
kế chuyển gene dựa trên các kỹ thuật di truyền phân tử và đƣa vào vùng đất
nhiễm. Hiện nay, có tới hơn 300 loà i vi sinh vật có khả năng phân hủy DDT
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
20
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




đã đƣợc nghiên cứu, danh sách dƣới đây đƣa ra một vài đại diện của vi khuẩn,
một số loài nấm và xạ khuẩn ( Phụ lục 2) [20, 29, 48].

Cơ chế của quá trình phân hủy sinh học DDT và đồng phân của nó có
thể là nhờ quá trình cắt vòng hoặc loại khử clo. Các vi sinh vật có khả năng
chuyển hóa DDT và các đồng phân của nó (o,p ,-DDT, p,p,-DDT) thành dạng
bớt độc hơn, không độc hoặc chuyển hóa hoàn toàn thành CO 2. Các cơ chế
tấn công DDT bởi vi sinh vật đã đƣợc công bố cho thấy D DT đƣợc loại clo
bởi quá trình khử dẫn đến DDD. Vi khuẩn và nấm sợi phân huỷ DDT chủ yếu
theo cơ chế này. Một con đƣờng khác phân huỷ sinh học ở điều kiện hiếu khí
đã đƣợc mô tả có sự tham gia của vi khuẩn phân huỷ chlorobiphenyl [15, 42].


5.1.1 Loại clo bởi quá trình khử

Dƣới các điều kiện khử, quá trình loại clo bởi quá trình khử là cơ chế
chủ yếu của quá trình chuyển hoá sinh học các đồng phân o,p´-DDT và p,p´-
DDT của DDT thành DDD (Fries 1969). Phản ứng diễn ra bởi sự thay thế
chlorin mạch thẳng bằng nguyên tử hydro. Một số vi sinh vật chuyển hoá
DDT thành DDD đã đƣợc công bố bao gồm Escheria coli, Enterobacter
aerogenes, Enterobacter cloacae, Klebsiella pneumoniae, Pseudomonas
aeruginosa, Pseudomonas putida, Bacillus sp., “Hydrogenomonas” và một
số nấm nhƣ Saccharomyces cerevisiae, Phanerochaete chrysosporium,
Trichoderma [29,48]. Rochkind-Dubinsky và cộng sự đã phát triển các điều
kiện khử loại trong các bình nuôi cấy. Các cơ chế khử loại clo với sự chuyển
tiếp các kim loại và phức kim loại đóng vai trò chất khử (Hollinger & Schraa
1994). Trong hầu hết các trƣờng hợp các quá trình có sự tham gia của vận
chuyển điện tử đơn, loại ion clo, và tạo gốc alkyl. Sự chuyển tiếp phức hệ kim
loại trong vi sinh vật có kết hợp với các trung tâm hoạt động của các p hân tử

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
21
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




vận chuyển điện tử. Ở E. coli, khử loại clo của DDT cần FAD và các điều
kiện kỵ khí, trong khi đó ở E. aerogenes là cytochrom oxidaza [29].

 Con đường chuyển hoá DDT bởi vi khuẩn theo cơ chế loại khử clo

Trƣớc tiên DDT bị phân hủy tạo DDMS, quá trình phân hủy tiếp theo
sẽ là quá trình loại Cl tạo DDNU,sau đó sẽ là quá trình oxy hoá tạo DDOH,
DDOH bị oxy hoá tiếp thành DDA và loại carbon thành DDM, DDM có thể
đƣợc chuyển hoá tạo DBP hoặc tách một vòng thơm tạo p -chlorophenylaxetic
acid (PCPA). Trong điều kiện kị khí DBP khô ng thể chuyển hóa xa hơn nữa
(Hình 1.4) [29].




Hình 1.4. Con đƣờng chuyển hoá DDT bởi vi khuẩn trong điều kiện kị khí theo
cơ chế loại khử clo



5.1.2 Khoáng hoá DDT bởi nấm thủy phân lignin

Nấm thủy phân lignin có khả năng phân huỷ nhiều loại chất hữu cơ bền
vững trong môi trƣờng tự nhiên trong đó có DDT. Aust 1990 chỉ ra rằng
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
22
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




khoáng hoá DDT xảy ra đồng thời với quá trình sinh ligninaza. Khi DDT
đƣợc bổ sung vào giống nấm thủy phân lignin quá trình khoáng hoá bắt đầu
ngay lập tức nhƣng nếu thí nghiệm bắt đầu từ giống là bào tử thì sự phân huỷ
và hoạt tính thủy phân lignin xảy ra đồng thời sau 4 ngày.

 Con đường phân hủy DDT bởi loài nấm trắng Phanerochaete
chrysosporium

Sự phân hủy DDT bởi nấm đảm trắng P. chrysosporium đƣợc biết đến
trong công trình nghiên cứu của Aust và cộng sự [15]. Bumpus và Aust đã
miêu tả sự phân hủy của DDT sau 30 ngày nuô i cấy (trong điều kiện thiếu N),
có khoảng 50% DDT đã đựơc chuyển hoá, trong đó 10% đƣợc khoáng hoá,
phần còn lại đƣợc chuyển hoá thành dicofol, FW-152 và bị phân hủy tạo
DBP. Tiếp đó là phản ứng phá vòng tạo CO2. Quá trình này đƣợc điều khiển
bởi hệ enzyme ligninase. Dicofol đƣợc tạo thành sau pha lag, DDD đƣợc tạo
thành sau pha suy tàn trên đó sẽ bị phân hủy bởi hệ enzyme ligninase khác.
Trong trƣờng hợp này DDE không đƣợc phát hiện. Trong quá trình khoáng
hoá DDT thì tinh bột và cenlulose là nguồn C tốt hơn so với nguồn C khác
(muối cacbornate) kể cả đƣờng (Hình 1.5)


5.1.3 Phân hủy DDT bởi vi khuẩn trong điều kiện hiếu khí

Kỹ thuật làm giàu vi sinh vật đã đƣợc sử dụng trong đó một hợp chất có
cấu trúc tƣơng tự đã đƣợc dùng thay thế DDT. Một số chủng vi khuẩn đã thể
hiện khả năng phân huỷ DDT theo các cơ chế mới. Chủng B-206 sinh ra các
chất trung gian phenol từ DDT, DDD, và DDE, tuy nhiên kh ông có sản phẩm
cắt vòng nào đƣợc tạo ra [42]. Nadeau 1994 thông báo về chủng Alcaligenes
eutrophus A5 chuyển hoá các đồng phân o,p´-và p,p´-DDT. Aiskable 1997 đã
phân lập đƣợc vi khuẩn Gram dƣơng từ đất nhiễm DDT ở New Zealand theo
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
23
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




phƣơng pháp làm giàu trên môi trƣờng khoáng chứa biphenyl, DDT, DDD và
DDE nhƣ là nguồn cacbon [42].




Hình 1.5. Con đƣờng phân hủy DDT bởi loài nấm trắng P. chrysosporium



Một trong các con đƣờng phân hủy DDT đƣợc nghiên cứu khá kỹ trên
đối tƣợng vi khuẩn Alcaligenes eutrophus A5, dƣới đây là cơ chế phân hủy
thực hiện bởi vi khuẩn này.

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
24
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




 Con đường phân hủy DDT bởi vi khuẩn Alcaligenes eutrophus A5

Chủng Alcaligenes eutrophus A5 có khả năng chuyển hoá cả o,p,- và
p,p,-DDT. DDT bị oxy hoá bởi enzym dioxygenase tạo ra một dẫn xuất
dihydrodiol- DDT và trải qua qúa trình phá vỡ vòng ở vị trí meta. Tiếp đó là
một loạt các phản ứng trung gian tạo sản phẩm cuối cùng là 4 - chlorobenzoic
acid (Hình 1.6).




Sản phẩm cắt vòng màu vàng




Hình 1.6. Con đƣờng phân hủy DDT bởi Alcaligenes eutrophus A5
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
25
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




5.2 Các điều kiện môi trƣờng ảnh hƣởng đến phân hủy sinh học DDT
và các dẫn xuất của DDT

Các yếu tố môi trƣờng ảnh hƣởng lớn đến sự phát triển của vi sinh vật.
Đặc biệt các yếu tố môi trƣờng tại vùng phân lập có tác động lớn đến sự phát
triển của vi sinh vật tại đó. Ở những vùng nhiệt đới, DDT bay hơi dễ hơn và
vi sinh vật cũng phân hủy các chất ô nhiễm này nhanh hơn, DDT ở đất ẩm bị
phân hủy nhanh hơn ở đất khô. Trong quá trình xử lý môi trƣờng thì vấn đề
này càng đóng vai trò quan trọng và quyết định hiệu suất xử lý. Các yếu tố
nhƣ nhiệt độ, độ pH môi trƣờng, nồng độ muối, nồng độ chất độc, các chất
hoạt động bề mặt v.v. đóng vai trò quyết định trong quá trình phân hủy,
chuyển hóa và khoáng hóa DDT.

Trong tự nhiên không chỉ tồn tại một loại chất ô nhiễm thuộc
hydrocacbon thơm đa nhân mà thƣờng chúng tồn tại dƣới dạng hỗn hợp. Do
đó việc nghiên cứu khả năng phân hủy hỗn hợp DDT là điều cần thiết để xem
ảnh hƣởng qua lại của chúng trong hỗn hợp cũng nhƣ nồng độ hỗn hợp của
các chất ô nhiễm. Sự tồn tại của DDT có thể thúc đẩy hoặc ức chế quá trình
phân hủy sinh học hoặc gây độc cho vi sinh vật.

Các yếu tố quan trọng khác là nguồn dinh dƣỡng bao gồm C, N, P có
sẵn trong môi trƣờng hay bổ sung thêm. Việc bổ sung các chất thêm nhƣ
nguồn cacbon cũng tạo điều kiện tăng khả năng phân hủy sinh học của các
chủng vi sinh vật phân hủy chất độc theo cơ chế đồng trao đổi chất , một số
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
26
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




chất thƣờng đƣợc bổ sung nhằm kích thích thêm quá trình phâ n hủy chất độc
có thể kể đến glucose, acetate, pyruvate. Các muối N đóng một vai trò hết sức
quan trọng trong quá trình xử lý bằng phƣơng pháp phân hủy sinh học, việc
bổ sung nguồn muối này đã làm tăng tốc độ phân hủy DDT. Nguồn N có thể
thêm vào cả dạng vô cơ và hữu cơ [23]. Phốtpho cũng là một nguồn dinh
dƣỡng cần thiết để tăng cƣờng quá trình phân hủy sinh học các chất ô nhiễm.
Nó đƣợc sử dụng để tăng sinh khối tế bào, thƣờng bổ sung muối gốc PO43-.
Nitơ và Phốtpho thƣờng bổ sung dƣới dạng muối (NH4)2HPO4. Hơn nữa,
phốtpho nhƣ là một chất đệm pH để tạo pH thích hợp cho hoạt động của vi
sinh vật nhằm tăng hoạt tính sinh học của chúng, do vậy làm tăng khả năng
sống sót của vi sinh vật trong các môi trƣờng có điều kiện khác nhau.

Ngoài ra tốc độ phân hủy các hợp chất hydrocacbon thơm đa nhân còn
bị ảnh hƣởng mạnh bởi các chất hoạt động bề mặt. Chất hoạt động là một sản
phẩm rất có giá trị đối với công nghệ sinh học và nó đã đƣợc ứng dụng rất
rộng rãi đối với nhiều ngành công nghiệp khác nhau. Đối với đất bị nhiễm
độc, các chất hoạt động bề mặt có thể làm tăng khả năng phân hủy, nó phụ
thuộc vào thời gian phân hủy và số lần các chất hoạt động bề mặt bám vào bề
mặt chất độc [36].

Bên cạnh đó quá trình phân hủy sinh học của vi sinh vật còn phụ thuộc
vào bản thân các vi sinh vật, phƣơng thức mà các vi sinh vật chuyển cơ chất
qua màng tế bào. Ngoài cơ chế phân hủy DDT và dẫn xuất của DDT bởi các
enzyme nội bào tức là phải chuyển các chất độc qua màng tế bào thì cơ chế
xúc tác phân hủy DDT bằng các enzyme ngoại bào cũng đã đƣợc quan tâm.
Trong đó ba enzyme ngoại bào LiP, MnP thuộc nhóm peroxidase và Lac
thuộc nhóm oxidoreductase hiện nay đƣợc quan tấm nhiều nhất.



Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
27
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




6 LACCASE

6.1 Định nghĩa
Laccase (p- benzenediol:oxygen oxidoreductase, E.C.1.10.3.2) thuộc
nhóm enzyme oxidase, cụ thể là polyphenol oxidase. Trong phân t ử có chứa 4
nguyên tử đồng có khả năng oxy hóa cơ chất sử dụng phân tử oxy làm chất
nhận điện tử. Khác với phần lớn các enzyme khác, laccase có phổ cơ chất rất
đa dạng, bao gồm diphenol, polyphenol, các dẫn xuất phenol, diamine, amine
thơm, benzenethiol, PCB, dioxin và cả các hợp chất vô cơ nhƣ iot. Các loạ i
enzyme laccase tách chiết từ các nguồn khác nhau rất khác nhau về mức độ
glycosyl hóa, khối lƣợng phân tử và tính chất động học [35].


6.2 Cấu trúc phân tử của laccase
Một loài sinh vật có thể có nhiều dạng isozyme của laccase, các dạng
isozyme này khác nhau về trình tự acid amine và một số tính chất về động học
xúc tác. Nấm có thể tạo ra nhiều dạng isozyme laccase khác nhau cả về mức
độ glycosyl hóa và cả thành phần các gốc carbonhydrate. Trametes versicolor
có 5 dạng isozyme chỉ khác nhau về thành phần carbonhydrate, thành phầ n
carbonhydrate của chúng thay đổi từ 10 – 45% so với khối lƣợng của thành
phần protein. Phân tử laccase thƣờng là monomeric protein, chỉ một số là
oligomeric protein, có khối lƣợng phân tử dao động trong khoảng 60 – 90 kD.
Phần lớn laccase c ủa nấm có bản chất là glycoprotein với hàm lƣợng
carbonhydrate chiế m khoảng 10 – 25% [34].
Tuy vậy, tất cả laccase đều giống nhau về cấu trúc trung tâm xúc tác
với 4 nguyên tử đồng. Những nguyên tử đồng này đƣợc chia thành 3 nhóm:
loại 1 (T1), loại 2 (T2) và loại 3 (T3), chúng khác nhau về tính chất hấp thụ
ánh sáng và thế điện tử. Các nguyên tử đồng T1 và T2 có tính chất hấp phụ
điện tử và tạo thành phổ điện tử mạnh, trong khi cặp nguyên tử đồng T3
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
28
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




không tạo phổ hấp thụ điện tử, và có thể đƣợc hoạt hóa khi liên kết với anion
mạnh.
Phân tử laccase thông thƣờng bao gồ m 3 tiểu phần chính (vùng) A, B,
C có khối lƣợng tƣơng đối bằng nhau, cả ba phần đều có vai trò trong quá
trình xúc tác của laccase. Vị trí liên kết với cơ chất nằm ở khe giữa vùng B và
C, trung tâm một nguyên tử đồng nằm ở vùng C và trung tâm ba nguyên t ử
đồng nằm ở bề mặt chung của vùng A và C. Trung tâm đ ồng một nguyên tử
chỉ chứa 1 nguyên tử đồng T1, liên kết với một đoạn peptide có 2 gốc
histidine và 1 gốc cystein. Liên kết giữa nguyên tử đồng T1 với nguyên tử S
của cystein là liên kết đồng hóa trị bền và hấp thụ ánh sáng ở bƣớc sóng 600
nm, tạo cho laccase có màu xanh nƣớc biển đặc trƣng. Trung tâm đồng 3
nguyên tử có nguyên tử đồng T2 và cặp nguyên tử đồng T3. Nguyên tử đồng
T2 liên kết với 2 gốc histidine bảo thủ trong khi các nguyên tử đồng T3 thì tạo
liên kết với 6 gốc histidine bảo thủ (Hình 1.7, 1.8) [35].




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
29
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 1.7. Hình ảnh không gian ba chiều của laccase từ M. albomyces

Tiểu phần A, B, C đƣợc kí hiệu đỏ, xanh lục và xanh lá cây




Hình 1.8. Trung tâm hoạt động của laccase

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
30
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




6.3 Cơ chế xúc tác của laccase

Laccase là enzyme oxy hóa khử có khả năng oxy hóa diphenol và các
hợp chất có liên quan, sử dụng oxy phân tử làm chất nhận điện tử. Khác vớ i
phần lớn các loại enzyme khác, laccase có phổ đặc hiệu cơ chất khá rộng. Sự
phù hợp của các cơ chất đối với laccase quyết định bởi hai nhân tố chính. Thứ
nhất là sự phù hợp giữa cơ chất và nguyên tử đồng T1, thứ hai là sự phụ thuộc
vào sự chênh lệch giữa thế oxy-hóa khử giữa cơ chất và enzyme. Các đại
lƣợng này phụ thuộc cấu trúc hóa học của cơ chất. Thế oxy hóa khử của
laccase dao động trong khoảng 0,4 đến 0,8 V [9]. Cơ chất khử bị mất một
điện tử nhờ xúc tác laccase thƣờng tạo thành một gốc tự do, gốc tự do không
bền này tiếp tục bị oxy hóa nhờ xúc tác bởi chính laccase đó hoặc tiếp tục các
phản ứng không cần xúc tác enzyme nhƣ hydrate hóa, phân ly hoặc polymer
hóa.
Trung tâm nguyên tử đồng một nguyên tử (T1) là nơi diễn ra phản ứng
oxy hóa cơ chất. Cơ chất chuyển một điện tử cho nguyên tử đồng T1, biến
nguyên tử đồng T1 (Cu2+) trở thành dạng Cu+, hình thành phân tử laccase có
cả 4 nguyên tử đồng đều ở trạng thái khử (Cu+). Một chu kỳ xúc tác liên quan
đến sự vận chuyển đồng thời 4 electron từ nguyên tử đồng T1 sang cụm
nguyên tử đồng T2/T3 qua cầu tripeptide bảo thủ His-Cys-His. Phân tử oxy
sau đó oxy hóa laccase dạng khử, tạo thành hợp chất trung gian peroxy, và
cuối cùng bị khử thành nƣớc (Hình 1.9).




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
31
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 1.9. Cơ chế xúc tác của laccase

Ngoài ra cơ chế xúc tác có thể xảy ra theo một trong các cơ chế sau. Cơ
chế đơn giản nhất có thể diễn ra khi các cơ chất bị oxy hóa trực tiếp bởi trung
tâm hoạt động do 4 nguyên tử đồng đả m nhiệ m. Tuy nhiên, các phần tử cơ
chất thƣờng có cấu tạo cồng kềnh hoặc có thế khử quá lớn, vì vậy chúng
không thể tiếp cận đƣợc trung tâm phản ứng của phân tử laccase. Trong
trƣờng hợp này cần một hợp chất hóa học trung gian (mediator). Hợp chất hóa
học này có thể tiếp xúc với trung tâm phản ứng của laccase và bị laccase oxy
hóa thành dang gôc tự do [52]. Sau đo mediator ơ dang oxy hoa nhân môt điên
̣ ́ ́ ̣̉ ́ ̣ ̣ ̣
tƣ cua cơ chât va trơ thanh khƣ, tiêp tuc tham gia vao chu ky xac tac. Ngƣơc lai,
̉̉ ́̀̉ ̀ ̣̉́ ̀ ̀́́ ̣̣
laccase sau khi cho mediator môt điên tƣ thì trơ thanh dang khƣvà sau đó bị oxy
̣ ̣ ̉ ̉ ̀ ̣ ,̉
hoá thành dạng oxy hoá và tiếp tục tham gia vào chu kỳ xúc tác tiếp theo (Hình
1.10). Các mediator thƣờng phù hợp cho laccase la 3-Hydroxyanthranillic acid
̀
(HAA), 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), N-
hydroxybenzo-trialzone (HBT), N-hydroxyphtaimide (HPI), violuric acid ( VLA)
v.v [52]. Sƣ tham gia cua mediator đã làm tăng ph cơ chất xúc tác và tí nh không
̣ ̉ ổ
đăc hiêu cơ chât c a laccase.
̣ ̣ ́ủ




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
32
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




A




B




Hình 1.10. Các kiểu xuc tac cua laccase
́́ ̉

A. Chu kỳ xúc tác không có sự tham gia của các mediator
B. Chu kỳ xúc tác với sự tham gia của các mediator

Các chất ức chế của laccase thƣờng là các ion nhỏ nhƣ azide, cyanide,
fluoride. Các ion này sẽ liên kết vào trung tâm đồng 3 nguyên và cản trở các
dòng điện tử đi đến các nguyên tử này. Các chất ức chế laccase khác là
ethylenediaminetetraacetic acid (EDTA), acid béo, tropolone, acid kojic và
acid coumaric, nhƣng chúng chỉ có tác dụng ức chế ở nồng độ cao hơn. Các
hợp chất chứa sulfhydryl nhƣ L-cystein, dithiothreitol và thioglycolic acid
cũng đƣợc coi là các chất ức chế laccase.


6.4 Tính chất hóa sinh của laccase

Hoạt tính xúc tác c ủa enzyme đƣợc đặc trƣng bởi hằng số Michaelis -
Menten (Km). Hằng số này của laccase dao động trong một giới hạn khá
rộng, trong khoảng 2 – 500µM phụ thuộc vào nguồn gốc enzyme và cơ chất.
Giá trị Km thấp nhất đối với cơ chất là syringaldazine (một dạng dimer của
hai phân tử 2,6-dimethoxyphenol liên kết với nhau bằng cầu nối azide). Ái lực
đối với oxy thì ít phụ thuộc vào enzyme hơn và chỉ dao động trong khoảng 20
- 50µM.


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
33
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Laccase hoạt động tối thích trong khoảng pH 4 – 6 đối với cơ chất
phenolic. Khi tăng pH sang vùng trung tính hoặc vùng kiềm thì hoạt tính của
laccase bị giả m, nguyên nhân do anion nhỏ là ion hydroxide đã ức chế
laccase. Mặt khác, tăng pH còn làm giả m thế oxy hóa khử của các cơ chất
phenolic do đó cơ chất phenolic dễ bị oxy hóa bởi laccase hơn. Do vậy, hoạt
tính laccase ở các pH khác nhau là kết quả của hai tác dụng đối lập của pH là
sự tăng chênh lệch thế oxy hóa khử laccase – cơ chất và tác dụng ức chế trung
tâm đồng ba nguyên tử của ion hydroxide. Đối với các cơ chất không phải
phenolic nhƣ ABTS thì phản ứng oxy hóa không liên quan đến sự vận chuyể n
ion và do đó pH tối thích nằm trong khoảng 2 – 3. Ngƣợc lại, tính bền của
laccase cao nhất trong khoảng pH kiềm nằm trong khoảng 8 – 9.

Nhiệt độ bền của laccase dao động đáng kể, phụ thuộc vào nguồn gốc
của vi sinh vật. Nhìn chung, laccase bền ở 30 – 50oC và nhanh chóng mất
hoạt tính ở nhiệt độ trên 60oC. Laccase bền nhiệt nhất đƣợc phân lập chủ yếu
từ các loài thuộc prokaryote ví dụ, thời gian bán hủy của laccase c ủa
Streptomyces lavendulae là 100 phút ở 70oC và của protein cotA từ loài
Bacillus subtilis là 112 phút ở 80oC. Thời gian bán hủy của laccase có nguồn
gốc nấm thƣờng là nhỏ hơn 1 giờ ở 70oC và dƣới 10 phút ở 80oC [9,35,43,55].


6.5 Sự phân bố và một số vi sinh vật sinh laccase

Laccase là enzyme rất phổ biến trong tự nhiên, chúng đƣợc tìm thấy ở
thực vật, nấm, một số vi khuẩn và côn trùng. Laccase lần đầu tiên đƣợc phát
hiện đầu tiên ở cây Rhus vernicifera. Việc nghiên cứu laccase trên đối tƣợng
thực vật và nấm đảm rất phổ biến. Laccase từ nấm đƣợc nghiên cứu và khảo
sát rất kỹ đặc biệt là laccase từ nấm đảm Basidomyces. Ngoài ra các các loài
nấm nhƣ Ascomyces, Deuteromyces, basidomyces và các loài nấm có khả

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
34
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




năng phân hủy ligincellulose nhƣ Agaricus bisporus, Botrytis cinerea,
Chaetomium themophilum, Coprius cinereus, Neurospora crassa, Phlebia
radiate, Pleurotus ostrotus ostreatus, Pycnoporus cinnabarius, Trametes
versicolor [35]. Tuy nhiên, các nghiên cứu này trên các đối tƣợng nấm sợi, xạ
khuẩn và vi khuẩn lại không nhiều. Một số vi sinh vật có khả năng sinh
laccase đƣợc miêu tả ở phụ lục 3 [21,25,38,44,56,60].



6.6 Gene mã hóa laccase

Trong vài thập kỷ gần đây, gene sinh tổng hợp laccase đã bắt đầu đƣợc
nghiên cứu. Cho đến nay đã có hơn 100 gene sinh tổng hợp laccase đƣợc đánh
giá và so sánh. Các nghiên cứu chủ yếu tập trung trên đối tƣợng vi sinh vật.
Năm 1998 gene laccase đầu tiên đƣợc phân lập và giải trình tự từ nấ m đả m
Neurospora crassa và nấm sợi Aspergillus nidulans. Tuy nhiên các gene
tƣơng ứng với các protein laccase hoàn chỉnh mới chỉ có khoảng 20 gene,
phần lớn trong số đó là từ nấm đảm [9,32,35,44,60] ( Phụ lục 4).

Đối với nấm đảm và thực vật bậc cao, các gene laccase thƣờng có
nhiều intron. Số lƣợng intron trong mỗi gene thƣờng từ 8 – 13 đoạn, mỗi đoạ n
có kích thƣớc khoảng 50 – 90 nucleotit. Ngoài ra cũng có những gene laccase
chỉ có một intron nhƣ Neurospora crassai, ngƣợc lại Pleurotus ostreatus lại
có đến 19 đoạn intron. Các gene điển hình mã hóa protein laccase thƣờng có
kích thƣớc khoảng 500 – 600 axit amin.

Ở nhiều chủng nấm trong bộ gene chứa nhiều gene mã hóa sinh tổng
hợp laccase. Trametes villosa chứa ít nhất 5 gene mã hóa cho laccase,
Coprinus cinereus chứa ít nhất 8 gene và Rhizoctonia solani, Pleurotuss
sajor-caju chứa ít nhất là 4 gene mã hóa laccase. Tuy nhiên các gene này nằ m

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
35
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




ở các allen khác nhau trên nhiễ m sắc thể và các trình tự bảo thủ liên quan đến
vị trí liên kết với các nguyên tử đồng lại đồng thời cũng có mặt trong các gene
mã hóa các enzyme oxidase chứa nhiều nguyên tử đồng khác, chính những
điều này đã gây khó khăn trong việc phân lập và xác định chính xác số gene
mã hóa cho laccase.

Sự biểu hiện của gene sinh tổng hợp laccase phụ thuộc rất nhiều vào
điều kiện môi trƣờng. Với mỗi chủng khác nhau thì đòi hỏi điều kiện môi
trƣờng thích hợp cho sinh tổng hợp laccase khác nhau. N hƣ môi trƣờng giàu
nitơ làm tăng quá trình sinh tổng hợp laccase ở chủng Pleurotus sajor-caju,
nhƣng chủng Lentinula edodes lại có khả năng sinh tổng hợp laccase t ốt hơn
trên môi trƣơn g co ham lƣơng nitơ thâp . Đồng và các ion kim loại khác nhƣ
̀ ́̀ ̣ ́
Hg2+, Mg2+, Cd2+ và một số hợp chất vòng thơm đƣợc xem là những nhân tô
́
hoạt hóa mạnh quá trình sinh tổng hợp laccase. Quá trình hoat hóa gene sinh
̣
tổng hợp laccase bởi các ion kim loại hoặc các hợp chất phenol chƣng minh la
́ ̀
đƣợc điều khiển bởi một trình tự điều hòa của vùng promoter cua gene
̉
[32,35].

Gene mã hóa sinh tổng hợp laccase đã đƣợc chuyển vào nhiều đố i
tƣợng khác nhau nhƣ Escherichia coli, Saccharomyces cerevisiae , Aspergillus
niger, A. nodulan, A. oryzae, cây thuốc lá v.v. Trong nghiên cứu mới nhất
(2009) Xiaoshu Shao và cộng sự đã chỉ ra rằng, hoạt tính của laccase từ
Shigella dysenteriae đƣợc biểu hiện trong Escherichia coli (Wlac) tăng từ
24,4 UI/mg lên 52,9 UI/mg sau khi thay thế hai axit amin Glu 106 bằng Phe
106 trong chuôi xoăn anpha (WlacS). Với kỹ thuật đột biến xóa đoạn trong
̃ ́
chuỗi xoăn anpha t ừ Leu 351 đến Gly 378 (WlacD), hoạt tính enzyme tăng
́
3,5 lần so với laccaseWlac). Đồng thời cả hai WlacS và WlacD đều bền nhiệt
hơn Wlac [60].

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
36
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Trình tự gene mã hóa laccase có thể chia thành 3 nhóm chính là
Ascomycete, Basidomycete và thực vật bậc cao. Tuy nhiên các nghiên c ứu về
gene mã hóa laccase ở prokaryote hiện nay không nhiều.


6.7 Ứng dụng của laccase

Phƣơng pháp oxy hóa sinh học nhờ enzyme đƣợc xem là phƣơng pháp
khả quan có thể thay thế các phƣơng pháp oxy hóa hóa học do chúng rất thân
thiện với môi trƣờng và đặc biệt là do phản ứng bởi enzyme thƣờng rất đặc
hiệu và có hiệu suất cao. Laccase là một trong các loại enzyme oxy hóa đƣợc
ứng dụng khá phổ biến trong các ngành công nghiệp do chúng có phổ cơ chất
rộng và sử dụng chất nhận điện tử cuối cùng là oxy phân tử chứ không phải
cần các chất nhận điện tử đắt tiền khác nhƣ NAD(P)+. Laccase đƣợc sử dụng
trong một số ngành nhƣ công nghiệp dệt nhuộ m, công nghiệp hóa mỹ phẩm,
hóa thực phẩ m, dƣợc phẩ m v.v. Laccase có tiềm năng cao trong công nghệ
nano sinh học để tạo các biosensor có độ nhạy cao. Ngoài ra còn đƣợc sử
dụng trong phân hủy các hợp chất lignincellulose và xử lý các chất ô nhiễ m
khó phân hủy [11,17,35,52,58].

Laccase rất hữu hiệu trong việc tham gia xúc tác phân hủy các chất độc
thông qua quá trình oxy hóa đặc biệt là các chất phức tạp, không tan. Laccase
có thể tham gia phân hủy các hợp chất phenol là chất thải của các quá trình
sản xuất khác nhau nhƣ hóa dầu, sản xuất các hợp chất hữu cơ v.v. Laccase
đƣợc cố định trên các vật liệu mang và hệ thống xúc tác laccase - mediator tỏ
ra hiệu quả trong việc chuyển hóa các chất ô nhiễm chứa phenol và các hợp
chất dẫn xuất clo phenol khác nhƣ các hợp chất hydrocarbon thơm đa nhân
(polycyclic aromatic hydrocarbon – PAH), polychlorinated biphenyl (PCB) t ừ
ngành công nghiệp dầu mỏ, thuốc nổ 2,4,6-trinitrotoluen (TNT) trong ngành

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
37
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




khai khoáng, quân s ự, thuốc trừ sâu (Dichloro Diphenyl Trichloroethane -
DDT, Hexacyclohexan - HCH v.v.), thuốc diệt cỏ hóa học (2,4,5-
Trichlorophenoxyacetic acid - 2,4,5-T; 2,4-Dichlorophenoxyacetic acid - 2,4-
D v.v.) dùng trong nông nghiệp [58].


6.8 Lignin peroxidase và Mangan peroxidase

6.8.1 Lignin peroxidase

Lignin peroxidase là một glycoprotein có chứa nhân heme, enzyme này
xúc tác quá trình oxy hóa lignin và các hợp chất có vòng giống lignin khi có
mặt H2O2 trong môi trƣờng. LiP có trọng lƣợng phân tử từ 36 – 48 kDa, pH
tối thích cho hoạt động trong khoảng 2,5 – 3, điể m đẳng điện pI là 3,2 – 4
[24].

LiP có thể xúc tác các phản ứng oxy hóa các hợp chất phenol dẫn đế n
mở vòng do có thế oxy hóa khử cao. Thế oxy hóa khử cao đƣợc giải thích do
các hợp chất chất trung gian đƣợc tạo ra trong chu trình xúc tác c ủa LiP là các
hợp chất LiPI và LiPII. Chu trình xúc tác của LiP đƣợc miêu tả ở hình 1.11.
Đầu tiên LiP bị oxy hóa thành LiPI nhờ H2O2, tiếp theo LiPI oxy hóa cơ chất
(hợp chất vòng thơm) và trở thành LiPII. LiPII tiếp tục oxy hóa một phân tử
cơ chất khác và trở về dạng ban đầu rồi tiếp tục một chu trình xúc tác khác.



LiP + H2 O2 H2O + LiPI
R+. + LiPII
LiPI + R
LiPII + R + 2H+ R+. + H2O + LiP

Hình 1.11. Chu trình hoạt hông của LiP
̣
R – Hợp chất hƣu cơ chứa vòng thơm
+.
R Hợp chất hữu cơ chứa vòng thơm bị oxy hóa thành gốc cation tự do
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
38
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




6.8.2. Mangan peroxidase

Mangan peroxidase cũng giống nhƣ LiP thuộc nhóm enzyme xúc tác
phản ứng với sự có mặt của H2O2. Enzyme này hoạt động nhƣ một
phenoloxydase bằng cách sử dụng Mn3+/Mn2+ làm cặp oxy hóa khử trung
gian, chúng tham gia phản ứng oxy hóa phenol và các hợp chất dẫn xuất
phenol bằng cách tấn công trực tiếp vào cấu trúc vòng thơm chuyển hóa
chúng thành những gốc có trọng lƣợng phân tử thấp theo con đƣơng oxy hóa
khử mangan gián tiếp. Cơ chế xúc tác của MnP đƣợc thể hiện trong hình 1.12
[14].

MnP + H2O2 MnPI + H2O
MnPI + Mn2+ MnPII + Mn3+
MnPII + R+.
MnPI + R
MnPII + Mn2+ + Mn3+ + H2O
MnP
Mn3+ + R Mn2+ + R+.
Hình 1.12. Chu trình hoạt hông của MnP
̣
R – Hợp chất hƣu cơ chứa vòng thơm
R+. – Hợp chất hữu cơ chứa vòng thơm bị oxy hóa thành gốc cation tự do


Hai enzyme LiP và MnP cũng đƣợc nghiên cứu và sử dụng nhiều trong
các ngành công nghiệp. Tuy nhiên để xử lý ô nhiễm các chất POPs trong đó
có DDT và các dẫn xuất thì Lac dễ thực hiện hơn do laccase xúc tác chỉ cầ n
oxy phân tử.


7 PHÂN LOẠI VI SINH VẬT

7.1 Phân loại theo phƣơng pháp truyền thống

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
39
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Phƣơng pháp phân loại cổ điển sử dụng hình thức kết hợp những đặc
điểm hình dạng bên ngoài và các đặc điểm sinh lý để phân loại. Các đặc điể m
hình thái nhƣ hình dạng, kích thƣớc tế bào, màu sắc của khuẩn lạc, kích cỡ
của tế bào vi sinh vật, khả năng bắt màu khi nhuộ m Gram, các đặc điểm vi
cấu trúc, cách thức chuyển động của tế bào, hình thức sinh sản, hình dạng và
vị trí của nội bào tử trong tế bào, hình thái và vị trí bào tử trong tế bào mẹ v.v.
Các đặc điể m về sinh lý và trao đổi chất nhƣ nguồn cacbon và nitơ đƣợc sử
dụng, nguồn năng lƣợng, cơ chế chuyển hóa năng lƣợng, kiểu dinh dƣỡng,
các sản phẩm trao đổi chất, giới hạn về nhiệt độ và nhiệt độ tối thích cho sinh
trƣởng, các hợp phần cấu tạo thành tế bào, giới hạn về pH tối thích cho sinh
trƣởng, các sắc tố quang hợp, các chất dự trữ, tính mẫn cảm với chất ức chế
sinh trƣởng v.v. Ngoài ra còn rất nhiều phƣơng pháp phổ biến khác nữa nhƣ
kiểm tra phản ứng sinh hóa của vi sinh vật với các chất phản ứng khác nhau,
các phản ứng miễn dịch của các kháng nguyên là thành phần cấu tạo của tế
bào nhƣ kháng nguyên O của lipopolysaccharid hay của bao nhày thƣờng
đƣợc sử dụng để phân biệt các chủng của một loài.


7.2 Phân loại bằng phƣơng pháp xác định và so sánh trình tự gene mã
hóa 18S rRNA

7.2.1 Một số phương pháp phân loại bằng sinh học phân tử

Từ cuối thế kỉ XX đặc biệt là những năm 80 trở lại đâ y, với sự phát
triển mạnh mẽ của sinh học phân tử, các nhà khoa học đã có một công cụ mới
cho việc phân loại vi sinh vật đó là phân loại học phân tử. Phƣơng pháp này
có ƣu điểm là thời gian đòi hỏi ngắn và tính chính xác cao. Phƣơng pháp này
cho phép phát hiện, mô tả và giải thích đƣợc tính đa dạng sinh học ở mức
phân tử giữa các loài và trong phạm vi loài.

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
40
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Phân loại học phân tử có thể dựa trên sự nghiên cứu các gene trong hệ
gene nhân, hệ gene của các bào quan (ti thể và lạp thể) hoặc các sản phẩm của
gene (protein, enzyme). Mỗi loại gene, sản phẩm của gene lại phù hợp với
từng đối tƣợng và mục đích nghiên cứu khác nhau. Do đó, việc lựa chọn gene
nào, loại protein nào có ý nghĩa lớn đối với sự thành công của mỗi hƣớng
nghiên cứu. Từ các nghiên cứu này, các nhà phân loại học có cơ sở chính xác
hơn trong việc đƣa ra các kết luận về phân loại học. Một số phƣơng pháp kĩ
thuật phân loại hiện đại đƣợc mô tả trong phụ lục 5 [1].


7.2.2 Phân loại dựa vào trình tự gene mã hoá 18S rRNA

Ngày nay, việc nghiên cứu phân tử rRNA là phƣơng pháp hữu hiệ u
nhất để xác định mối quan hệ trên cây tiến hóa của các vi sinh vật, vì rRNA
có mặt ở tất cả các loại vi sinh vật, có chức năng xác định và là trình tự có
tính bảo thủ cao, chúng chỉ khác nhau rất ít giữa các nhóm vi sinh vật. Tuy
nhiên dựa vào sự khác nhau này, ngƣời ta có thể đánh giá đƣợc mối quan hệ
phát sinh chủng loại và phân loại các chủng vi sinh vật.

Trong tế bào, riboxom có thể tồn tại trong tế bào chất, trên mạng lƣới
nội sinh chất, hay trong ty thể và lục lạp. Riboxom có cấu trúc gồm hai tiểu
đơn vị, mỗi tiểu đơn vị gồm có 2 thành phần riêng rẽ về rRNA và protein. Vi
sinh vật nhân thật có hằng số lắng 80S gồm hai tiểu đơn vị 60S và 40S, tiểu
đơn vị 60S chứa các loại 5S; 5,8S và 28S rRNA, tiểu đơn vị 40S có chứa 18S
rRNA. Trong 4 loại rRNA của sinh vật nhân thật (5S; 5,8S; 18S; 28S) thì
gene mã hóa cho 18S rRNA (kích thƣớc khoảng 1900 nucleotit) là phù hợp
nhất cho các nghiên cứu phân loại nấm. Sở dĩ nhƣ vậy là do gene mã hóa cho
5S và 5,8S rRNA có kích thƣớc khoảng 120 và 160 nucleotit dễ xác định và
so sánh trình tự nhƣng lại quá ngắn để có thể phân biệt một cách chi tiết giữa
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
41
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




các chủng. Còn gene mã hóa cho 28S rRNA có kích thƣớc khoảng 4200
nucleotit, quá lớn, gây khó khăn cho tách dòng , xác định và so sánh trình t ự
của cơ thể đa bào. Chỉ có gene mã hóa cho 18S rRNA với kích thƣớc khoảng
1900 nucleotit là phù hợp cho việc phân loại và không gây khó khăn trong
nghiên cứu.

Vùng đệm 18S – 5,8S có thể thay đổi đƣợc kích thƣớc và trình tự ngay
ở cả những nhóm phân loại có quan hệ họ hàng gần nhau. Phần kích thƣớc
này có thể đƣợc sử dụng để xác định tập đoàn và trình tự khác biệt rộng cho
phép khám phá ra những đơn vị giống nhƣ loài rất chính xác bằng PCR, lai
v.v. Giữa các đơn vị gene có các đoạn ITS – 2 và ITS – 2. Ở đầu 5’ của phân
tử rRNA đƣợc phiên mã có một ETS. Nói chung, các đơn vị gene bảo thủ hơn
các đoạn ITS, các ITS lại bảo thủ hơn đoạn ETS.

Gene mã hóa cho cấu trúc 18S rRNA của sinh vật nhân thật đã đƣợc
nghiên cứu kỹ cùng với nhiều cặp mồi đặc hiệu để nhân đ oạn gene này lên
bằng kỹ thuật PCR. Nấm sợi là sinh vật nhân thật, hiện nay đã có nhiều tác
giả sử dụng phƣơng pháp phân loại dựa vào gene mã hóa 18S rRNA để phân
loại nấm nói chung và nấm sợi nói riêng [30].




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
42
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




PHẦN II VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU
1 VẬT LIỆU

1.1 Nguyên liệu

Ba chủng nấm sợi đƣợc phân lập tử đất ô nhiễm hôn h ợp DDT, DDD,
̃
DDE, Hexachlorocyclorohexane (HCH), Heptachlor, Aldrin, Diendrin,
Endrin ở nồng độ cao của Nam Đàn, Nghệ An. Các chủng nấm này đƣợc đặt
tên lần lƣợt là FNA1, FNA2, FNA3. Đây là 3 chủng nấm sợi trong bộ giống
của phòng Công nghệ Sinh học Môi trƣờng – Viện Công nghệ Sinh học Việt
Nam.

1.2 Hóa chất

Hóa chất sử dụng để nghiên cứu là các hóa chất tinh khiết, đảm bảo chất
lƣợng nhƣ ABTS, Guiaiacol, DDT, 2,4,5-T v.v. đƣợc nhập ngoại từ các hãng
hóa chất có uy tín Sigma, Merk v.v. Trong quá trình phân lo ại chủng có sử
dụng bộ kit cloning của hãng Fermentas. Cặp mồi sử dụng trong phản ứng
PCR là EF4f /Fung5R.

1.3 Thiết bị

Các thiết bị, máy móc đƣợc sử dụng của Viện công nghệ sinh học nói
chung và phòng thí nghiệm trọng điểm Công nghệ Gen nói riêng. Các thiết bị
bao gồ m: Box cấy vô trùng, máy đo quang phổ hấp thụ, kính hiển vi, cân điện
tử, nồi khử trùng ƣớt, nồi khử trùng khô, tủ sấy, máy nuôi lắc ổn nhiệt, tủ nuôi
ổn nhiệt, máy ly tâm, máy chu trình nhiệt, máy xác định trình tự gen tự động
ABI PRISM 3100 Avant Genetic Analyzer, máy điện di DNA (Bio-Rad), tủ
lạnh các loại 4oC,-20oC, -80oC, và các dụng cụ thí nghiệm khác v.v.



Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
43
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




1.4. Môi trƣờng nuôi cấy

Các môi trƣờng cơ bản đƣợc sử dụng trong phân lập, nghiên cứu các
đặc điể m sinh lý của nấm sợi và môi trƣờng nuôi cấy vi khuẩn E.coli sử dụng
trong phân loại đƣợc trình bày ở bảng 2.1.

Bảng 2.1. Các môi trƣờng nuôi cấy cơ bản

Môi trường muối khoáng dịch (g/l) Môi trường muối khoáng thạch (g/l)

Thành phần các loại hoá chất
KNO3 3,0
giống nhƣ môi trƣờng khoáng dịch và
KH2PO4 0,3
MgSO4 0,4 có bổ sung thêm 20g agar.
NaH2PO4 0,4
NaCl 1,0
Nƣớc máy vừa đủ 1 lít
pH 6,5

Môi trường Czapek dịch (g/l) Môi trường Czapek thạch (g/l)

Thành phần các loại hoá chất
Saccharose 30
giống nhƣ môi trƣờng czapek dịch và
NaNO3 2
KH2PO4 1 có bổ sung thêm 20g agar.
KCl 0.5
FeSO4 0.01
NaCl 1
pH 7

Môi trường LB dịch (g/l) Môi trường LB thạch (g/l)

Thành phần các hoá chất tƣơng
NaCl 10
tự môi trƣờng LB dịch nhƣng có bổ
Tryptone 10
Cao men 5,0 sung thêm 15g agar.

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
44
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Nƣớc cất vừa đủ 1 lít
pH 7

Môi trường Czapek nghèo Nước muối sinh lý (0,85%)

Là hỗn hợp môi trƣờng muối NaCl 8,5g
Nƣớc máy vừa đủ 1 lít
khoáng và Czapek theo tỷ lệ 4 : 1
về thể tích.


Môi trƣờng trƣớc khi sử dụng đƣợc khử trùng ở 121oC, 1 atm trong 15
phút. Môi trƣờng muối khoáng và czapek đƣợc bổ sung thêm hỗn hợp vitamin,
hỗn hợp vi lƣợng và nguồn cơ chất là DDT.

Thành phần các loại môi trƣờng sử dụng làm môi trƣờng thay thế nghiên
cứu khả năng sinh laccase đƣợc trình bày trong bảng 2.2.

Bảng 2.2. Môi trƣờng thay thế


Môi trương MEG (g/l)
̀ Môi trường SG (g/l)

( Malt extract glucose) (Soy glucose)

Cao malt 6 Glucose 5
Cao men 4 KH2PO4 1
Glucose 8 MgSO4 0,5
MgSO4 0,5 Fe SO4 0,01
Na2HPO4 0,6 NaCl 1
KH2PO4 0,5 CaCO 3 0,5
CaCO 3 0,5 KCl 0,5
Bột đậu tƣơng
Fe SO4 0,01 10
MnSO4 0,05
CuSO4 0,05

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
45
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Môi trương YS (g/l)
̀ Môi trương PG (g/l)
̀

(Yeast extract-Soluble starch) (Potato glucose)

Nƣơc chiêt khoai tây
́ ́
Cao men 2,0 500
Cao malt 3,0 Glucose 10
Tinh bôt tan
̣ 10 KH2PO4 0,6
NaCl 0,1
MgSO4 0,05



2 PHƢƠNG PHÁP NGHIÊN CỨU

2.1 Nghiên cứu một số đặc điểm sinh học của các chủng nấm sợi
Môi trƣờng Czapek nghèo đƣợc sử dụng để nghiên cứu hình thái của
các chủng nấm đã đƣợc làm sạch. Trong môi trƣờng nuôi cấy có bổ sung
100ppm hỗn hợp DDT, DDD và DDE, nuôi cấy ở 30oC. Sau 5 ngày khi nấ m
phát triển tốt, chúng đƣợc quan sát và chụp ảnh khuẩn lạc trên đĩa thạch. Hình
thái bào tử của các chủng nấm đƣợc quan sát và chụp ảnh dƣới kính hiển vi
quang học (Nikon eclipse 50i, Nhật Bản) với độ phóng đại 40 lần.


2.2 Sàng lọc khả năng sinh Lac, LiP, MnP

Guaiacol (0,01 %) và thuốc nhuộ m màu RBBR (remazol brilliant blue
R, 0,04 %) là 2 chất đƣợc sử dụng làm chất chỉ thị trong các nghiên c ứu sàng
lọc khả năng sinh enzyme ngoại bào Lac, LiP, MnP. Vòng màu nâu đỏ xung
quanh khuẩn lạc đƣợc tạo thành trên môi trƣờng bổ sung guaiacol và khả
năng làm mất màu RBBR là dấu hiệu vi sinh vật có khả năng sinh tổng hợp
các loại enzyme trên [14,52].



Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
46
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




2.3 Nghiên cứu khả năng phân hủy DDT của chủng FNA1

Khả năng phân hủy DDT của chủng FNA1 đƣợc xác định sau 7 ngày
nuôi lắc 180 vòng/phút ở 30oC trên môi trƣờng Czapek nghèo có bổ sung
nồng độ DDT thích hợp căn cứ vào kết quả thí nghiệm khả năng phát triể n
trên các nồng độ DDT khác nhau. Độ tồn lƣu DDT, DDD, DDE sau 7 ngày
nuôi cấy đƣợc tách chiết và phân tích bằng phƣơng pháp sắc ký lỏng cao áp
(HPLC), sử dụng máy GC/ECD 2010 c ủa hãng Shimadzu Nhật Bản.


2.4 Phƣơng pháp xác định hoạt tính enzyme

2.4.1 Xác định hoạt tính laccase

Nguyên tắc: Dựa trên sự oxi hóa ABTS (2,2'-azino-bis 3-
ethylbenzothiazoline-6-sulfonic acid) bởi laccase thành hợp chất đƣợc hấp thụ
ánh sáng mạnh tại bƣớc sóng 420 nm.

Định nghĩa: Một đơn vị hoạt độ laccase là lƣợng enzyme cần thiết để tạo
thành 1 µM sản phẩm từ ABTS trong thời gian 1 phút, ở điều kiện thí nghiệm.

Thành phần phản ứng:

Thành phần Đối chứng (ml) Thí nghiệm (ml)

Đệm acetate
0,8 0,6
(20mM), pH 2

Dịch lên men 0,2 0,2

ABTS (5mM) 0 0,2

Tổng thể tích 1 1


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
47
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Phản ứng xảy ra khi cho ABTS vào hỗn hợp. Giá trị OD đo sau 3 phút.

Công thức tính:

(OD  ODo )  V pu  106  D f
U
VE  t  

Trong đó: U: Hoạt độ enzym (U/l)
ε: Hệ số hấp thụ ánh sáng ở bƣớc sóng 420nm, ε= 36.000 (M-1cm-1)
Vpu: Tổng thể tích phản ứng (1 ml)
VE: Thể tích enzyme (0,2 ml)
ODτ: Giá trị OD đo đƣợc tại thời điể m τ
ODo: Giá trị OD đo đƣợc tại thời điểm τ = 0
Df: Độ pha loãng
t: Thời gian phản ứng

2.4.2 Xác định hoạt tính LiP

Nguyên tắc: Dựa trên sự oxy hóa 2,4-dichlorophenol (2,4-D) của
enzyme tạo thành sản phẩm có độ hấp thụ mạnh tại bƣớc sóng 510 nm.

Định nghĩa: Một đơn vị hoạt độ của LiP là lƣợng enzyme cần thiết để
tạo thành 1 µM sản phẩm từ 2,4-DCP trong thời gian 1 phút, ở điều kiện thí
nghiệm.

Thành phần phản ứng và công thức tính đƣợc miêu tả ở phụ lục 6.


2.4.3 Xác định hoạt tính MnP

Nguyên tắc: Dựa trên sự oxi hóa phenol đỏ của enzyme MnP tạo thành
hợp chất hấp thụ mạnh ở bƣớc sóng 610 nm.

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
48
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Định nghĩa: Một đơn vị hoạt độ MnP là lƣợng enzyme cần thiết để oxy
hóa phenol đỏ tạo thành 1 µM sản phẩm hấp thụ bƣớc sóng 610 nm trong thời
gian 1 phút, ở điều kiện thí nghiệm.

Thành phần phản ứng và công thức tính đƣợc miêu tả tại phụ lục 6.


2.5 Khảo sát các điều kiện môi trƣờng ảnh hƣởng đến khả năng phát
triển và sinh laccase của chủng FNA1

Ảnh hưởng của nhiệt độ, pH môi trường nuôi cấy, nồng độ NaCl

Để nghiên cứu ảnh hƣởng của pH, nhiệt độ, nồng độ muối NaCl lên
khả năng sinh trƣởng và sinh laccase của nấm sợi, môi trƣờng Czapek nghèo
với pH 2-9, nhiệt độ là 28, 30, 37 và 420C, nồng độ NaCl là 0; 0,1; 1; 5; 10%
đã lần lƣợt đƣợc sử dụng. Sau 5 ngày nuôi cấy đánh giá khả năng sinh trƣởng
thông qua quan sát và khối lƣợng khô sinh khối nấm. Mẫu dịch lên men đƣợc
sử dụng để đo hoạt tính enzyme.

Ảnh hưởng của nồng độ DDT và nồng độ glucose

Để nghiên cứu khả năng phát triển của nấm sợi ở các nồng độ DDT
khác nhau, môi trƣờng Czapek chứa DDT với nồng độ 50; 100; 200; 300 ppm
đã đƣợc sử dụng. Ngoài nguồn carbon là DDT còn một điều kiện nữa cũng
ảnh hƣởng rất lớn đến sự phát triển của nấm là nồng độ đƣờng. Thông qua thí
nghiệm này có thể xác định nấ m sợi đƣợc chọn để nghiên cứu chuyển hóa
DDT có theo cơ chế nào, đồng trao đổi chất hay không thuộc dạng này.
Đƣờng glucose đƣợc sử dụng với các nồng độ lần lƣợt là 0; 0,1; 0,5; 1; 2; 3%,
môi trƣờng nuôi cấy có bổ sung 100 ppm DDT.



Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
49
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Ảnh hưởng của các chất cảm ứng

Các chất cảm ứng sinh laccase đƣợc sử dụng là guiaiacol, veratyl
alcohol, CuSO4. Để nghiên cứu khả năng phát triển và sinh laccase trên môi
trƣờng chứa các chất ô nhiễ m khác nhau, các cảm ứng sinh enzyme là các
chất độc khác cũng đƣợc sử dụng nhƣ dịch chiết (dịch chiết từ đất ô nhiễm có
chứa 2,3,7,8 TCDD – phụ lục 7); 2,4-D; 2,4,5-T; PAH ( các đại diện là pyren,
phenanthren, anthracene) với nồng độ 100 ppm.

Ảnh hưởng của chất hoạt động bề mặt

Chất hoạt động bề mặt đƣợc sử dụng là tween 80 với nồng độ 0,2% và
nƣớc chiết bồ kết với nồng độ 0,5% ( từ dịch chiết 20g quả bồ kết trong 100
ml nƣớc cất). Hoạt tính enzyme đƣợc xác định theo từng ngày nuôi cấy.

Ảnh hưởng của nguồn carbon, nitơ và môi trường thay thế

Để nghiên cứu ảnh hƣớng của các nguồn carbon và nitơ khác nhau,
chủng nghiên cứu đƣợc nuôi trong môi trƣờng Czapek nghèo với thành phầ n
carbon trong môi trƣờng (saccharose) đƣợc thay thế bằng glucose, lactose,
tinh bột, cellulose và cao malt, nguồn nitơ NaNO3 và KNO3 đƣợc thay thế
bằng NH4NO3, urê, cao men, cao thịt, bột đậu tƣơng. Môi trƣờng thay thể
đƣợc khảo sát bằng các môi trƣờng MEG (cao malt), YS (cao men), SG (bột
đậu tƣơng) và PG (khoai tây).


2.6 Xác định một số tính chất hóa sinh của laccase thô

Xác định pH tối ưu và độ bền pH

pH thích hợp nhất cho laccase từ chủng tuyển chọn hoạt động đƣợc xác
định theo phƣơng pháp nhƣ miêu tả tại mục 2.3.1 với pH của đệm thay đổi từ

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
50
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




pH 1 đến pH 5.

Để tìm đƣợc pH thích hợp cho việc bảo quản enzyme, dịch enzyme
đƣợc ủ ở nhiệt độ phòng với các pH khác nhau. Hoạt tính enzyme còn lạ i
đƣợc xác định ở nhiệt độ phòng sau 3 giờ ủ.

Xác định nhiệt độ thích hợp cho hoạt động của laccase và độ bền nhiệt

Khoảng nhiệt độ thích hợp nhất cho laccase từ chủng FNA1 hoạt động
đƣợc xác định trong khoảng nhiệt độ từ 30 0C đên 80 0C.
́

Ảnh hƣởng của nhiệt độ đến enzyme đƣợc xác định bằng cách ủ dịch lên
men tại các nhiệt độ 700C, 800C, 900C. Hoạt tính còn lại đƣợc xác định tại nhiệt
độ phòng sau các khoảng thời gian ủ nhất định.


2.7 Phân loại nấm sợi dựa vào xác định và so sánh trình tự gen mã hóa
18S rRNA

2.7.1 Tách DNA tổng số từ nấm sợi

Màng tế bào đƣợc phá bằng lysozym và SDS, DNA tổng số đƣợc giả i
phóng ra. Việc loại bỏ protein khỏi DNA đƣợc thực hiện bởi enzym
proteinaza K. Qui trình các bƣớc thực hiện nhƣ sau:

Bƣớc 1: Nuôi cấy thu sinh khối nấm
Bƣớc 2: Thu sinh khối bằng cách ly tâm 6000 vòng/10 phút ở 4oC. Lặp lại vài
lần để thu đủ mẫu.
Bƣớc 3: Bổ sung môi trƣờng nuôi cấy để rửa sinh khối, ly tâm 2 lần với 6000
vòng/10 phút ở 4oC.
Bƣớc 4: Dùng panh để lấy sinh khối cho vào cối sứ đã khử trùng và nghiề n
trong nitơ lỏng thành bột mịn.

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
51
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Bƣớc 5: Dùng thìa xúc mẫu cho vào các ependoff, bổ sung 600µl đệ m
lyzozym và lắc nhẹ.
Bƣớc 6: Bổ sung tiếp 65µl lysozym, ủ 37oC trong 30-45 phút.
Bƣớc 7: Cho 50µl protenaza K ủ ở 56oC trong 2 giờ.
Bƣớc 8: Bổ sung tiếp chloroform : isoamyalcolhol (tỷ lệ 24 : 1)với tỷ lệ 1 : 1 về
thể tích, trộn đều sau đó ly tâm 12000 vòng/phút trong 15 phút ở 4oC.
Bƣớc 9: Thu phần dịch nổi bên trên cho vào ống Eppendorf mới.
Bƣớc 10: Bổ sung isopropanol với tỷ lệ 1 : 1 về thể tích, ủ ở 4oC qua đêm.
Bƣớc 11: Ly tâm ở vận tốc 12000 vòng/phút trong 15 phút ở 4oC, thu tủa.
Bƣớc 12: Hòa tan kết tủa trong 500 µl TE.
Bƣớc 13: Loại RNA bằng cách thêm RNAse, ủ ở 37oC qua đêm.
Bƣớc 14: Bổ sung chloroform : isomyalcolhol (t ỷ lệ 24 : 1) với tỷ lệ 1 : 1 về
thể tích sau đó đảo nhẹ và ly tâm ở vận tốc 12000 vòng/phút, 15 phút
ở 4oC.
Bƣớc 15: Thu phần dịch nổi phía trên.
Bƣớc 16: Bổ sung ethanol 100% (giữ lạnh) tỷ lệ 1 : 1 về thể tích.
Bƣớc 17: Ly tâm ở vận tốc 12000 vòng/phút trong 15 phút ở 4oC, thu kết tủa
sau đó rửa sạch bằng ethanol 80%. Làm khô DNA.
Bƣớc 18: Hòa trong 100µl TE và bảo quản ở 4oC.

2.7.2 Nhân đoạn gen bằng kỹ thuật PCR

Kỹ thuật PCR do Mullis và cộng sự phát minh năm 1985. Từ đó đến

nay kỹ thuật này đƣợc sử dụng rất phổ biến trong công nghệ sinh học và đóng

góp to lớn cho những tiến bộ về sinh học phân tử. Cặp mồi đƣợc sử dụng

trong nghiên cứu này là EF4f/Fung5R đƣợc thiết kế dựa vào trình tự có tính

bảo thủ cao của gen 18S ở sinh vật eukaryot.
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
52
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Mồi xuôi EF4f: 5’ – GGAAGGG(G/A)TGTATTTATTAG – 3’

Mồi ngƣợc Fung5R: 5’ – GTAAAGTCCTGGTTCCC – 3’

Thành phần phản ứng (l):

Đệm PCR 2
MgCl2 (25mM) 3
dNTP 2.5
EF4f (20pmol) 1
Fung5r (20pmol) 1
Taq-polymeraza (5 unit/l) 0.5
H2O 12.5
DNA 2
Tổng thể tích 25

Chu trình nhiệt:

Bƣớc 1: 95oC (5 phút)

Bƣớc 2: 94oC (1 phút)

Bƣớc 3: 48oC (1 phút)

Bƣớc 4: 72oC (3 phút)

Bƣớc 5: Lặp lại 35 lần từ bƣớc 2 đến bƣớc 4

Bƣớc 6: 72oC (10 phút)

Bƣớc 7: Bảo quản ở 4oC




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
53
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




2.7.3 Gắn sản phẩm PCR vào vectơ và biến nạp vào E.coli

Thứ tự các bƣớc đƣợc tiến hành theo Kit InsTAcloneTMPCR cloning
(mã số #K1214 của hãng Fermentas. Sau khi biến nạp cấy chuyển các khuẩn
lạc ra môi trƣờng LB thạch có bổ sung các chất chỉ thị (kháng sinh, X-gal) để
chọn lọc các dòng tế bào mang vector tái tổ hợp mong muốn. Các dòng tế bào
chọn lọc đƣợc nuôi trên LB dịch để tách DNA plasmit.

Thành phần phản ứng tạo vector tái tổ hợp:

3l
Vector pTZ57R/T
6l
Buffer 5X ligation
3l
Sản phẩ m PCR
1l
T4 DNA ligaza
17l
Nƣớc cất
30l
Tổng thể tích

Ủ hỗn hợp ở 22oC trong thời gian 1giờ.

Quy trình biến nạp vào E.coli:

Quy trình biến nạp đƣợc thực hiện theo quy trình và hóa chất đƣợc
miêu tả tại phụ lục 8.


2.7.4 Tách chiết DNA plasmid

Tách chiết DNA plasmit theo phƣơng pháp cuả Sam Brook và Russell [51].

Bƣớc 1: Thu sinh khối tế bào bằng cách ly tâm 6000 vòng/phút, 10 phút ở
4oC.
Bƣớc 2: Bổ sung 500l STE, lắc nhẹ và nhanh. Sau đó ly tâm 6000 vòng/phút
(ở 4oC) để thu cặn tế bào.
Bƣớc 3: Bổ sung 200l Sol I và lắc kỹ.
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
54
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Bƣớc 4: Bổ sung 400l Sol II, lắc đảo ngƣợc 5 lần rồi ủ trong đá 5 phút.
Bƣớc 5: Bổ sung 300l Sol III, để lạnh, lắc mạnh rồi ủ trong đá 20 phút.
Bƣớc 6: Ly tâm 12000 vòng/ phút trong 10 phút ở 4oC, hút 600l pha trên.
Bƣớc 7: Bổ sung 600l chloroform : isoamyalcolhol (tỷ lệ 24 : 1), lắc kỹ, ly
tâm 12000 vòng/ phút trong 6 phút ở 4oC để thu lấy pha trên.
Bƣớc 8: Bổ sung 560l isopropanol, giữ ở nhiệt độ phòng trong 2 giờ.
Bƣớc 9: Ly tâm 12000 vòng/phút trong 10 phút ở 4oC, thu tủa, rửa tủa bằng
ethanol 70% rồi thu tủa lại bằng cách ly tâm 6000 vòng/p hút trong 7
phút ở 4oC.
Bƣớc 10: Làm khô tủa bằng máy hút chân không, hoà tan trong nƣớc cất 2 lần
khử ion rồi giữ ở -20oC để dùng cho các thí nghiệ m sau.


2.7.5 Kiểm tra plasmit mang sản phẩm PCR mong muốn

Để kiểm tra plasmit có mang sản phẩ m PCR đúng kích thƣớc hay
không, có thể tiến hành cắt bằng enzym giới hạn BamHI và EcoRI hoặc tiến
hành PCR kiể m tra với cặp mồi đã nêu. Ở đây tiến hành chạy PCR để kiể m
tra với thành phần phản ứng và chu trình nhiệt nhƣ đƣợc trình bày ở trên. Sau
khi PCR, điện di kiể m tra trên gel agarose 1%, nếu thu đựợc băng có kích
thƣớc khoảng 550bp thì có thể kết luận plasmit tách đƣợc có thể mang sản
phẩ m PCR mong muốn. Sau các bƣớc kiểm tra, DNA plasmit đƣợc tách sạch
dùng để xác định trình tự.




2.7.6 Điện di kiểm tra DNA tổng số



Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
55
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Điện di kiểm tra sử dụng gel agarose có nồng độ 1%, nhuộ m bằng
Ethidium bromide và sau đó soi DNA dƣới ánh sáng tử ngoại.


2.6.7 Xác định trình tự đoạn gene mã hóa 16S rRNA

Xác định trình tự gene mã hóa 16S rRNA của vi khuẩn, theo phƣơng
pháp của Sanger, sử dụng máy đọc trình tự tự động ABI PRISM 3100 Avant
Data Collection v1.0 và Sequencing Analysis.


2.6.8 Xây dựng cây phát sinh chủng loại

Sau khi đã có kết quả xác định trình tự đoạn gen 18S rRNA, tiến hành
so sánh trình tự với các trình tự tƣơng ứng đã có trên GenBank. Tiếp đó dùng
phần mề m tin sinh học Clustalx để xây dựng cây phát sinh chủng loại.




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
56
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




PHẦN 3 KẾT QUẢ VÀ THẢO LUẬN


2 Một số đặc điểm hình thái khuẩn lạc và cuống sinh bào tử của
các chủng FNA1, FNA2, FNA3

Ba chủng nấm sợi FNA1, FNA2 và FNA3 phân lập từ đất ô nhiễ m hỗ n
hợp thuốc trừ sâu đã đƣợc tuyển chọn. Sau 5 ngày nuôi cấy trên môi trƣờng
Czapek nghèo có b ổ sung DDT hình thái khuẩn lạc của 3 chủng nấ m đƣợc
quan sát và mô tả ở hình 1. Chủng FNA1 có khuẩn lạc mọc lan rộng, đƣờng
kính 2 cm, khuẩn ty khí sinh màu xanh lá mạ viền ngoài màu xanh trắng,
bông xốp. Khuẩn lạc chủng FNA 2 tròn, đƣờng kính 1,2 cm, bề mặt khuẩn ty
khí sinh chắc, có múi, màu xanh rêu đậm, viền ngoài trắng, tâm có giọt tiết
màu đen. Chủng FNA3 có khuẩn lạc tròn, rộng 1,5 cm, viền ngoài khẩn ty khí
sinh có màu trắng hơi khứa, trong màu nâu, sinh giọt tiết màu nâu đậ m.
Khuẩn ty cơ chất của cả 3 chủng trên đều màu trắng.

Cuống sinh bào tử và bào tử của 3 chủng FNA 1, FNA2, FNA3 có dạng
gân giô ng nhau . Cuông sinh bao tƣ trân , không phân nhanh . Đầu sinh bào tử
̀ ́ ́ ̀ ̉̀ ́
trân dang tia . Bào tử xếp thành chuỗi đính với thể bình
̀ ̣ . Chủng FNA 1 và
FNA2 có hai tầng thể bình , FNA3 có một tầng thể bình . Bào tử có hình tròn
đến eli p, bào tử non nhẵn , bào tử già gai ráp (Hình 3.1). Với các đặc điểm về
hình thái khuẩn lạc và bào tử nhƣ trên có thể xếp 3 chủng nấm sợi này vào chi
Aspergillus. Do chủng FNA1 phát triển nhanh nhất, tạo sinh khối lớn nên đã
đƣợc chọn để tiến hành các nghiên cứu tiếp theo.




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
57
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Tên
FNA1 FNA2 FNA3
chủng




Hình
thái
khuẩn
lạc




Hình
thái
cuống
sinh
bào tử




Hình 3.1 Hình thái khuẩn lạc và cuống sinh bào tử chủng FNA1, FNA2, FNA3


2 SÀNG LỌC KHẢ NĂNG SINH TỔNG HỢP Lac, LiP, MnP

Guaiacol (0,01 %) và thuốc nhuộm màu RBBR (0,04 %) là 2 chất đƣợc
sử dụng làm chất chỉ thị sàng lọc. Kết quả đƣợc thể hiện tại hình 3.2 cho thấy
chủng FNA1 có khả năng sinh enzyme mạnh nhất, chủng FNA2 sinh enzyme
yếu nhất trong 3 chủng nghiên cứu. Để khẳng định điều này dịch nuôi cấy của
3 chủng này sau 6 ngày đã đƣợc sử dụng để xác định hoạt tính enzyme.
Chủng FNA1 không phát hiện thấy LiP nhƣng có khả năng sinh Lac và MnP
cao nhất, lần lƣợt là 5,41 và 26,9 (U/l). Hai chủng FNA2 và FNA3 phát hiệ n
thấy sự có mặt của cả ba loại enzyme trên nhƣng hoạt tính yếu hơn FNA1
(Bảng 3.1). Kết hợp khả năng phát triển và sinh enzyme chủng FNA1 đƣợc
lựa chọn để tiến hành các nghiên cứu tiếp theo.


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
58
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Tên
FNA1 FNA2 FNA3
chủng




Guaiacol




RBBR




+++ + ++
Ghi chú


Hình 3.2 Khả năng sinh enzyme từ 3 chủng chọn lọc

+++ : Tốt; +: Yếu
++: Trung bình;




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
59
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Bảng 3.1 Hoạt tính Lac, LiP, MnP của 3 chủng FNA1, FNA2, FNA3


Tên chủng Chỉ thị Lac (U/l) LiP (U/l) MnP (U/l)

RBBR 5,41 - 26,9
FNA1
Guaiacol 3,74 - -

RBBR 2,3 4,15 6,05
FNA2
Guaiacol 2,9 - -

RBBR 3,3 2,07 -
FNA3
Guaiacol 2,9 - 13,4




3 KHẢ NĂNG PHÂN HỦY DDT CỦA CHỦNG FNA1

Sau khi xác định đƣợc ở nồng độ DDT là 200 ppm chủng FNA1 phát
triển tốt nhất thông qua nghiên c ứu ảnh hƣởng của nồng độ DDT đến khả
năng sinh trƣởng của FNA1 (trình bày tại mục 4.2.1). Đánh giá khả năng phân
hủy DDT đã đƣợc tiến hành bằng phƣơng pháp sắc ký lỏng cao áp để xác
định độ tồn lƣu của DDT và các đồng phân của nó. Sau 7 ngày nuôi cấy, mẫ u
không có vi sinh vật và có FNA1 đã đƣợc so sánh, kết quả phân tích đƣợc thể
hiện trên sắc ký đồ ở hình 3.3 (A, B). Khả năng phân hủy DDE, DDD và
DDT của chủng FNA1 đạt rất cao, các chất trên đƣợc loại bỏ lần lƣợt là 92,69
%, 97,19 % và 97,23 % (Bảng 3.2).




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
60
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 3.3 Phổ sắc ký đồ

A: Mẫu nuôi cấy không có vi sinh vật
B: Mẫu nuôi cấy có vi sinh vật




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
61
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Bảng 3.2 Khả năng phân hủy DDT, DDE, DDD bởi chủng FNA1


Lƣợng thu hồi Lƣợng bị loại bỏ
Chất ô
Không có FNA1
nhiễm (ppm) (%)
VSV (ppm) (ppm)

4,271 0,312 3,959 92,69
DDE

10,238 0,287 9,951 97,19
DDD

162,8 4,5 158,3 97.23
DDT



Đã có nhiều công bố về khả năng phân hủy sinh học DDT của vi sinh
vật. Các nhóm vi sinh vật tiềm năng cho quá trình phân hủy DDT phục vụ cho
xây dựng qui trình công nghệ khử độc đất nhiễ m hỗn hợp DDT, HCH và các
chất ô nhiễm hữu cơ chứa clo khác đƣợc quan tâm là nấm, xạ khuẩn và vi
khuẩn. Theo các nghiên cứu thì có tới hơn 300 chủng vi sinh vật có khả năng
phân hủy DDT và các dẫn suất, một số vi sinh vật chuyển hoá DDT đã đƣợc
công bố bao gồm Escheria coli, Enterobacter aerogenes, Enterobacter
cloacae, Klebsiella pneumoniae, Pseudomonas aeruginosa, Pseudomonas
putida, Bacillus sp. v.v. và một số nấm nhƣ Saccharomyces cerevisiae,
Phanerochaete chrysosporium, Trichoderma [29]. Quá trình chuyển hoá DDT
của các vi sinh vật đã đƣợc nghiên cứu phần lớn đều theo cơ chế đồng trao
đổi chất. Cũng có thể chủng FNA1 đƣợc phân lập từ đất ô nhiễm DDT và các
thuốc trừ sâu khác cũng phân hủy DDT theo cơ chế đồng trao đổi chất. Các
nghiên cứu trƣớc đã sử dụng môi trƣờng muối khoáng chứa DDT nhƣng
chủng FNA1 không phát triển, chủng này chỉ phát triển trên môi trƣờng có bổ
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
62
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




sung saccharose. Tuy nhiên cần rất nhiều nghiên cứu tiếp theo để làm sáng tỏ
cơ chế chuyển hóa DDE, DDD, DDT c ủa chủng nấ m sợi này.

Khả năng phân hủy hỗn hợp DDT của nấm FNA1 cao hơn hằn so với
khả năng phân hủy của vi khuẩn đƣợc phân lập từ cùng mẫu nghiên cứu là
BNA71 và BNA73 [6]. Hai chủng này phân hủy lần lƣợt là 12,53 % và 19,66
% DDT tổng sau 14 ngày nuôi cấy, trong khi chủng FNA1 phân hủy đƣợc
94,41 % sau 7 ngày. Điều này hoàn toàn phù hợp với các nghiên cứu trong và
ngoài nƣớc cho thấy khả năng phân hủy DDT của nấm tốt hơn hẳn vi khuẩn
và xạ khuẩn. Aislabie và cộng sự đã sử dụng chủng xạ khuẩn Terrabacter sp.
DDE-1 để nghiên cứu khả năng phân huỷ sinh học của nó. Nồng độ DDE đã
giả m từ 0,1 mg/ml xuống con 0,062 mg/ml (48 %) sau 10 ngày nuôi cấ y
̀
Terrabacter sp. DDE-1 [10]. Johnson va Kennedy đa xác đ ịnh hiêu qua phân
̀ ̃ ̣ ̉
hủy DDT của Ae robacter aerogenes và Bacillus subtilis lân lƣơt la 45 % và
̀ ̣̀
30 % sau 24h vơi nông đô ban đâu la 5µg/ml [31].
́ ̀ ̣ ̀̀

Bumpus và Aust đã sử dụng nấm đảm loai P. chrysosporium nghiên
̀
cứu xử lý DDT trong môi trƣờng thiếu nitơ, sau 30 ngày nuôi cấy, khoảng 50
% DDT đã đƣợc chuyển hoá trong đó có 10 % đã đƣợc khoáng hoá hoàn toàn
và thấy xuất hiện các sản phẩm của quá trình trao đổi chất nhƣ dicofol, FW-
14
152 và DBP [15]. Fernando (1989) kiể m tra khả năng phân huỷ C-DDT
trong hỗn hợp đất và lõi ngô bởi nấm P. chrysosporiumi cho thấy sau 60 ngày
14 14
C chuyển sang dạng C-CO2, 5 % sang dạng hoà tan trong nƣớc và
10%
18% ở dạng không thể tách chiết. Con đƣờng chuyển hóa DDT của vi khuẩ n
E. Aerogenes đƣợc công bố bởi Wedemeyer năm 1976 cũng tạo ra sản phẩm
trung gian là DDD và DDE [41]. Từ kết quả phân tích DDD và DDE cho
thấy hàm lƣợng DDD và DDE của mẫu có bổ sung chủng FNA1 thấp hơn
nhiều của mẫu đối chứng. Số liệu này chứng tỏ chủng FNA1 có khả năng
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
63
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




phân hủy cả DDT, DDD và DDE. So sánh khả năng chuyển hóa DDT và các
dẫn xuất với con đƣờng chuyển hóa bởi hai chủng P. Chrysosporium, E.
Aerogenes, chúng tôi nhận thấy kiểu phân hủy sinh học DDT của chủng
FNA1 khá giống với các chủng nêu trên.

Nhƣ vậy chủng FNA1 có khả năng phát triển tốt và phân hủy DDT ở
nồng độ rất cao trong thời gian ngắn. Còn rất nhiều chủng vi khuẩn và nấ m
khác đã đƣợc phát hiện có khả năng phân hủy DDT rất tốt với nồng độ rất
thấp từ 0,1 – 2 ppm nhƣ loài Rhodotorula gracilis, Torulopsis utilis phân hủy
lần lƣợt 97 %, 94 % DDT với nồng độ ban đầu là 2ppm, còn loài Blepharisma
intermedium phân hủy 90 % DDT với nồng độ ban đầu là 1ppm. Bidlan và
Manonmani đã chứng minh chủng Serratia marcescens DT-1P làm giảm 50%
DDT sau 48 giờ với nồng độ ban đầu là 5ppm. Kanoknit phân lập đƣợc 167
chủng từ tỉnh Songkhla, Thái Lan có khả năng phát triển trên môi trƣờng có
chứa 25ppm DDT. Chỉ có năm chủng sinh trƣởng và phát triển và tạo vòng
phân hủy ở nồng độ 100ppm DDT, sau 10 ngày nuôi cấy năm chủng này có
khả năng phân loại bỏ từ 20,3 % đến 37,4 % DDT với nồng độ ban đầu là 25
ppm. Chúng mình trên cho thấy khả năng phân hủy DDT của chủng FNA1
cao hơn hẳn nhiều chủng đã đƣợc công bố [62].

Theo các khảo sát bƣớc đầu cho thấy chủng FNA1 sinh enzyme ngoại
bào trên môi trƣờng chọn lọc đặc hiệu với chất cảm ứng là 100 ppm DDT.
Đây có thể là một trong các lý do tại sao loài nấ m sợi này phân hủy chuyển
hóa DDE, DDD, DDT rất tốt so với các chủng vi sinh vật khác. Để tìm hiể u
và ứng dụng chủng FNA1 nhƣ là một ứng cử viên cho phƣơng pháp tăng
cƣờng sinh học xử lý đất nhiễm nặng hỗn hợp thuốc trừ sâu và côn trùng cần
rất nhiều nghiên cứu sâu sắc hơn. Theo các kết quả thu đƣợc từ rất nhiề u
phòng thí nghiệm trên thế giới thì enzyme ngoại bào do nấ m đảm và mới nhất
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
64
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




hiện nay enzyme do nấm sợi sinh tổng hợp đang mở ra triển vọng rất to lớn để
xử lý loại bỏ các chất ô nhiễm hứu cơ khó phân hủy (POPs) trong đó có DDT
và các dẫn xuất của nó [26].


4 CÁC ĐIỀU KIỆN MÔI TRƢỜNG ẢNH HƢỞNG ĐẾN KHẢ NĂNG
SINH TRƢỞNG VÀ SINH TỔNG HỢP LACCASE CỦA FNA1

4.1 Ảnh hưởng của nhiệt độ, pH môi trường nuôi cấy, nồng độ NaCl

4.1.1 Ảnh hưởng của nhiệt độ

Nấm đƣợc nuôi ở các nhiệt độ khác nhau, kết quả đƣợc đánh giá sau 5
ngày nuôi cấy. Khả năng phát triển của FNA1 đƣợc đánh giá thông qua s ự
khác biệt về sinh khối và đặc biệt là màu sắc giữa các nhiệt độ nuôi. Kết quả
đƣợc thể hiện trong hình 3.4, ở khoảng nhiệt độ 30 oC đến 37 oC chủng FNA1
phát triền sinh khối mạnh nhất, ở 37 oC có sự đổi màu môi trƣờng nuôi cấ y
sang màu vàng nhạt, chứng tỏ chủng này phát triển mạnh nhất ở khoảng 37
o
C. Điều này hoàn toàn phù hợp với đặc điể m nguồn mẫu đƣợc phân lập từ
bioreactor hiếu khí.




28 oC 30 oC 37 oC 42oC

Hình 3.4 Ảnh hƣởng của nhiệt độ lên sinh trƣởng của chủng FNA1

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
65
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 3.5 Ảnh hƣởng của nhiệt độ lên khả năng sinh laccase của chủng FNA1


Dịch lên men sau 5 ngày đƣợc sử dụng để xác định hoạt tính laccase,
kết quả thể hiện trong hình 3.5. Chủng FNA1 sinh laccase cao nhất trong
khoảng nhiệt độ 30-37 oC, cao nhất là 12,2 U/l. Khả năng này giảm hẳn khi
nhiệt độ tăng cao hơn, ở 40oC hoạt tính enzyme chỉ còn 1,3 U/l.

4.1.2 Ảnh hưởng của pH môi trường nuôi cấy

Sự đánh giá ảnh hƣởng của pH lên s ự phát triển và sinh laccase c ủa
chủng FNA1 ở các pH 1 – 9 đã đƣợc tiến hành. Kết quả đƣợc đánh giá sau 5
ngày nuôi cấy cho thấy FNA1 có khả năng phát triển trong dải pH rộng, từ
môi trƣờng có pH rất thấp ( pH 2), đến môi trƣờng có pH cao ( pH 9) và tốt
nhất trong khoảng pH 4 – 6 ( Hình 3.6), kết quả này phù hợp với đặc điể m
nguồn mẫu chủng đƣợc phân lập là đất ô nhiễ m có pH khá thấp. Một số vi
sinh vật cũng phát triển trên môi trƣờng có các chất độc hóa học khác cũng
phát triển trong khoảng pH hơi axit nhƣ chủng Aspergillus sp.FDN20 ở pH 6,
chủng Aspergillus terreus FDN41 ở pH 6,5 [3].



Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
66
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




pH môi trƣờng là một trong các yếu tố quan trọng không những ảnh
hƣởng đến sự phát triển mà còn ảnh hƣởng lớn đến khả năng sinh enzyme
ngoại bào của vi sinh vật. Với chủng FNA1 pH môi trƣờng ban đầu tốt nhất
cho sinh laccase là pH 5 ( 111,11 U/l), mặc dù phát triển tốt trong khoảng pH
4-6 nhƣng tại pH 4 hoạt tính enzyme rất thấp, chỉ đạt 2,9 % so với hoạt tính
enzyme tại pH 5. Khi pH môi trƣờng tăng dần hoạt tính laccase giả m dần, tại
pH 6 giảm nhẹ còn 90%, đến pH 7 giảm mạnh xuống còn 3,1 % ( Hình 3.7).




pH 1 2 3 4 5 6 7 8 9

Hình 3.6 Ảnh hƣởng của pH lên khả năng sinh trƣởng của chủng FNA1




Hình 3.7 Ảnh hƣởng của pH lên khả năng sinh laccase của chủng FNA1



Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
67
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




4.1.3 Ảnh hưởng của nồng độ NaCl

Chủng nấm sợi FNA1 phát triển đƣợc đƣợc ở các nồng độ NaCl từ 0
đến 10%, phát triển tốt nhất ở nồng độ 0,1 % NaCl, đây cũng là nồng độ mà
laccase đƣợc sinh tổng hợp mạnh nhất đạt 10,41 U/l sau 5 ngày nuôi cấy. Từ
5 % NaCl trở lên khả năng phát triển rất yếu và hoạt tính enzyme giảm rõ rệt,
ở nồng độ NaCl 10 % lƣợng enzyme hầu nhƣ đƣợc sinh tổng hợp ( Hình 3.8,
3.9). Chủng Aspergillus sp. FDN20 cũng có khả năng phát triển ở khoảng
nồng độ NaCl khá rộng từ 0,1 đến 10 %, chủng Aspergillus terreus FDN41 lạ i
phát triển trong khoảng hẹp hơn từ 0 đến 5 %. Tuy nhiên nồng độ thích hợp
nhất cho các chủng sinh trƣởng và phát triển lại rất khác nhau, chủng FNA1
khoảng 0,1 %, chủng Aspergillus sp. FDN20 cần lƣợng muối khá cao khoảng
3% [3].




Hình 3.8 Ảnh hƣởng của nồng độ NaCl lên sự sinh trƣởng của chủng FNA1


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
68
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 3.9 Ảnh hƣởng của nồng độ NaCl lên khả năng sinh laccase của chủng FNA1



4.2 Ảnh hưởng của nồng độ DDT và nồng độ glucose

4.2.1 Ảnh hưởng của nồng độ DDT

Mỗi chủng vi sinh vật đều có giới hạn nhất định đối với các điều kiện
môi trƣờng, trong đó điều kiện quan trọng ảnh hƣởng đến khả năng sử dụng
chủng nghiên cứu vào thực tế xử lý khử độc ngoài hiện trƣờng là giới hạ n
nồng độ các chất ô nhiễ m mà tại đó vi sinh vật có thể phát triển. Để tìm hiể u
vấn đề này cũng nhƣ lựa chọn môi trƣờng nuôi cấy với nồng độ DDT thích
hợp môi trƣờng Czapek nghèo vẫn tiếp tục đƣợc sử dụng và các nồng độ
DDT khác nhau đƣợc bổ sung vào bình nuôi cấy. Sinh khối nấ m đƣợc sấy khô
đến khối lƣợng không đổi và cân bằng cân phân tích sau 7 ngày nuôi cấy. Kết
quả cho thấy ở các nồng độ lần lƣợt là 50, 100, 200, 300 ppm chủng FNA1
đều sinh trƣởng tốt, sự chênh lệch khối lƣợng khô và hoạt tính laccase không


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
69
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




nhiều, dao động trong khoảng 6 - 7 U/l. Tuy nhiên ở nồng độ 200 ppm DDT
chủng FNA1 phát triển tốt hơn ( Hình 3.10).




50 ppm 100 ppm 200 ppm 300 ppm


Hình 3.10 Ảnh hƣởng của nồng độ DDT lên khả năng sinh trƣởng của FNA1



4.2.2 Ảnh hưởng của nồng độ glucose

Để tìm hiểu chủng FNA1 chuyển hóa chất độc theo cơ chế nào, đồng
trao đổi chất hay sử dụng DDT làm nguồn carbon và năng lƣợng duy nhất,
glucose đã đƣợc sử dụng để thực hiện nghiên cứu này. Sau 5 ngày nuôi cấy
FNA1 trên môi trƣờng muối khoáng chứa 200 ppm DDT và glucose ở các
nồng độ khác nhau kết quả đƣợc trình bày trong hình 23. Ở nồng độ glucose 0

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
70
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




% chủng FNA1 hoàn toàn không phát tri ển, 0,1 % phát triển yếu, nồng độ
glucose càng cao thì FNA1 phát triển càng mạnh và màu môi trƣờng thay đổi
càng rõ rệt dần chuyển sang mầu nâu đỏ (Hình 3.11). Kết quả này chứng tỏ
chủng FNA1 phân hủy DDT theo cơ chế đồng trao đổi chất, sử dụng cả 2
nguồn carbon là đƣờng và chất độc DDT, đây là cơ chế phổ biến ở các vi sinh
vật phân hủy chất độc. Trong khi đó chủng nấm Aspergillus sp.FNA33 đƣợc
phân lập từ cùng vùng ô nhiễm có thể phát triển trên môi trƣờng muối khoáng
không bổ sung glucose hay nguồn carbon khác ngoài chất độc là HCH.

Dịch nuôi cấy sau 5 ngày đƣợc sử dụng để xác định hoạt tính laccase,
kết quả trình bày tại hình 3.12. Hoạt tính đạt cao nhất là 7,47 U/l ở 0,1 %
glucose và giảm dần khi nồng độ glucose tăng. Trong dải nồng độ khảo sát thì
chủng FNA1 phát triển tốt nhất ở nồng độ 3% glucose nhƣng tại đây không
phát hiện đƣợc laccase (Hình 3.12). Để giải thích và chứng mình đặc điể m
này cần nhiều nghiên cứu khác nhƣ động thái sinh tổng hợp laccase ở các
nồng độ glucose khác nhau và cơ chế trao đổi chất .v.v nhƣng do thời gian và
điều kiện không cho phép nên thí nghiệm dừng ở bƣớc đầu khảo sát nhƣ trên.




Glucose 0 0.1 0.5 1 2 3
(%)
Hình 3.11 Ảnh hƣởng của nồng độ glucose lên khả năng sinh trƣởng của FNA1




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
71
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 3.12 Ảnh hƣởng của nồng độ glucose lên khả năng sinh laccase của FNA1



4.3 Ảnh hưởng của các chất cảm ứng

4.3.1 Guaiacol, veratyl alcohol, CuSO4

Khả năng sinh laccase bởi nấm sợi ngoài sự phụ thuộc vào các yếu tố
nhƣ nhiệt độ, pH, thành phân môi trƣờng, thơi gian nuôi c ấy .v.v còn phụ
̀
thuộc rất nhiều vào sự có mặt và nồng độ các chất cảm ứng nhƣ Cu2+, veratryl
alcohol (VA), gallic acid, guaiacol, catechol, hydroxybenzoic acid, vanillin
.v.v [43]. Ba loại chất cảm ứng là guaiacol (0,01 %), CuSO4 (1 mM) và VA (1
%) đã đƣợc lựa chọn để khảo sát ảnh hƣởng của chúng lên khả năng sinh tổng
hợp laccase. Vẫn sử dụng môi trƣờng Czapek nghèo và d ịch nuôi cấy sau 5
ngày để xác định hoạt tính enzyme. Kết quả cho thấy môi trƣờng có bổ sung
thêm chất cảm ứng hoạt tính laccase tăng không đáng kể so với môi trƣờng
không bổ sung, môi trƣờng có chƣa CuSO4 đạt cao nhất là 11,04 U/l (Hình

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
72
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




3.13). Các chất cảm ứng này có thể không phải là chất cảm ứng sinh laccase
phù hợp với chủng nấ m sợi FNA1, với mỗi chủng giống khác nhau thì chất
cảm ứng thích hợp và nồng độ tối ƣu của chất đó là không giống nhau, nhƣ
Trichoderma harzianum WL1 hoạt tính laccase đạt tới 4,36 U/ml sau 4 ngày
khi có bổ sung 1mM CuSO4, hoạt tính laccase của Trametes sp. AH28-2 đạt
cao nhất với cảm ứng O-toluidine 1 mM sau 72 giờ là 504 U/l trong khi với
cảm ứng guaiacol 1 mM chỉ đạt 287 U/l [49,61].




Hình 3.13 Ảnh hƣởng của chất cảm ứng đến khả năng sinh laccase của FNA1



4.3.2 Các chất ô nhiễm khác

Để tìm hiểu khả năng phát triển của chủng FNA1 trên các môi trƣờng
có mặt các chất ô nhiễm khó phân hủy khác ngoài DDT nhƣ 2,4-D, 2,4,5-T, 3
đại diện của PAH và đặc biệt là dịch chiết đất chứa 2,3,7,8-TCDD đã đƣợc sử
dụng để đánh giá. Kết quả sau 5 ngày nuôi cấy đƣợc trình bày ở hình 3.14 và
3.15. Trên tất cả các bình thí nghiệ m chủng FNA1 đều sinh trƣởng phát triển
tốt, điều này chứng tỏ ngoài khả năng phát triển trên môi trƣờng chứa nguồn
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
73
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




carbon là DDT chủng nấm sợi này còn có thể sinh trƣởng đƣợc trong môi
trƣờng chứa các chất ô nhiễ m khác. Chủng FNA1 có s ử dụng các chất ô
nhiễ m này làm nguồn carbon hay không c ần tiếp tục nghiên cứu nhƣng bƣớc
đầu đã mở ra khả năng ứng dụng của chủng FNA1 trong xử lý các vùng ô
nhiễ m khác không chỉ riêng vùng ô nhiễm DDT.

Cơ chất thƣờng đóng vai trò là chất cảm ứng cho quá trình sinh tổng
hợp một loại enzyme tƣơng ứng nào đó. Khi bổ sung cơ chất vào môi trƣờng
nuôi cấy có sự tác động đến khả năng sinh enzyme ngoại bào của FNA1,
trong môi trƣờng có chứa 2,4-D, 2,4,5-T, 3 đại diện của PAH và dịch chiết
hoàn toàn không phát hiện thấy sự có mặt của laccase, chỉ trong môi trƣờng
chứa DDT là có sự sinh tổng hợp laccase. Đây là đặc tính khá đặc hiệu, chủng
nấm sợi này chỉ tạo laccase khi có mặt của DDT và DDT chính là chất cả m
ứng để chủng nấ m này sinh tổng hợp laccase.




pyren anthracene ph enanthren dịch chiết
2,4-D 2,4,5-T DDT


Hình 3.14 Ảnh hƣởng của các chất độc khác nhau lên sự sinh trƣởng của FNA1




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
74
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 3.15 Khối lƣợng khô sinh khối trên các nguồn chất ô nhiễm khác nhau



4.4 Ảnh hưởng của chất hoạt động bề mặt

Đối với đất bị nhiễ m độc, đặc biệt là ô nhiễm DDT các chất hoạt động
bề mặt đóng vai trò quan trọng nhƣ giảm độc tố do các chất độc gây lên. Các
chất hoạt động bề mặt làm tăng khả năng sẵn sàng phân hủy sinh học của các
chất thuộc POPs, và DDT cũng là một trong 12 chất POPs. Quá trình phân
hủy sinh học DDT có thể tăng lên khi bổ sung tỷ lệ hợp lý chất hoạt động bề
mặt sinh học. Ví dụ sử dụng enzyme MnP và Lac để xử lý methoxychlor
(MC-một loại thuốc trừ sâu đƣợc sự dụng khá rộng rãi) với sự kết hợp lần
lƣợt của Tween 80 và 1-hydroxybenzotriazole (HBT) đã chuyển đổi MC
thành olefin methoxychlor (MCO) và 4,4 '-dimethoxybenzophenone. Trong


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
75
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




trƣờng hợp kết hợp MnP và Tween 80 sau 24 giờ xử lý 65 % MC đã bị loạ i
bỏ [27].
Do vậy để khử độc môi trƣờng bị ô nhiễm với nguồn nguyên liệu rẻ
tiền nghiên cứu ảnh hƣởng của chất hoạt động bề mặt nhƣ tween 80 và nƣớc
quả bồ kết lên khả năng sinh trƣởng và sinh laccase của chủng FNA1 đã đƣợc
tiến hành. Kết quả cho thấy FNA1 đều phát triển tốt trên 2 loại chất hoạt động
bề mặt này nhƣng khả năng sinh enzyme thì hoàn toàn khác nhau (Hình 3.16).
Trên môi trƣờng có bổ sung bồ kết lƣợng laccase sinh ra không đáng kể, trong
khi bổ sung tween 80 hoạt tính laccase đo đƣợc lên đến 2608,33 U/l sau 1
ngày. Hoạt tính laccase của chủng FNA1 là khá cao so với 1 vài chủng khác
nhƣ chủng Marasmius quercophilus có hoạt tính laccase cao nhất là 0,8 U/ml
sau 5 ngày nuôi cấy trong môi trƣờng có bổ sung 0,1 % Tween 80 và đồng
[50].




Hình 3.16 Ảnh hƣởng của chất hoạt động bề mặt lên khả năng sinh

laccase của FNA1
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
76
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Kết quả trên cho thây môi trƣờng Czapek có bổ sung 0,2 % Tween 80
là môi trƣờng nấ m sợi FNA1 cho hoạt tính laccase cao, và môi trƣờng này đã
đƣợc sử dụng để tiếp tục tìm hiểu động thái sinh tổng hợp laccase của chủng
FNA1. Thí nghiệm đƣợc theo dõi trong 10 ngày, kết quả trình bày trong hình
3.17. Hoạt tính laccase đạt cao nhất sau 1 ngày nuôi cấy và giảm mạnh ở các
ngày sau đó.




Hình 3.17 Động thái sinh tổng hợp laccase



4.5 Ảnh hưởng của nguồn carbon, nitơ và môi trường thay thế

4.5.1 Ảnh hưởng của nguồn carbon

Việc sử dụng một số nguồn carbon thay thế saccharose trong môi
trƣờng Czapek nghèo cho thấy nguồn carbon thích hợp nhất cho sinh tổng
hợp enzyme của chủng FNA1 vẫn là saccharose, tiếp theo là glucose đạt 40 %
so với nguồn carbon là sacchrose. Trên các nguồn carbon khác chủng FNA1
vẫn có khả năng sinh laccase nhƣng hoạt tính laccase rất thấp (Hình 3.19),
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
77
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




khác với một số chủng khác đã đƣợc công bố nhƣ Trichoderma viride và
Trichoderma longibrachiatum đều có khả năng sinh tổng hợp laccase rất tốt
trên cả 3 nguồn carbon là glucose, saccharose và CM-cellulose [22].
Trong khi đó khả năng sinh trƣởng của FNA1 cũng rất khác nhau,
chủng này phát triển tạo sinh khối yếu trên các nguồn carbon nhƣ lactose,
cellulose và dịch chiết khoai tây. Nguồn carbon thich hợp nhất cho FNA1
phát triển là saccharose, glucose và cao malt (Hình 3.18).




tinh bột
Glucose saccharose lactose cellulose khoai tây cao
malt

Hình 3.18 Ảnh hƣởng của nguồn carbon lên khả năng sinh trƣởng của FNA1




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
78
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 3.19 Ảnh hƣởng của nguồn carbon lên khả năng sinh laccase của FNA1




4.5.2 Ảnh hưởng của nguồn nitơ

Tƣơng tự nhƣ nghiên cứu ảnh hƣởng của nguồn carbon lên sinh trƣởng
và sinh tổng hợp laccase của FNA1, để nghiên cứu ảnh hƣởng của nguồn nitơ
môi trƣờng Czapek nghèo vẫn đƣợc sử dụng và thay thế nguồn nitơ trong môi
trƣờng bằng các nguồn khác. Kết quả cho thấy trên nguồn urê chủng FNA1
phát triển yếu và phát triển tốt trên các nguồn còn lại (Hình 3.20). Lƣợng sinh
khối lớn trên các nguồn cao thịt, cao men và bột đậu tƣơng không đồng nghĩa
với khả năng sinh tổng hợp laccase tốt, trên các nguồn nitơ này hoạt tính
laccase rất thấp và giao động trong khoảng 1 U/l (Hình 3.21). Chủng FNA1
sinh trƣởng và sinh tổng hợp laccase tốt nhất trên môi trƣờng Czapek nghèo
vơi nguồn nitơ vô cơ là NaNO3 và KNO3 khác với đa số chủng nấ m sinh
laccase thích hợp với nguồn nitơ hữu cơ nhƣ Pleurotus ostreatus 32,

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
79
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Trametes pubescens MB 89 thích hợp với peptone, Agaricus bisporus,
Trametes versicolor thích hợp với nguồn cao malt v.v. [16,18,28,46].




cao thịt bột đậu tƣơng
Urê NH4NO3 Czapek nghèo cao men

Hình 3.20 Ảnh hƣởng của nguồn nitơ lên khả năng sinh trƣởng của FNA1




Hình 3.21 Ảnh hƣởng của nguồn nitơ lên khả năng sinh laccase của FNA1



Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
80
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




4.5.3 Ảnh hưởng của môi trường thay thế

Để lựa chọn môi trƣờng thích hợp cho sản xuất laccase với lƣợng lơn
chúng tôi đã tiến hành thí nghiệ m với các môi trƣờng MEG, YS, PG và SG
(thành phân nhƣ đƣợc mô tả trong phần phƣơng pháp). Kết quả cho thấy
chủng FNA1 phát triển rất tốt trên cả 4 loại môi trƣờng này nhƣng hoạt tính
laccase đạt cao nhất trên môi trƣờng SG (21,3 U/l) (Hình 3.22). Môi trƣờng
SG là môi trƣờng có thành phân chủ yếu là bột đậu tƣơng, đây là điều thuậ n
lợi vì là nguồn nguyên liệu sẵn có và rẻ tiền, có thể áp dụng trên quy mô lớ n
để sản xuất lƣợng lớn enzyme. Một số chủng nấm và xạ khuẩn trên thế giới
cũng sử dụng môi trƣờng có thành phần chính là đậu tƣơng để sản xuất
laccase với lƣợng lớn nhƣ Peniophora sp, Pleurotus, Trametes versicolor,
Coprinopsis cinerea, Fomes sclerodermeus và Streptomyces cyaneus CECT
3335 v.v. [19,37].

Dựa trên kết quả nghiên cứu ảnh hƣởng của chất hoạt động bề mặt,
Tween 80 đƣợc bổ sung vào môi trƣờng SG. Tuy nhiên trên môi trƣờng có
bột đậu tƣơng hoạt tính laccase không tăng lên nhƣ trên môi trƣờng Czapek
nghèo. Vậy đối với chủng nấm sợi FNA1 môi trƣờng thích hợp nhất để sản
xuất laccase với lƣợng lớn là môi trƣờng Czapek nghèo có bổ sung Tween 80.




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
81
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 3.22 Ảnh hƣởng của môi trƣờng thay thế đến khả năng sinh

laccase của FNA1



5 MỘT SỐ TÍNH CHẤT CỦA LACCASE THÔ

5.1 pH tối ưu và độ bền pH

5.1.1 pH tối ưu

Đô pH môi trƣờng ảnh hƣớng rất lớn đến vận tốc phản ứng enzyme.
Bởi pH ảnh hƣởng đến trạng thái ion hóa các gốc R của các gốc axit amin
trong phân tử enzyme, ion hóa các nhóm chức trong trung tâm hoạt động và
ion hóa cơ chất. Để tìm ra khoảng pH tối ƣu cho hoạt động của laccase từ
chủng FNA1 hoạt tính enzyme đã đƣợc xác định thông qua việc sử dụng dịch
lên men chủng FNA1 trong môi trƣờng Czapek nghèo có bổ sung 0,2 %
Tween 80 và các đệm có pH khác nhau. Trên hình 3.23 thể hiện kết quả định
tính, hoạt tính laccase đƣợc thể hiện thông qua mức độ xanh đậ m hay nhạt của
sản phẩ m tạo thành do ABTS bị oxy hóa. Enzyme do FNA1 sinh ra hoạt động

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
82
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




xúc tác phản ứng mạnh nhất trong khoảng pH rất thấp từ pH 1 – 2. Kết quả
xác định hoạt tính trong hình 3.24 thể hiện rõ hơn kết luận trên, laccase này
hoạt động ở khoảng pH 1,5 là thích hợp nhất, tại đây hoạt tính laccase đo
đƣợc lên đến 2802,8 U/l. Laccase c ủa chủng FNA1 có thể hoạt động trong
khoảng pH thấp nhƣ trên là một đặc tính rất quý vì trong công nghệ xử lý môi
trƣờng có rất nhiều nguồn ô nhiễm có điều kiện khắc nghiệt nhƣ pH rất thấp
hoặc rất cao. pH hoạt động tối ƣu của laccase từ chủng này là thấp hơn so vớ i
một số chủng nấm khác nhƣ Trametes trogii, Trametes versicolor,
Melacarpus albomyces, Marasmius quercophilus .v.v, pH hoat đông tôi ƣu
̣̣ ́
của laccase từ các chủng nói trên lân lƣơt la pH 2; 3; 3,5 và 4,5 [39].
̀ ̣̀




pH 5 4,5 4 3,5 3 2,5 2 1,5 1

Hình 3.23 pH tối ƣu của laccase từ chủng FNA1




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
83
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 3.24 Ảnh hƣởng của pH lên hoạt tính của laccase từ chủng FNA1



5.1.2 Độ bền pH

Do pH môi trƣờng có ảnh hƣởng đến độ bền của protein cho nên việc
xác định độ bền pH của enzyme có ý nghĩa quan trọng trong quá trình thu
nhận, tinh sạch, nghiên cứu và bảo quản enzyme. Laccase thô c ủa FNA1 bề n
ở khoảng pH 4 – 5 (Hình 3.25), khoảng pH bền này khá thấp so với một số
chủng nấ m đảm khác nhƣ nấ m đảm Sclerotium rolfsii chỉ còn 50 % hoạt tính
khi đƣơc u ơ pH 5,0 và 30 0C trong vong 65 phút [33].
̣ ̉̉ ̀




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
84
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 3.25 Độ bền pH của laccase từ chủng FNA1



5.2 Nhiệt độ thích hợp cho hoạt động của laccase và độ bền nhiệt

5.2.1 Nhiệt độ thích hợp cho hoạt động của laccase

Nhiệt độ tối ƣu cho hoạt động của laccase đƣợc xác định qua việc đo
hoạt độ enzyme ở các nhiệt độ phản ứng khác nhau từ nhiệt độ phòng (32oC)
đến 90 oC. Kết quả trên hình 3.26 cho thấy khi nhiệt độ tăng dần từ 32 oC đến
50 oC hoạt tính laccase cũng tăng dần từ 53,4 % (1354,2 U/l) đến 100%, nhiệt
độ thích hợp nhất cho laccase hoạt động khoảng 50 oC (2732 U/l) và giảm nhẹ
khi nhiệt độ tăng lên 60 oC. Ở 90 oC enzyme vẫn còn khả năng hoạt động
nhƣng hoạt tính giảm mạnh chỉ còn 35,7 % (905,1 U/l). Nhiệt độ thích hợp
cho hoạt động của laccase từ nấ m sợi FNA1 thấp hơn so với 1 số chủng nấ m
đảm khác nhƣ Pycnoporus sanguineus là 55 oC, 3 loại laccase của C.
micaceus là pool 1; pool 2; pool 3 tƣơng ứng là 65, 60, 65 oC [33].


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
85
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 3.26 Ảnh hƣởng của nhiệt độ phản ứng lên hoạt tính laccase từ chủng FNA1



5.2.2 Độ bền nhiệt

Do bản chất hóa học của enzyme là protein nên dƣới ảnh hƣởng của
nhiệt độ, enzyme đều bị biến tính ít nhiều và ảnh hƣởng tới hoạt độ, mức độ
ảnh hƣởng tùy thuộc vào nhiệt độ và thời gian ủ enzyme. Để xác định khoảng
nhiệt độ bền của laccase từ FNA1 dịch enzyme thô đƣợc ủ ở các nhiệt độ 50,
60, 80, và 90 oC, hoạt tính enzyme đƣợc xác định sau các khoảng thời gian
nhất định. Laccase thô của FNA1 bền nhiệt ở khoảng nhiệt độ dƣới 50 oC.
Khi xử lý enzyme ở 60 oC sau 40 phút hoạt tính laccase giảm còn một nửa so
với ban đầu (Hình 3.27), thời gian này là 200 phút đối với laccase c ủa P.
sanguineus và dƣới 5 phút đối với các laccase của C. micaceus khi xử lý ở 65
o
C. Xử lý ở nhiệt độ cao 80 và 90 oC hoạt tính enzyme sau 10 phút đã giả m
mạnh xuống khoảng 50 % hoạt tính ban đầu và duy trì ổn định trong thời gian
ủ tiếp theo [33].
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
86
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 3.27 Ảnh hƣởng của nhiệt độ lên độ bền laccase từ FNA1



6 PHÂN LOẠI CHỦNG NẤM SỢI FNA1 BẰNG PHƢƠNG PHÁP SO
SÁNH TRÌNH TỰ ĐOẠN GEN MÃ HÓA 18S rRNA

Hiện nay, phƣơng pháp sử dụng kỹ thuật sinh học phân tử trong nghiên
cứu phân loại dựa vào trình tự đoạn gen mã hóa 18S rRNA đƣợc sử dụng rất
rộng rãi và kết quả phản ánh nhanh chóng và chính xác vị trí phân loại của
các chủng nấ m sợi. Do đó chúng tôi tiến hành tách dòng gen mã hóa 18S
rRNA của chủng nấm sợi FNA1 để xác định và so sánh trình tự nucleotide
của chủng nấm này với các chủng nấm khác trên ngân hàng gen thế giới nhằ m
phân loại định tên chủng này.

6.1 Tách chiết DNA tổng số

Để tiến hành các nghiên c ứu tiếp theo, việc thu đƣợc DNA tổng số
không bị đứt gãy, có độ tinh sạch cao là rất quan trọng. Kết quả điện di kiể m

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
87
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




tra trên gel agaroza 1% ở hình 3.28 cho thấy DNA tổng số thu đƣợc không bị
đứt gãy, băng gọn, sạch có thể đƣợc sử dụng cho các nghiên c ứu tiếp theo.




DNA tổng số




Hình 3.28 Điện di đồ sản phẩm tách DNA tổng số chủng FNA1


6.2 Nhân đoạn gen 18S rRNA bằng kỹ thuật PCR

Phản ứng PCR đƣợc tiến hành sử dụng DNA tổng số của chủng FNA1
làm sợi khuôn, cặp mồi đặc hiệu Fung5r và EF4f và chu trình nhiệt nhƣ đã
nêu ở phần phƣơng pháp.
1 2




750bp
Khoảng 550bp


Hình 3.29 Sản phẩm PCR 18S rRNA chủng FNA1

Kênh 1: Marker 1kb, kênh 2: Sản phẩ m PCR


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
88
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Sản phẩm PCR nhân đoạn gen 18S rRNA chủng FNA1 đƣợc kiểm tra
bằng điện di trên gel agaroza 1% (Hình 3.29). Kết quả này cho thấy, băng
của sản phẩm PCR là băng đơn, sắc nét và có kích thƣớc khoảng 550 bp phù
hợp với tính toán lý thuyết, chứng tỏ đoạn gen mong muốn có thể đã đƣợc
nhân lên đặc hiệu.


6.3 Tách dòng gen 18S rRNA trong vectơ pTZ57R/T

Sau khi thu đƣợc sản phẩ m PCR, tiến hành gắn vào vectơ pTZ57R/T
nhờ enzym T4 ligase, và biến nạp vào tế bào khả biến E. coli. Sau khi nuôi
tĩnh qua đêm ở 37oC, trên đĩa biến nạp xuất hiện các khuẩn lạc trắng và khuẩ n
lạc xanh xen kẽ (Hình 3.30). Một số khuẩn lạc trắng đƣợc lựa chọn để tiế n
hành tách DNA plasmid. Sản phẩm DNA plasmid thu đƣợc ở các dòng chọn
lựa đƣợc điện di kiể m tra trên gel agaroza 1% (Hình 3.31), mẫu DNA plasmid
ở các kênh 1, 3 nằm ở vị trí cao hơn so với mẫu đối chứng có khả năng mang
sản phẩm mong muốn.

Để kiểm tra dòng plasmid lựa chọn có mang sản phẩm mong muốn hay
không, phản ứng PCR kiể m tra có sử dụng khuôn là DNA plasmid c ủa các
dòng 1, 3 đã đƣợc thực hiện. Tại các kênh 1, 2 hình 3.32 xuất hiện băng DNA
có kích thƣớc khoảng 550bp, vậy có thể các dòng này đã mang sản phẩ m
PCR mong muốn. Hai dòng này đã đƣợc lựa chọn để tách và làm sạch DNA
plasmid với số lƣợng lớn phục vụ cho việc xác định trình tự (Hình 3.33).




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
89
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Hình 3.30 Khuẩn lạc vi khuẩn E. coli trên môi trƣờng LB chứa X-Gal sau khi biến
nạp vector pTZ57R/T


C1 23




Hình 3.31 Phổ điện di sản phẩm tách DNA
Kênh C: Đối chứng (khuẩn lạc màu xanh)
plasmit
Kênh 1, 2, 3: DNA plasmit của các dòng khuẩn lạc màu trắng




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
90
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




M 1 2




Hình 3.32 Sản phẩm PCR từ DNA plasmit với cặp mồi EF4f và fung5r

Kênh M: Marker 1kb
Kênh 1, 2: Sản phẩm PCR kiểm tra dòng 1 và 3




1 2 C




Hình 3.33 DNA plasmit mang gen 18S rRNA của chủng FNA1
Kênh 1, 2: DNA plasmit sau khi làm sạch

Kênh C: Đối chứng




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
91
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




6.4 So sánh trình tự đoạn gen mã hóa 18S rRNA của chủng FNA1

Trình tự đoạn gen 18S rRNA (534 nucleotid) của chủng FNA1 đã đƣợc
xác định, kết quả đƣợc trình bày ở hình 3.34. Trình tự đoạn gen mã hoá 18S
rRNA của chủng FNA1 đƣợc đăng ký trên Genbank với mã số GQ906535.

So sánh với các trình tự gen 18S rRNA c ủa các chủng vi nấm đã công
bố trên các ngân hàng dữ liệu Genbank, EMBL cho thấy chủng FNA1 có mức
tƣơng đồng cao với các chủng vi nấ m thuộc ngành nấ m nang Ascomycetes,
ngành phụ Pezizomycotina, chi Aspergillus. Dựa trên cơ sở so sánh mức độ
tƣơng đồng một phần trình tự gen mã hóa 18S rRNA chủng FNA1 với một số
chủng vi nấm đại diện, sử dụng phần mềm Clustal X để xây dựng cây phát
sinh chủng loại để thấy rõ đƣợc mối quan hệ phát sinh chủng loại của chủng
nấm sợi FNA1(Hình 3.35).

Nhƣ vậy, dựa trên các đặc điểm hình thái khuẩn lạc, bào tử và so sánh
một phần trình tự gen mã hóa 18S rRNA của chủng FNA1 thì ch ủng này
thuộc chi Aspergillus và đƣơc đăt tên là Aspergillus sp. FNA1.
̣ ̣

GGAAGGGGTGTATTTATTAGATAATCTGTGCTCCTTCTTCGAGCTCCTTGGTGATTCATAA
TAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTC
GATGGTAGGATAGTGGCCTACCATGGTGGCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGA
GAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTAC CCAATCC
CGACACGGGGAGGTAGTGACAATAAATACTGATACGGGGCTCTTTTGGGTCTCGTAATTGGAAT
GAGTACAATCTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGG
TAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG
TCTGGCTGGCCGGTCCGCCTCACCGCGAGTACTGGTCCGGCTGGACCTTTCCTTC TGGGGAACCT
CATGGCCTTCACTGGCTGTGGGGGGAACCAGGGACTTTTACA

Hình 3.34 Trình tự đoạn gen mã hóa 18S rRNA của chủng FNA1


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
92
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Aspergillus sp. FNA1




Hình 3.35 Cây phát sinh chủng loại của chủng Aspergillus sp. FNA1



Nấm thuộc chi Aspergillus có nhiều chủng có khả năng phân hủy
DDT hay các chất có cấu trúc tƣơng tự. Aspergillus conicus làm biến đổ i
55,1% bis(4-chlorophenyl)acetic acid (DDA) thành các s ản phẩ m hòa tan
trong nƣớc chƣa xác định và chƣa chiết tách đƣợc. Aspergillus niger và
Penicillium brefeldianum chuyển hóa lần lƣợt 12,4 và 24,6% DDT thành
các sản phẩm không xác định và hòa tan trong nƣớc. Aspergillus niger
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
93
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




phân huy 4, 4’-dichlorobenzophenone (DBP) thành 4 -chlorobenzophenone
̉
và methylated 4-chlorobenzophenone [47]. Các minh chứng trên cho thấy
vai tro rât qua n trong cua nâm sơi
̀́ ̣ ̉ ́ ̣ , đăc biêt la cac đai diên cua chi
̣ ̣̀́ ̣ ̣ ̉
Aspergillus trong phân huy sinh hoc DDT va cac san phâm trong chu trì nh
̉ ̣ ̀́ ̉ ̉
khoáng hóa DDT .

Trên cây phát sinh chủng loại cho thấy chủng Aspergillus sp. FNA1
có quan hệ gần gũi với một số chủng nhƣ Aspergillus sp. FNA4,
Aspergillus sp. FNA33, Aspergillus sp. FBH11, đây đều là các chủng có
khả năng phân hủy các chất thuộc POPs. Đặc biệt 2 chủng Aspergillus sp.
FNA4, Aspergillus sp. FNA33 là 2 chủng đƣợc phân lập cùng địa điểm ô
nhiễ m với chủng FNA1, các chủng này có khả năng phân hủy lần lƣợt
94,48 % hỗn hợp DDT trong 14 ngày và 88 % HCH, trong khi chủng
FNA1 phân hủy 97,23 % DDT; 97,19 DDD; và 92,69 % DDE trong 7 ngày
nuôi cấy. Cả 3 chủng FNA4, FNA33 và FBH11 đều đƣợc mô tả là có khả
năng sinh laccase, chủng FNA4 sinh laccase với hoạt tính 15,4 U/l, chủng
FNA33 là 4,3 U/l [3,4,5], chủng FBH11 có độ tƣơng đồng 98 % đƣợc phân
lập từ đất ô nhiễm thuốc diệt cỏ/dioxin sinh laccase với hoạt tính cao. Môt
̣
số chủng nâm sơi thu ộc chi Aspergillus đƣợc công bố là có kha năng sinh
́ ̣ ̉
enzyme ngoai bao la
̣̀̀ Aspergillus terreus LD-1 và Aspergillus nidulans.
Chủng Aspergillus tereus sinh ra hai loai enzyme ngo
̣ ại bào la MnP va
̀ ̀
Laccase trong điều kiện kiềm (pH từ 11 đến 12.5), hoạt tính enzyme trung
bình của hai loại enzyme này là 0,384 U/mg [40].




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
94
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




KẾT LUẬN

1. Dựa trên các đặc điểm hình thái khuẩn lạc, bào tử và so sánh một phầ n
trình tự gen mã hóa 18S rRNA, chủng nấm sợi FNA1 đƣợc xác định thuộc
chi Aspergillus và đƣợc đặt tên là Aspergillus sp. FNA1. Trình tự đoạn gen
mã hóa 18S rRNA c ủa chủng Aspergillus sp. FNA1 đƣợc đăng ký trên
Genbank với mã số GQ906535.
2. Cả 3 chủng FNA1, FNA2 và FNA3 đều có khả năng sinh laccase và MnP,
chủng FNA1 không sinh LiP. Trên môi trƣờng sàng lọc, hoạt tính laccase
lần lƣợt là 5,4; 2,9; 3,3 (U/l), hoạt tính MnP lần lƣợt là 26,9; 6,05; 13,4
(U/l), hoạt tính LiP của FNA2 và FNA3 là 4,15 và 2,07 (U/l).
3. Aspergillus sp. FNA1 phân hủy DDT theo cơ chế đồng trao đổi chất, sau 7
ngày nuôi cấy chủng này loại bỏ DDE, DDD và DDT lần lƣợt là 92,69 %,
97,19 % và 97,23 % so với mẫu đối chứng.
4. Aspergillus sp. FNA1 phát triển tốt nhất ở 37oC, pH 5, nồng độ NaCl 0,1
%, nồng độ DDT 200 ppm, ngoài ra còn phát triển tốt trên môi trƣờng chứa
2,4-D, 2,4,5-T, pyren, phenanthren, anthracene và dịch chiết. Chủng FNA1
không phát triển trên nguồn carbon là lactose và cellulose, phát triển yế u
trên nguồn nitơ là urê.
5. Aspergillus sp. FNA1 sinh tổng hợp laccase trong điều kiện 30oC, pH 5,
nồng độ NaCl 0,1 %, glucose 0,1 %, CuSO4 1 mM và nguồn chất ô nhiễ m
là DDT, nguồn carbon là saccharose, nguồn nitơ là NaNO3 và KNO3.
6. Môi trƣờng thích hợp nhất để Aspergillus sp. FNA1 sinh tổng hợp laccase
là môi trƣờng Czapek nghèo có bổ sung Tween 80 0,2 %, hoạt tính laccase
đạt 2608,3 U/l sau 1 ngày nuôi cấy.
7. Laccase từ chủng FNA1 có pH tối ƣu 1,5, nhiệt độ tối ƣu 50oC, bền trong
khoảng pH 4 – 5 và nhiệt độ dƣới 50 oC.
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
95
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




KIẾN NGHỊ

1. Nghiên cứu các gen chức năng tham gia quá trình phân hủy DDT và gen
mã hóa laccase.
2. Nghiên cứu khả năng phân hủy sinh học các loại thuốc trừ sâu khác của
chủng FNA1, đồng thời nghiên cứu khả năng sử dụng enzyme ngoại bào
trong việc loại bỏ thuốc nhuộ m màu và phân hủy các chất ô nhiễm.
3. Tối ƣu các điều kiện lên men để sản xuất laccase với lƣợng lớn.
4. Tiếp tục nghiên cứu các đặc tính hóa sinh của laccase từ chủng FNA1.




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
96
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




TÀI LIỆU THAM KHẢO

Tài liệu Tiếng Việt


1. Lê Trần Bình, Phan Văn Chi, Nông Văn Hải, Trƣơng Nam Hải,
Lê Quang Huấn, 2003. áp dụng các kỹ thuật phân tử trong nghiên cứu tài
nguyên sinh vật Việt Nam. Nxb KH&KT Hà Nội: 325- 329
2. Hoàng Thị Mỹ Hạnh, Nguyễn Đƣơng Nhã, Đặng Thị Cẩm Hà, 2004. Nấm
sợi phân hủy hydrocarbon thơm đa nhân phân lập từ cặn dầu thô của giếng
khai thác dầu, Vũng Tàu. Tạp chí Công nghệ Sinh học, số I(tập 2): 255-
264.
3. Hoàng Thị Mỹ Hạnh, Nguyễn Thanh Thủy, Ngô Xuân Quý, Nghiêm Xuân
Trƣờng, Nghiêm Ngọc Minh, Đặng Thị Cẩm Hà (2004) Khả năng phân
hủy 2,4-D và dibenzofuran c ủa chủng nấm sợi FDN20. Tạp chí công nghệ
sinh học 2 (4): 517-528
4. Trần Thị Nhƣ Hòa, Nghiêm Ngọc Minh, Đặng Thị Cẩm Hà (2008), “Phâ n
loại hai chủng vi sinh vật từ đất nhiễm chất diệt cỏ/dioxin khử độc trong
bioreactor hiếu khí”, Tạp chí công nghệ sinh học, tập(số), trang.
5. Nghiêm Ngọc Minh, Vũ Mạnh Chiến, Đặng Thị Cẩm Hà (2006), “Nghiên
cứu phân loại và khả năng sử dụng DDT của chủng XKNA21 đƣợc phân
lập từ đất ô nhiễ m DDT”, Tạp chí công nghệ sinh học, 4(2), 257-264
6. Nguyễn Nguyên Quang, Đặng Thị Cẩm Hà (2009), “Phân lập, phân loại và
khả năng phân hủy DDT, DDD, DDE c ủa một số chủng vi sinh vật”, Tạp
chí công nghệ sinh học, đang in.
7. Mai Thanh Truyết. Ô nhiễm thuốc sát trùng: DDT.
8. Mai Thanh Truyết, Nguyễn Minh Quang. Phát triển và môi trường bền
vững ở Việt Nam.


Tài liệu Tiếng Anh

9. Adinarayana Kunamneni et al (2008), “Engineering and Application of
fungal laccase for organic synthesis”, Microbial Cell Factories.
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
97
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




10. Aislabie J, Davison A D, Boul H L, Franzmann P D, Jardine D R, and
Karuso P (1999), “Isolation of Terrabacter sp. Strain DDE-1, Which
metabolizes 1,1-dichloro-2,2-bis (4-chlorophenyl) ethylene when induced
with biphenyl”, Appl and Environ Microbiol, 65, pp. 5607-561.
11. Andrea Zille (2005), Laccase reactions for textile applications , Doctor
thesis, University of Minho, Italia
12. Ben- Dyke R., Sanderson D., Noakes D., (1970), ”Acute toxicity data for
pesticides”, World Rev Pestic Cont, 9, pp.119- 127.
13. Bidleman T., Christensen E., Billings W. et al., (1981). Atmospheric
transport of organochlorines in the North Atlantic gyre, J. Mar Res 39,
pp.443- 464.
14. Bononi, V. L. R., Machado, K. M. G., Matheu, D. R. (2005) ,
“Ligninolytic enzymes production and Remazol Brilliant Blue R
decolorization by tropical Brazilian Basidiomycetes fungi”, Brazilian
journal of microbiology 36, pp.246-252.
15. Bumpus and Aust (1987), “Biodegradation of DDT [1,1,1- trichloro - 2,2-
bis (4-chlorophenyl) ethane] by the white rot fungus Phanerochaete
chrysosporium”, Appl Environ Microbiol, 53(9), pp.2001–2008.
16. Christiane Galhaup, Harald Wagner Barbara, Hinterstoisser and Dietmar
Haltrich (2002), “Increased production of laccase by the wood -degrading
basidiomycete Trametes pubescens”, Enzyme and Microbial Technology,
30(4), pp.529-536.
17. Crawford, D.L. and Crawford, R.L. (1978), “Microbial degradation of
lignocellulose the lignin component”, Appl. Env. Microbiol, 31(5),
pp.714-717.
18. D. A. Wood (1980), “Production, Purification and Properties of
Extracellular Laccase of Agaricus bisporus”, Journal of General
Microbiology 117, pp.327-338.
19. Gerd J. Mander, Huaming Wang, Elizabeth Bodie, Jens Wagner , Kay
Vienken, Claudia Vinuesa, Caroline Foster, Abigail C. Leeder, Gethin
Allen, Valerie Hamill, Giselle G. Janssen, Nigel Dunn-Coleman, Marvin
Karos, Hans Georg Lemaire, Thomas Subkowski, Claus Bollschweiler,
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
98
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Geoffrey Turner, Bernhard Nüsslein, and Reinhard Fischer (2006), “Use
of Laccase as a Novel, Versatile Reporter System in Filamentous Fungi ”,
Applied and Environmental Microbiology, 72(7), pp.5020-5026.
20. Giraud, Guiraud P., Kadri M., Blake G., Steiman S., (2001),
“Biodegradation of phenanthrene and fluoranthene by fungi isolated from
an experimental constructed wetland for wastewater treatment ”, Wat.
Res., 35(17), pp.4126-4136.
21. Gladys Alexandr, Igor B. Zhulin (2000), “Laccases are widespread in
bacteria”, Trend in Biotechnology, 18(2), pp.41-42.
22. Gochev, V. K., A. I. Krastanov (2007), “Isolation of Laccase Producing
Trichoderma Spp”, Bulg. J. Agric. Sci., 13, pp.171-176
23. Guarro Josep, Josepa Gene, và Alberto M. Stchigel. Developments in
Fungal Taxonomy. Unitat de Microbiologia Spain.
24. Hans E. Schoemaker, Klaus Piontek (1996), “On the interaction of lignin
peroxidase with lignin”, Pure & Appl. Chem, 68(11), pp.2089-2096.
25. Harald Claus (2003), “Laccase and their occurrence in prokaryotes ”,
Arch Microbiol, 179, pp.145-150.
26. Hestbjerg Helle, Willumsen Pia Arentsen, Christensen Mette, Andersen
Ole and Jacobsen Carsten Suhr (2003), “Bioaugmentation of tar-
contaminated soils under field conditions using Pleurotus ostreatus refuse
from commercial mushroom production”. Environmental Toxicology and
Chemistry 22(4), pp.692-98.
27. Hirofumi Hirai , Sawako Nakanishi, Tomoaki Nishida (2004), “Oxidative
dechlorination of methoxychlor by ligninolytic enzymes from white -rot
fungi”, Chemosphere, 55(4), pp.641-645
28. Hongman Hou, Jiti Zhou, Jing Wang, Cuihong Du, Bin Yan (2004),
“Enhancement of laccase production by Pleurotus ostreatus and its use
for the decolorization of anthraquinone dye”, Process Biochemistry,
39(11), pp.1415-1419




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
99
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




29. J.M. Aislabie, N.K.Richards, H.L.Boul (1997), “Microbial degradation of
DDT and its residues- a review”, New Zealand Journal of Agricultural
Research, pp.271- 275.
30. Jan D. V. E., Gabriela F. D., Anneke K. – W., Eric S (2000), “Analysis of
the dynamics of fungal communities in soil via fungal – specific PCR of
soil DNA followed by denaturing gradient gel electrophore sis”, Journal of
Microbiological Methods, 43, pp.133 – 151.
31. Johnson B. Thomas and Jack O. Kennedy (1973), “Biomagnification of p,
p'-DDT and Methoxychlor by Bacteria”, Appl Environ Microbiol, 26(1),
pp.66-71.
32. José Renato P . Cavallazzi, Catarina M. Kasuya , Marcos A. Soares,
(2005), “Screening of inducers for laccase production by Lentinula edodes
in liquid medium”, Brazillan Journal of Microbiology 36, pp.383-387.
33. Kizhekkedathu Narayanan Niladevi, Parukuttyama Prema (2005),
“Mangrove Actinomyces as the so urce of Ligninolytic Enzymes”
Actinomycestologica, 19, pp.40 –47.
34. Klaus Piontek, Matteo Antorini, Thomas Choinowski Crystal (2002),
“Structure of a Laccase from the Fungus Trametes versicolor at 1.90-Å
Resolution Containing a Full Comp lement of Coppers”, The Journal of
Biological Chemistry, 277,pp.37663-37669.
35. Laura-Leena Kiiskinen (2005), “Characteration and heterologuos
production of novel laccase from Melanocarpus albomyces”, Doctor
Thesis, Helneski University of Technology.
36. Lucier G.W., Trischer A. M., Van den Heuvel J.P., et al., (1992),
“Organohalogen compounds: Extended abstracts of 12th Intern. Symp. On
dioxins and related compounds”, Tampere: Finish Institute of occupational
heath, 10, pp.3-6.




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
100
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




37. M. Enriqueta Arias, María Arenas, Juana Rodríguez, Juan Soliveri,
Andrew S. Ball, and Manuel Hernández (2003), “Kraft Pulp
Biobleaching and Mediated Oxidation of a Nonphenolic Substrate by
Laccase from Streptomyces cyaneus CECT 3335”, Applied and
Environmental Microbiology, 69(4), pp.1953-1958.
38. Marie-Francois Hullo, Ivan Moszer, Antoine Danchin and Isabelle
Martin-verstraete (2001), “Cot A of Bacillus subtilis is a copper-depedent
laccase”. Journal of Bacteriology, pp.5426-5430.
39. Marièlle Bar (2001), “Kinetics and physico-chemical properties ò white-
rot fungal laccases”, doctor thesis.
40. Mario Scherer, Reinhard Fischer (2001), “Molecular characterization of a
blue-copper laccase, TILA, of Aspergillus nidulans”, FEMS Microbiology
Letters, 199, pp.207-213.
41. Nadeau Lloyd J, Sayler Gary S and Spain J C (1998), “Oxidation of
1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane (DDT) by Alcaligenes
eutrophus A5”, Archives of Microbiology, 171(1), pp.44-49.
42. Nadeau, L. J.; Menn, F- M.; Breen, A.; Sayler, G.S., (1994). “Aerobic
degradation of DDT by Alcaligenes eutrophus A5”, Applied and
environmental microbiology 60: 51- 55.
43. O. V. Morozova, G. P. Shumakovich, M. A. Gorbacheva, S. V. Shleev,
and A. I. Yaropolov (2007), ““Blue” Laccases”, Biochemistry (Moscow),
72(10), pp.1136-1150.
44. P. Sharma, R. Goel, N. Capalash (2007), “Bacterial laccase”, World J
Microbiol Biotechnol, 23, pp.823-832.
45. Pereira W., Domagalski J., Hostettler F., et al., (1996), “Occurrence and
accumulation of pesticides and organic contaminants in river sediment,
water and clam tissues from the San Joaquin River and tributaries,
California”, Environ Toxicol Chem, 15(2), pp.172- 180.




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
101
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




46. PJ Collins, MJJ Kotterman, JA Field and ADW Dobson (1996),
“Oxidation of Anthracene and Benzo[a]pyrene by Laccases from
Trametes versicolor”, Appl. Environ. Microbiol.,62(12), pp.4563-4567.
47. R V Subba-Rao and M Alexander (1985) “Bacterial and fungal
cometabolism of 1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane (DDT) and
its breakdown products”, Applied and Environmental Microbiology
49(3), pp.509-516.
48. Rochkind- Dubinsky, M.L.; Sayler, G.S.; Blackburn, J.W., 1987.
Microbiological decomposition of chlorinated aromatic compounds.
Microbiology series, vol. 18, New York, Marcel Dekker: pp. 153- 162.
49. S. Sadhasivam, S. Savitha, K. Swaminathan, Feng-Huei Lin (2008),
“Production, purification and characterization of mid -redox potential
laccase from a newly isolated Trichoderma harzianum WL1 ”, Process
Biochemistry 43, pp.736–742.
50. S. Tagger, C. Périssol, G. Gil, G. Vogt and J. Le Petit (1998)
“Phenoloxidases of the white-rot fungus Marasmius quercophilus isolated
from an evergreen oak litter (Quercus ilex L.)”, Enzyme and Microbial
Technology, 23(6), pp.372-379.
51. Sambrook J., Russell D.W. (2001), Molecular Cloning. A Laboratory
Manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY.
52. Sergio Riva (2006), “Laccases: Blue enzymes for green chemistry”,
Trends in Biotechnology, 24(5), pp.219-226.
53. Shah, M. M.; Barr, D. P.; Chung, N.; Aust S.D., (1992),“ Use of white rot
fungi for the degradation of environmental cheicals”, Toxicology letters,
64/65, pp.493- 501.
54. Staples C., Werner A., Hoogheem T., (1985) “Assessment of priority
pollutant concentrations in the United States using STORET database”,
Environ Toxicol Chem 4, pp.131- 142.
55. Susana Rodríguez Couto and José Luis Toca-Herrera (2009), “Lacasses in
the textile industry”, Biotechnology and Molecular Biology Reviews , 1(4),
pp.115-120.
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
102
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




56. Tereza Skálová et al, (2009), “The structure of small laccase from
streptomyces coelicolor reveals a link between laccase and nitrite
reductases”, Journal of Molecular Biotechnology, 385, pp.1165-1178.
57. The Use and Effectiveness of Phytoremediation to Treat Persistent
Organic Pollutants (2005), Kristi Russell Environmental Careers
Organization.
58. Timothy P.Ruggaber, Jeffrey W. Talley (2006), “Enhancing
Bioremediation with enzymatic Processes ”, Practice periodical of
hazardous, toxic, and radioactive waste management.
59. Toxicology profile for DDT, DDE, DDD, pp. 1- 231.
60. Xiaohu Shao et al (2009), “Deletion and site-directed mutagnesis of
laccase from Shigella dysenteriae results in enhanced enzymatic activity
and thermostability”, Enzyme and Microbial Technology, 44, pp.274-280.
61. Y. Z. Xiao, Q. Chen, J. Hang, Y. Y. Shi1, Y. Z. Xiao, J. Wu, Y. Z. Hong,
Y. P. Wang (2004), “Selective induction, purification and characterization
of a laccase isozyme genes from Trametes sp. AH28 -2 and analyses o f
their differential expression”, Applied Microbiology and Biotechnology
71, pp.493-501.
62. Yi Huang, Xi Zhao and Shengji Luan (2007), “Uptake and biodegradation
of DDT by 4 ectomycorrhizal fungi”, Sicence of the total enviroment 358,
pp.235-241.
63. Zaidi R., Baquar. And Imam H. S., (1999), “Factors affecting microbial
degradation of polycyclic aromatic hydrocacbon phenanthrene in the
Caribbean coastal water”, Marine Pollution Bulletin, 38, pp.737- 742.




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
103
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




PHỤ LỤC

Phụ lục 1. Đặc tính lý - hóa một số đồng phân của DDT

Đặc tính p,p,-DDT p,p,-DDE p,p,-DDD o,p,- DDT o,p,-DDE o,p-DDD
Khối
lƣợng 354.5 318.03 320.05 354.49 318.03 320.05
phân tử
Tinh thể Tinh thể
Tinh thể Tinh thể bé,
Màu bé, bột bé, bột ND ND
bé,bột trắng bột trắng
trắng trắng
Trạng
Rắn Rắn Rắn Rắn Rắn ND
thái vật lý
Nhiệt độ
Phân hủy 336 0C 3500C ND ND ND
sôi
Khối lƣợng
riêng 0.98-0.99 ND 1.385 0.98-0.99 ND ND
3
d(g/cm )
Mùi Nhẹ ND ND ND ND ND
Độ tan
0.025mg/l 0.085mg/l 0.14mg/l 0.1mg/l
ND ND
(250C) (250C) (250C) (25 0C)
trong nƣớc
Tan tốt
Ít tan trong Tan trong
Độ tan trong chất
etanol, tan etanol, iso
béo và các
trong dung tốt trong ND ND ND octan,
dung môi
etylete và cacbon-
môi hữu cơ hữu cơ
acetone tetraclorit
khác
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
104
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Áp suất
1.6x10-7 6x10-6 1.35x106 1.1x10-7 6.2x10-6 1.94x106
200C,torr 250C,torr 25 0C,torr 20 0C,torr 250C,torr 30 0C,torr
bay hơi




Phụ lục 2. Các vi sinh vật sử dụng DDT

Vi khuẩn Nấm Xạ khuẩn
Alcaligenes eutrophus A5 Nocardia .sp Streptomyces aureofaciens

Phanerochaete Streptomyces
Arthrobacter. Sp
chrysosporium viridochromogenes

Bacillus. Sp Trichoderma viridae Streptomyces annamoneus

Cylindrotheca closterium Sacharomyces cerevisiae Streptomyces chromofuscus

Enterobacter aerogenes Fusarium solami

Enterobacter cloacae Aspergillus conicus

Eschrichia coli Aspergillus niger

Klebsiella pneumoneae Leccinum scabrum

Klebsiella pneumoniae Gloeophyllum trabeum

Pseudomonas putida Penicillium brefeldianum




Phụ lục 3. Vi sinh vật sinh laccase

Nấm đảm Nấm sợi Xạ khuẩn Vi khuẩn

Phanerochaete Melanocarpus Streptomyces Bacillus
chrysosporium albomyces lavendulae licheniformis

Pycnoporus Fusarium Streptomyces Bacillus
cinnabarinus oxysporum psammoticus halodurans

Rhizotonia solani Aspergillus nidulans Streptomyces Thermus

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
105
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




viridosporus thermophilus

Trametes villosa Trichoderma Streptomyces Escherichia coli
harzianum coelicolor

Trametes versicolor Aspergillus niger Bacillus subtilis

Pleurotus ostreatus Aspergillus terreus

Lentinula edodes Pholiota spp.

Agaricus bisporus Peniophora spp.

Botrytis cinerea Mauginiella sp.



Phụ lục 4. Gene mã hóa laccase

Tên gene
Tên chủng Tên chủng Tên gene laccase
laccase

Bacillus subtilis cotA Basidiomycete PM1 lac1

Ceriporiopsis
Ics-1 Podospora anserina lac2
subvermispora

Coprinus cinereus lcc1 Populus euramericana lac90

Cryptococcus
CNLAC1 Rhizoctonia solani lcc4
neoformans

Gaeumannomyces
LAC2 Trametes pubescens lap2
graminis var. tritici

Marasmius
lac1 Trametes trogii lcc1
quercophilus

Myceliophthora
lcc1 Trametes versicolor lccI
thermophila

Neurospora crassa SalI Trametes versicolor lcc2


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
106
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Phlebia radiata lac1 Trametes villosa lcc1

Pleurotus ostreatus poxa1b Trametes villosa lcc2

Streptomyces
Pleurotus ostreatus Poxc Poxb
lavendulae



Phụ lục 5. Một số kỹ thuật phân loại hiện đại

Phạm vi
Thành phần tế bào Phƣơng pháp phân tích
phân loại
Thành phần Bazơ (%G+C) Chi
Biến tính DNA : DNA Loài
Các phần DNA đƣợc cắt bằng enzym giới
DNA nhiễm sắc thể Loài và dƣới loài
hạn
Đa hình chiều dài các đoạn giới hạn của
RNA riboxom
Trình tự nucleotit Loài, chi
RNA riboxom
và trên chi
Lai DNA : rRNA
Loài, chi
Trình tự axit amin
và trên chi
So sánh bằng phản ứng huyết thanh
Loài và chi
Protein
Các kiểu điện di
Các dòng
Điện di enzym đa vị trí
trong loài
Cấu trúc peptidoglucan
Thành tế bào Polysaccharid Loài và chi
Axít teichoic
Axít béo
Lipid phân cực Loài và chi
Màng
Axít mycolic
Isoprenoid quinones
Các sản phẩm trao
Axít béo Loài và chi
đổi chất
Sắc kí lỏng pyrolysis
Loài và dƣới loài
Toàn bộ tế bào
Pyrolsis khối phổ


Phụ lục 6. Xác định hoạt tính LiP, MnP
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
107
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Xác định hoạt tính enzyme LiP
Thành phần phản ứng:
Thành phần phản ứng Mẫu đối chứng Mẫu thí nghiệm
Đệm kali phosphate PPB (50
500 µl 500 µl
mM, pH = 7)
4-aminoantipyrine, 0,164 mM 50 µl 50 µl
2,4-DCP 3 mM 200 µl 200 µl
Dịch enzyme 200 µl 200µl
H2O2 4 mM 0 µl 50 µl
Nƣớc khử ion 50 µl 0 µl

Phản ứng diễn ra khi cho H2O2 vào hỗn hợp, giá trị OD đo sau 1 phút.
(ODM  ODC )  V pu  106  D f
U
Công thức tính:
VE  
Trong đó:
U: Hoạt độ enzym (U/l)
ε: hệ số hấp thụ, ε510 = 21647 M-1cm-1
Vpu: Tổng thể tích phản ứng (1 ml)
VE: Thể tích enzyme (0,2 ml)
ODM: Giá trị OD đo đƣợc của mẫu thí nghiệm
ODC: Giá trị OD đo đƣợc của mẫu đối chứng
Df: Độ pha loãng

Xác định hoạt tính MnP
Thành phần phản ứng:
Thành phần phản ứng Mẫu đối chứng Mẫu thí nghiệm
Đệm kali phosphate PPB (100
3 ml 3 ml
mM, pH = 7)
MnSO4 0,1 mM 200 µl 200 µl
Phenol đỏ 0,1 mM 300 µl 300 µl
Dịch enzyme 1 ml 1 ml
H2O2 50 mM 0 µl 500 µl
Nƣớc khử ion 500 µl 0 µl




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
108
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Phản ứng diễn ra khi cho H2O2 vào hỗn hợp, sau 1 phút 30 giây dừng phản
ứng bằng cách cho 40 µl NaOH 5M vào 1 ml mẫu, xác định giá trị OD ở bƣớc sóng
610 nm.

(ODM  ODC )  V pu  106  D f
U
Công thức tính:
VE  1,5  


Trong đó: U: Hoạt độ enzyme (U/l)
ε: hệ số hấp thụ, ε610 = 4460 M-1cm-1
Vpu: Tổng thể tích phản ứng (5 ml)
VE: Thể tích enzyme (1 ml)
ODM: Giá trị OD đo đƣợc của mẫu thí nghiệm
ODC: Giá trị OD đo đƣợc của mẫu đối chứng
Df: Độ pha loãng


Phụ lục 7. Phƣơng pháp chiết dịch chiết từ đất ô nhiễm

Cân khoảng 10g đất nhiễm chất độc hóa học (1,5DN5) thu nhận từ sân bay
Đà Nẵng đã đƣợc làm khô vào bình tam giác, bổ sung 15g Na2SO4 để tiếp tục làm
khô mẫu. Sau khi mẫu khô hoàn toàn bổ sung 45ml dung môi Methanol : Toluen =
1 : 4 để chất độc khuếch tán ra ngoài, siêu âm mẫu đất 30 phút, đậy nắp và lắc 2 giờ
hoặc hơn, sau đó để lắng, ly tâm tách dịch, bổ sung H2 SO4 với tỉ lệ 1 : 1 về thể tích
so với tổng thể tích dung dịch trên để oxy hóa. Khi dung dịch tách làm hai pha thì
dùng phễu chiết để lấy pha trên và bảo quản trong lọ tối màu.



Phụ lục 8. Quy trình biến nạp DNA tái tổ hợp vào tế bào E. coli

Các bƣớc thực hiện theo quy trình và hóa chất của “PCR cloning kit” hãng
Fermentas.
Chuẩn bị tế bào khả biến và môi trường nuôi cấy:
Ngày trước biến nạp: Nuôi 1 khuẩn lạc vi khuẩn E.coli (bất kì chủng nào)
trong môi trƣờng C, lắc 37oC qua đêm.
Ngày biến nạp: Làm ấm môi trƣờng C trong tube ở 37oC ít nhất 20 phút và làm
ấm đĩa thạch LB có bổ sung kháng sinh ampicilin (100 µl/ml) ở 37oC ít nhất 20 phút
trƣớc khi gạt.

Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
109
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Quy trình biến nạp:
Bƣớc 1: Bổ sung 150 µl dịch nuôi qua đêm vào 1,5 ml môi trƣờng C đã làm
ấm. Lắc ở 37 oC trong 20 phút.
Bƣớc 2: Ly tâm 6000 vòng trong 4 phút ở 4 oC, loại dịch nổi
Bƣớc 3: Trộn đều tế bào trong 300 µl dung dịch T. Ủ 5 phút trong đá.
Bƣớc 4: Ly tâm 6000 vòng trong 4 phút ở 4 oC, loại dịch nổi
Bƣớc 5: Trộn đều tế bào trong 120 µl dung dịch T. Ủ 5 phút trong đá.
Bƣớc 6: Lấy 2,5 µl sản phẩm ligation vào ống mới làm lạnh trong đá 2 phút.
Bƣớc 7: Bổ sung 50 µl tế bào đã chuẩn bị vào ống chứa sản phẩm ligation trên,
ủ trong đá 5 phút
Bƣớc 8: Gạt ngay ra đĩa LB-ampicillin, có bổ sung thêm X-gal và IPTG. Ủ 37
o
C qua đêm.


Phụ lục 9. Hoạt tính laccase



Ảnh hƣởng của nhiệt độ

Nhiệt độ (oC) 28 30 37 42
Hoạt tính (U/l) 7 12.2 10.7 1.3




Ảnh hƣởng pH môi trƣờng nuôi cấy

2 3 4 5 6 7 8 9
pH
Hoạt tính 0 2.6 3.2 111.1 100 3.4 1.4 3.5
(U/l)




Ảnh hƣởngnồng độ NaCl

0 0.1 1 5 10
NaCl %
Hoạt tính 5.8 10.4 2.6 1.4 0.04
Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
110
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




(U/l)



Ảnh hƣởng của nồng độ DDT

50 100 200 300
DDT ppm
Hoạt tính (U/l) 7 6,6 7,1 6,8




Ảnh hƣởng của nồng độ glucose
2 3
Glucose % 0 0,1 0,5 1
Hoạt tính 0 7,5 6,5 6 0,2 0
(U/l)



Ảnh hƣởng của các chất cảm ứng
Chất cảm ứng guiaiacol veratyl alcohol CuSO4
Hoạt tính (U/l) 7,6 2,9 11



Ảnh hƣởng của chất hoạt động bề mặt
Nƣớc bồ kết
Chất hoạt động bề mặt Tween 80
1 ngày 2608,3 0,4
2 ngày 0,4 0,5
Hoạt tính (U/l)
4 ngày 6,5 3,8
6 ngày 4,8 3,1



Động thái sinh tổng hợp laccase

0 1 2 3 4 5 6 7 8 9 10
Ngày
Hoạt tính 0 2608,3 0,4 2,5 6,5 194,4 4,8 2,6 7,5 6,3 2,25
(U/l)


Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
111
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Ảnh hƣởng của nguồn carbon

Tinh bột
Carbon Glucose Saccharose lactose Khoai tây Cao malt Cellulose

Hoạt tính 8,6 22,2 1,8 4,3 3,7 1,1 3,3
(U/l)



Ảnh hƣởng của nguồn nitơ

Nitơ Cao thịt Đậu tƣơng
NaNO₃+KNO₃ NH₄NO₃
Cao men Urê
Hoạt tính
22,2 1,5 1,1 1,7 0,6 0,9
(U/l)




Môi trƣờng thay thế

Môi trƣờng MEG YS SG PG
Hoạt tính (U/l) 11,3 6,2 21,3 5,8



pH tối ƣu

5 4,5 4 3,5 3 2,5 2 1,5 1
pH
Hoạt tính 0,02 3,2 7,5 28,2 503,1 1552,8 2355,6 2802,8 1969,4
(U/l)



Nhiệt độ tối ƣu

Nhiệt độ (oC) 32 40 50 60 70 80 90
Hoạt tính 1354,2 1877,3 2532,4 2307,9 1289,3 914,4 905,1
(U/l)




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
112
Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học




Độ bền pH
1 2 3 4 5 6 7 8 9 10
pH
Hoạt tính 650 1075 1472 2100 1825 1416,7 1386 1425 1472 1425
(U/l)



Độ bền nhiệt

Nhiệt độ (oC) 50 60 80 90
10 phút 2508 2370.37 1333.333 1370.37

Hoạt tính 20 phút 2394 1958.333 1120.37 1212.963
(U/l)
40 phút 2453 1287.037 1263.889 1018.519
1259.259 1185.185 1074.074
60 phút 2409




Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn
113

Top Download Thạc Sĩ - Tiến Sĩ - Cao Học

Xem thêm »

Tài Liệu Thạc Sĩ - Tiến Sĩ - Cao học Mới Xem thêm » Tài Liệu mới cập nhật Xem thêm »

Đề thi vào lớp 10 môn Toán |  Đáp án đề thi tốt nghiệp |  Đề thi Đại học |  Đề thi thử đại học môn Hóa |  Mẫu đơn xin việc |  Bài tiểu luận mẫu |  Ôn thi cao học 2014 |  Nghiên cứu khoa học |  Lập kế hoạch kinh doanh |  Bảng cân đối kế toán |  Đề thi chứng chỉ Tin học |  Tư tưởng Hồ Chí Minh |  Đề thi chứng chỉ Tiếng anh
Theo dõi chúng tôi
Đồng bộ tài khoản