LUẬN VĂN TỐT NGHIỆP: " XÁC ĐỊNH ĐẶC ĐIỂM SINH HÓA VÀ KHẢ NĂNG KHÁNG THUỐC CỦA VI KHUẨN GÂY BỆNH MỦ GAN Edwardsiella ictaluri TRÊN CÁ TRA (Pangasianodon hypophthalmus) NUÔI THÂM CANH Ở MỘT SỐ TỈNH ĐỒNG BẰNG SÔNG CỬU LONG"

Chia sẻ: bandoctl

Với mục tiêu nghiên cứu của đề tài là tìm hiểu mức độ xuất hiện và tính kháng thuốc của vi khuẩn Edwardsiella ictaluri trên cá tra bệnh mủ gan nuôi thâm canh ở một số tỉnh Đồng Bằng Sông Cửu Long. Kết quả cho thấy vi khuẩn E. ictaluri xuất hiện hầu hết ở các vùng nuôi. Kết quả phân lập từ mẫu cá đã xác định được 84 chủng thuộc nhóm vi khuẩn Edwardsiella. Qua kiểm tra các chỉ tiêu cơ bản như nhuộm gram, tính di động, oxydase, catalase chọn ra 10 chủng để tiến hành định...

Bạn đang xem 20 trang mẫu tài liệu này, vui lòng download file gốc để xem toàn bộ.

Nội dung Text: LUẬN VĂN TỐT NGHIỆP: " XÁC ĐỊNH ĐẶC ĐIỂM SINH HÓA VÀ KHẢ NĂNG KHÁNG THUỐC CỦA VI KHUẨN GÂY BỆNH MỦ GAN Edwardsiella ictaluri TRÊN CÁ TRA (Pangasianodon hypophthalmus) NUÔI THÂM CANH Ở MỘT SỐ TỈNH ĐỒNG BẰNG SÔNG CỬU LONG"

TRƯỜNG ĐẠI HỌC CẦN THƠ
KHOA THỦY SẢN




PHẠM THỊ NGỌC XUÂN




XÁC ĐỊNH ĐẶC ĐIỂM SINH HÓA
VÀ KHẢ NĂNG KHÁNG THUỐC CỦA VI KHUẨN
GÂY BỆNH MỦ GAN Edwardsiella ictaluri TRÊN CÁ TRA
(Pangasianodon hypophthalmus) NUÔI THÂM CANH
Ở MỘT SỐ TỈNH ĐỒNG BẰNG SÔNG CỬU LONG




LUẬN VĂN TỐT NGHIỆP ĐẠI HỌC
NGÀNH BỆNH HỌC THỦY SẢN




Năm 2009




PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
TRƯỜNG ĐẠI HỌC CẦN THƠ
KHOA THỦY SẢN




PHẠM THỊ NGỌC XUÂN




XÁC ĐỊNH ĐẶC ĐIỂM SINH HÓA
VÀ KHẢ NĂNG KHÁNG THUỐC CỦA VI KHUẨN
GÂY BỆNH MỦ GAN Edwardsiella ictaluri TRÊN CÁ TRA
(Pangasianodon hypophthalmus) NUÔI THÂM CANH
Ở MỘT SỐ TỈNH ĐỒNG BẰNG SÔNG CỬU LONG




LUẬN VĂN TỐT NGHIỆP ĐẠI HỌC
NGÀNH BỆNH HỌC THỦY SẢN




CÁN BỘ HƯỚNG DẪN

NGUYỄN THỊ THU HẰNG
ĐẶNG THỊ HOÀNG OANH




Năm 2009




PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
LỜI CẢM TẠ

Hôm nay, để có thể hoàn thành được luận văn này, tôi đã phải trải qua một quá
trình dài học tập và rèn luyện tại trường. Tuy nhiên gia đình là nhân tố quan
trọng nhất giúp tôi hoàn thành mọi việc. Bên cạnh đó, thầy cô và bạn bè cũng
góp phần không nhỏ trong sự thành công của tôi. Vì vậy hôm nay tôi xin gửi
lòng biết ơn đến:

- Ba Mẹ và toàn thể gia đình tôi-những người luôn ở bên tôi, động viên và
chăm sóc tôi từ vật chất đến tinh thần, giúp tôi có đủ sức mạnh vượt qua
tất cả!

- Lòng biết ơn sâu sắc tôi xin gửi đến cô Nguyễn Thị Thu Hằng và cô Đặng
Thị Hoàng Oanh đã tạo mọi điều kiện thuận lợi cho tôi hoàn thành tốt luận
văn này!

- Xin gửi lòng biết ơn chân thành đến cô Trần Thị Tuyết Hoa, cô Đặng
Thụy Mai Thy và cô Bùi Thị Bích Hằng đã quan tâm, động viên tôi trong
suốt thời gian làm cố vấn học tập!

- Xin gửi lời cảm ơn đến chị Nguyễn Hà Giang, anh Lê Hữu Thôi cùng tất
cả các thầy cô và các anh chị trong khoa Thủy Sản đã động viên và giúp
đỡ tôi trong suốt quá trình thực hiện đề tài!

- Lòng chân thành biết ơn tôi xin gửi đến các cô chú và anh chị ở các địa
phương đã nhiệt tình giúp tôi trong quá trình thu m ẫu!

- Lòng tri ân tôi xin gửi đến tất cả các Thầy Cô đã từng dạy dỗ tôi trong
suốt thời gian tôi theo học tại trường tiểu học Trương Định, trường trung
học cơ sở cấp II Thanh Đức A, trường trung học phổ thông Lưu Văn Liệt-
tỉnh Vĩnh Long và trường Đại học Cần Thơ!

- Đồng thời, tôi cũng xin gửi lòng biết ơn đến tập thể các bạn lớp Bệnh Học
Thủy Sản khoá 31 và tất cả những người bạn đã luôn ở bên cạnh tôi với sự
chia sẻ, những lời động viên và lời khuyên chân thành!

Và một lần nữa tôi xin gửi đến tất cả những người thân yêu, thầy cô, bạn
bè…những người đã góp phần mang đến cho tôi sự thành công cùng những
hương vị của cuộc sống này lời cảm ơn chân thành nhất!!!

Tác giả

Xin chân thành cảm ơn!!!




i

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
TÓM TẮT

Với mục tiêu nghiên cứu của đề tài là tìm hiểu mức độ xuất hiện và tính kháng
thuốc của vi khuẩn Edwardsiella ictaluri trên cá tra bệnh mủ gan nuôi thâm
canh ở một số tỉnh Đồng Bằng Sông Cửu Long. Kết quả cho thấy vi khuẩn E.
ictaluri xuất hiện hầu hết ở các vùng nuôi. Kết quả phân lập từ mẫu cá đã xác
định được 84 chủng thuộc nhóm vi khuẩn Edwardsiella. Qua kiểm tra các chỉ
tiêu cơ bản như nhuộm gram, tính di động, oxydase, catalase chọn ra 10 chủng
để tiến hành định danh theo phương pháp truyền thống và kit API 20E được cả
10 chủng đều là E. ictaluri. Tuy nhiên kết quả kiểm tra API lại sai khác đối
với một số chỉ tiêu (citrate, indole).

Kết quả chạy PCR một lần nữa khẳng định cả 10 chủng vi khuẩn đều là E.
ictaluri khi tất cả đều hiện vạch sáng ở 407 bp.

Kháng sinh đồ được thực hiện trên cả 10 chủng vi khuẩn E. ictaluri với 8 loại
thuốc kháng sinh. Kết quả là 100% vi khuẩn kháng hoàn toàn với S
(streptomycin) và OA (oxolinic acid), 100% vi khuẩn kháng với FFC
(florfenicol), vi khuẩn nhạy nhất với AMX (amoxycillin). Riêng với DO
(doxycycline) có 80% số chủng nhạy, 10% số chủng trung bình nhạy và 10%
số chủng kháng. Nhìn chung trong tất cả 10 chủng thì chỉ có chủng CA4.4G
đa kháng với cả S, OA, FFC và DO.

Nồng độ ức chế tối thiểu (MIC) trên kháng sinh streptomycin đối với 2 chủng
vi khuẩn đã phân lập ở trên, kết quả cho thấy vi khuẩn E. ictaluri kháng với
streptomycin ở mức thấp (2-4 µg/ml).




ii

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
MỤC LỤC

PHẦN I: GIỚI THIỆU...................................................................................1
PHẦN II: LƯỢC KHẢO TÀI LIỆU ..............................................................3
2.1 Tình hình nuôi cá tra ................................................................................3
2.2 Bệnh vi khuẩn trên cá ..............................................................................3
2.3 Bệnh do vi khuẩn E. ictaluri ....................................................................4
2.3.1 Tình hình bệnh do vi khuẩn E. ictaluri trên thế giới ..............................4
2.3.2 Tình hình bệnh do vi khuẩn E. ictaluri ở Việt Nam ...............................5
2.3.3 Đặc điểm hình thái, sinh lý và sinh hóa của vi khuẩn E. ictaluri ...........6
2.3.4 Một số cơ quan thường bị E. ictaluri tấn công.......................................6
2.4 Một số nghiên cứu khác trên vi khuẩn E. ictaluri ....................................7
2.5 Tình hình sử dụng thuốc thú y thủy sản....................................................7
2.6 Phương pháp PCR ...................................................................................9
2.6.1 Các nhân tố ảnh hưởng đến phản ứng PCR ...........................................9
2.6.2 Ưu và nhược điểm của phương pháp PCR........................................... 10
2.7 Các nghiên cứu về nồng độ ức chế tối thiểu (MIC) ................................ 10
PHẦN III: VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU ..................... 12
3.1 Thời gian và địa điểm nghiên cứu .......................................................... 12
3.1.1 Thời gian nghiên cứu .......................................................................... 12
3.1.2 Địa điểm nghiên cứu ........................................................................... 12
3.1.3 Đối tượng nghiên cứu ......................................................................... 12
3.2 Vật liệu nghiên cứu ................................................................................ 12
3.2.1 Dụng cụ thí nghiệm............................................................................. 12
3.2.2 Hóa chất và môi trường....................................................................... 12
3.2.2.1 Hóa chất........................................................................................... 12
3.2.2.2 Môi trường ....................................................................................... 12
3.3 Phương pháp nghiên cứu........................................................................ 13
3.3.1 Phương pháp thu mẫu ......................................................................... 13
3.3.2 Phương pháp lấy mẫu vi sinh .............................................................. 13


iii

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
3.3.3 Tách ròng mẻ cấy................................................................................ 14
3.3.4 Định danh vi khuẩn theo phương pháp truyền thống ........................... 14
3.3.5 Định danh vi khuẩn bằng bộ Kit API 20E ........................................... 14
3.3.6 Phương pháp PCR............................................................................... 14
3.3.7 Phương pháp lập kháng sinh đồ .......................................................... 16
3.3.8 Phương pháp xác định MIC ................................................................ 16
3.4 Phương pháp xử lý số liệu...................................................................... 17
PHẦN IV: KẾT QUẢ VÀ THẢO LUẬN .................................................... 18
4.1 Kết quả phân lập và định danh vi khuẩn................................................. 18
4.1.1 Kết quả phân lập vi khuẩn ................................................................... 18
4.1.2 Kết quả định danh vi khuẩn theo phương pháp truyền thống ............... 18
4.1.3 Kết quả định danh vi khuẩn bằng bộ Kit API 20E ............................... 20
4.2 Kết quả định danh vi khuẩn bằng phương pháp PCR ............................. 22
4.3 Kết quả kháng sinh đồ............................................................................ 23
4.4 Kết quả MIC .......................................................................................... 25
PHẦN V: KẾT LUẬN VÀ ĐỀ XUẤT ........................................................ 27
5.1 Kết luận ................................................................................................. 27
5.2 Đề xuất .................................................................................................. 27
TÀI LIỆU THAM KHẢO ........................................................................... 28
PHỤ LỤC.................................................................................................... 33




iv

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
DANH SÁCH BẢNG

Bảng 3.1: Thành phần hóa chất tham gia vào phản ứng khuếch đại của qui
trình phát hiện vi khuẩn E. ictaluri .............................................................. 15
Bảng 3.2: Giới hạn xác định mức độ kháng, trung bình nhạy và nhạy của các
loại kháng sinh theo đường kính chuẩn trung bình của công ty Bio-rad ....... 16
Bảng 4.1 Các chỉ tiêu hình thái, sinh lý và sinh hóa của vi khuẩn E. ictaluri
bằng phương pháp truyền thống................................................................... 19
Bảng 4.2 Kết quả phân tích các chỉ tiêu hình thái, sinh lý và sinh hoá của các
chủng vi khuẩn bằng bộ Kit API 20E........................................................... 21
Bảng 4.3 Hàm lượng DNA chiết tách ......................................................... 22
Bảng 4.4 Kết quả kháng sinh đồ của các chủng vi khuẩn E. ictaluri ........... 24
Bảng 4.5 Giá trị MIC của thuốc kháng sinh streptomycin trên 2 chủng vi
khuẩn E. ictaluri ......................................................................................... 25
Bảng 3.3 Bảng kiểm tra kết quả test O/F ...................................................... 34
Bảng 3.4 Các chỉ tiêu định danh E. ictaluri bằng phương pháp sinh hóa truyền
thống ........................................................................................................... 37
Bảng 3.5 Cách đọc kết quả bộ Kit API 20E ................................................. 39
Bảng 4.5 Dấu hiệu bên trong và bên ngoài của các mẫu cá .......................... 40




v

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
DANH SÁCH HÌNH

Hình 4.1 Đĩa cấy thuần (A), Vi khuẩn E. ictaluri Gram âm, hình que ngắn (B)
.................................................................................................................... 18
Hình 4.2 Khả năng sử dụng các loại đường (A), Các chỉ tiêu sinh hóa thuyền
thống (B) ..................................................................................................... 19
Hình 4.3 Kết quả kiểm tra vi khuẩn E. ictaluri trên Kit API 20E ................. 20
Hình 4.4 Kết quả chạy PCR phát hiện E. ictaluri ........................................ 23
Hình 4.5 Kết quả kháng sinh đồ trên vi khuẩn E. ictaluri ............................ 24
Hình 4.6 Kết quả MIC của vi khuẩn E. ictaluri ........................................... 25




vi

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
PHẦN I
GIỚI THIỆU

Đồng Bằng Sông Cửu Long là một trong 7 vùng kinh tế trọng điểm nằm ở
phía Nam của đất nước, có diện tích gần 4 triệu ha, chiếm khoảng 12% tổng
diện tích cả nước. Đây là vùng hạ lưu châu thổ sông Mekong, được xem là
vùng trù phú nhất, không chỉ của Việt Nam mà của cả khu vực Đông Nam Á.
Đồng thời đây cũng là vùng nuôi trồng thủy sản lớn nhất của cả nước, diện
tích nuôi trồng thủy sản chiếm khoảng 60% với sản lượng chiếm khoảng 65%
và giá trị xuất khẩu thủy sản chiếm 51% (Dương Nhựt Long, 2003). Mười
tháng đầu năm 2008, xuất khẩu thủy sản của cả nước đạt 1.054.600 tấn, trị giá
3.828 tỷ USD, tăng 39,4% về lượng và 24,4% về giá trị so với cùng kỳ năm
2007. Trong đó mặt hàng chủ lực là cá tra và cá basa đạt mức tăng trưởng cao
nhất (http://www.fistenet.gov.vn/).
Để đạt được những kết quả như thế đòi hỏi sự gia tăng cả về số lượng lẫn chất
lượng của sản phẩm vì vậy diện tích cũng như mật độ nuôi ngày càng được
nâng cao, kết quả là những năm gần đây, tình hình bệnh xuất hiện trên động
vật thủy sản ngày càng nhiều đã đến mức báo động. Một trong số những bệnh
đang được quan tâm hàng đầu đó là bệnh mủ gan đã gây thiệt hại không nhỏ
về kinh tế cho nhiều hộ nuôi. Ngày nay bệnh mủ gan vẫn đang là mối quan
tâm hàng đầu cho những ai đang và sẽ nuôi cá tra thâm canh ở khu vực
ĐBSCL. Theo Hawke (1981), Từ Thanh Dung (2004) cho rằng vi khuẩn E.
ictaluri thuộc họ Enterobacteriaceae, là vi khuẩn Gram âm, hình que, phản
ứng âm tính với oxidase và dương tính với catalase, không có khả năng sinh
H2S và Indole. Trên môi trường TSA ở 28oC sau 48 giờ vi khuẩn phát triển
thành những khuẩn lạc nhỏ, tròn, màu trắng, có rìa không đồng nhất.
Nhiều nghiên cứu trước đây đã xác định tác nhân gây bệnh mủ gan là do vi
khuẩn Edwardsiella ictaluri gây ra, bệnh thường xảy ra trên cá tra nuôi thâm
canh ở tất cả các giai đoạn, tỉ lệ hao hụt từ 10% cao nhất có thể lên đến 90%
(Nguyễn Quốc Thịnh và ctv, 2003; Crumlish, 2001; Từ Thanh Dung, 2004;
Shotts et al., 1986).
Cùng với sự xuất hiện vi khuẩn Edwardsiella ictaluri gây bệnh mủ gan thì
nhiều nghiên cứu về kháng sinh phòng trị bệnh do Edwardsiella ictaluri cũng
được tiến hành để góp phần khắc phục tình hình dịch bệnh do vi khuẩn gây ra
trên cá tra. Theo nghiên cứu của Từ Thanh Dung và ctv (2005) đã nghiên cứu
và cho rằng bệnh này có thể khống chế bằng nhóm kháng sinh quinolon
(flumequin, oxolinic acid, enrofloxacin) nhưng ngày nay nhóm kháng sinh này


1

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
đã bị cấm sử dụng. Mặc khác, theo kết quả điều tra của Nguyễn Quốc Thịnh
(2006) đa số người dân nuôi cá thường sử dụng kháng sinh để phòng trị bệnh.
Tuy nhiên, một bộ phận không nhỏ người nuôi chưa nắm bắt tốt kỹ thuật nuôi
và việc quản lý sức khỏe của động vật thủy sản trong ao nuôi cũng như những
hiểu biết về thuốc kháng sinh còn nhiều hạn chế, liều lượng và thời gian sử
dụng không phù hợp dẫn đến sự gia tăng hiện tượng kháng thuốc kháng sinh
của một số giống loài vi khuẩn nên việc phòng trị kém hiệu quả gây nhiều tổn
thất to lớn về kinh tế và ảnh hưởng không nhỏ đến môi trường sinh thái cũng
như sức khỏe con người.
Vì vậy, đề tài “Xác định đặc điểm sinh hoá và khả năng kháng thuốc của
vi khuẩn gây bệnh mủ gan Edwardsiella ictaluri trên cá tra
(Pangasianodon hypophthalmus) nuôi thâm canh ở một số tỉnh Đồng
Bằng Sông Cửu Long” được thực hiện nhằm đánh giá tình hình bệnh mủ gan
ở một số tỉnh Đồng Bằng Sông Cửu Long cũng như sự kháng thuốc của các
chủng vi khuẩn này để có biện pháp hợp lý trong quá trình nuôi cũng như
quản lý dịch bệnh trong khu vực góp phần bảo vệ môi trường sinh thái.
Mục tiêu của đề tài:
Tìm hiểu mức độ xuất hiện và tính kháng thuốc của vi khuẩn Edwardsiella
ictaluri trên cá tra bệnh mủ gan.
Nội dung nghiên cứu của đề tài:
Phân lập vi khuẩn Edwardsiella ictaluri gây bệnh mủ gan trên cá tra.
Định danh vi khuẩn Edwardsiella ictaluri bằng phương pháp truyền thống và
phương pháp PCR (Polymerase Chain Reaction).
Lập kháng sinh đồ và xác định nồng độ ức chế tối thiểu (MIC) của vi khuẩn
Edwardsiella ictaluri với một số loại thuốc kháng sinh.




2

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
PHẦN II
LƯỢC KHẢO TÀI LIỆU

2.1 Tình hình nuôi cá tra

Cá tra (Pangasianodon hypophthalmus), trước đây còn có tên là Pangasius
hypophthalmus, P. micronemus hay P. Sutchi (Nguyễn Văn Kiểm, 2004), là
loài cá được nuôi hầu hết ở các nước Đông Nam Á và là loài cá nuôi quan
trọng nhất trong khu vực này. Ở Campuchia, sản lượng nuôi cá tra chiếm bằng
một nửa sản lượng các loài cá nuôi, trong đó tỷ lệ cá tra chiếm 98% trong 3
loài thuộc họ cá tra, chỉ có 2% là cá basa và cá vồ đém. Tại Thái Lan, nước
đầu tiên thành công trong việc sinh sản nhân tạo cá tra vào năm 1966 có sản
lượng cá tra nuôi chỉ đứng sau cá rô phi, đến năm 1970 đã chủ động cung cấp
giống cho nghề nuôi cá tra trong nước.
Cá tra là một loài cá nuôi truyền thống trong ao của nông dân các tỉnh Đồng
Bằng Sông Cửu Long (ĐBSCL). Ngoài tự nhiên, cá tra phân bố ở lưu vực
sông MeKong, có mặt ở cả 4 nước: Việt Nam, Lào, Campuchia, Thái Lan
(Nguyễn Văn Kiểm, 2004). Cá sống đựơc ở mọi tầng nước, thường sống được
ở các thủy vực nước tĩnh, nước chảy, chịu đựng được điều kiện khắc nghiệt
của môi trường. Cá sống chủ yếu ở môi trường nước ngọt tuy nhiên cá vẫn có
thể sống và phát triển ở môi trường nước lợ (ao nuôi tôm sú vào mùa mưa).
(http://www.bentre.gov.vn/).
Khi ngành nuôi trồng thủy sản đã phát triển, nhiều đối tượng có giá trị kinh tế
được đưa vào nuôi, các hình thức nuôi công nghiệp như thâm canh, siêu thâm
canh được áp dụng phổ biến. Sự đầu tư lớn về giống, thức ăn và năng suất cao
luôn là điều kiện tiềm ẩn nguy cơ bùng nổ dịch bệnh. Do vậy, khi nuôi trồng
thủy sản càng phát triển thì vấn đề dịch bệnh càng trở nên thường xuyên, đe
dọa ngành nuôi trồng thủy sản, gây những thiệt hại lớn và đôi khi bệnh đã trở
thành nhân tố quyết định thắng thua trong một đợt sản xuất (Đỗ Thị Hòa và
ctv, 2004).

2.2 Bệnh vi khuẩn trên cá

Bệnh là những biến đổi bất thường của cơ thể sinh vật với những biến đổi xấu
của môi trường xung quanh, cơ thể nào thích ứng được thì tồn tại, không thích
ứng được thì chết. Hay nói cách khác bất cứ một sự thay đổi trạng thái nào đó
của cơ thể hoặc một cơ quan nào ảnh hưởng đến chức năng sinh lý của cơ thể
sinh vật gọi là bệnh (Từ Thanh Dung, 2005). Bệnh cá luôn được xem là một
trong những tác nhân gây hao hụt trong nghề nuôi thủy sản trên thế giới và
Việt Nam. Tác nhân gây bệnh và mức độ gây thiệt hại cũng rất đa dạng và
phụ thuộc vào đối tượng nuôi khác nhau. Bệnh nấm, ký sinh trùng, vi
khuẩn,…là những tác nhân gây bệnh thường gặp trong nghề nuôi cá nước
ngọt (Bùi Quang Tề, 1993).

Theo Đỗ Thị Hòa và ctv (2004) thì khi động vật thủy sản bị bệnh thường có
những biểu hiện như: trạng thái hoạt động không bình thường, không giữ


3

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
được thăng bằng, nổi đầu, dạt vào bờ, quay vòng trên mặt nước, kén hoặc bỏ
ăn, có sự biến đổi màu sắc một bộ phận hay toàn bộ cơ thể kèm theo những
dấu hiệu chậm lớn, yếu và chết. Nếu các hoạt động sống bị rối loạn phá hủy
một hay nhiều cơ quan quan trọng như hô hấp, tiêu hóa, tuần hoàn, thần
kinh…thì bệnh xảy ra nặng và động vật bị bệnh có thể chết.

Qua thống kê của Lê Xuân Sinh (2006) cho thấy bệnh mủ gan trên cá tra xuất
hiện nhiều nhất (82,1%), bệnh xuất huyết (63,4%), bệnh do ký sinh trùng
(32,0%). Ngoài ra, còn có một số bệnh nguy hiểm khác nhưng xuất hiện với
tần số thấp hơn như: bệnh vàng da (12,2%), bệnh đường ruột (11,5%), bệnh
lồi mắt (11,4%), bệnh tuột nhớt (10,0%), bệnh lở loét (3,1%),…
Gần đây, theo điều tra của Nguyễn Tấn Duy Phong (2008) cho thấy bệnh gan
thận mủ xuất hiện với tần số cao nhất (93,8%), tiếp theo đó là bệnh xuất huyết
(75%), bệnh trắng gan trắng mang (68,8%). Như vậy, thấy rằng bệnh gan thận
mủ do vi khuẩn Edwardsiella ictaluri gây ra đang là mối đe dọa lớn nhất cho
người nuôi cá tra hiện nay.

2.3 Bệnh do vi khuẩn Edwardsiella ictaluri

2.3.1 Tình hình bệnh do vi khuẩn E. ictaluri trên thế giới

Vi khuẩn E. ictaluri gây bệnh xuất huyết được phân lập lần đầu tiên trên cá
nheo Mỹ (Ictalurus puntatus) bởi Hawke (1979) với tên gọi là ESC (Enteric
Septicaemia of Catfish).
Vi khuẩn E. ictaluri kén chọn vật chủ nhạy cảm hơn nhiều so với E. tarda và
gây thiệt hại đáng kể trên cá trơn. Bệnh do vi khuẩn E. ictaluri gây ra được
tìm thấy ở loài Ictalurus punctatus (Hawke, 1979) còn có hai loài khác như
Ictalurus purcatus và Ictalurus catus (Plumb and Sanchez, 1983), Clarias
batrachus (Kasornchandra et al., 1987) ở Thái Lan.
Năm 1985, Boonyaratpalin cũng đã phát hiện E. ictaluri gây bệnh trên cá trê
trắng (Clarias batrachus) và trong môi trường nước ở Thái Lan (Trích dẫn bởi
Từ Thanh Dung, 2004)
Ngoài ra, mầm bệnh này cũng được công bố ở hầu hết Bắc Mỹ và các tiểu
bang khác như Indiana, Idaho, California, Arizona và New Mexico (Inglis et
al., 1994). Năm 1976, Hawke đã phân lập được vi khuẩn E. ictaluri trên cá
nheo sông nâu (Ictalurus nebulosus). Bên cạnh đó vi khuẩn E. ictaluri còn
được báo cáo trên cá dao xanh (Eigemannia virens) (Kent & Lyons, 1982), cá
nheo xanh (Ictalurus furcatus) (Plumb & Sanchez, 1983), cá trê trắng (Clarias
batrachus) (Kasornchandra, 1987). Vi khuẩn này cũng được Crumlish (2001)
và Bùi Quang Tề (2003) phân lập được trên cá tra nuôi (Pangasius
hypophthalmus).




4

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
2.3.2 Tình hình bệnh do vi khuẩn E. ictaluri ở Việt Nam

Bệnh trắng gan hay còn gọi là bệnh mủ gan được ghi nhận lần đầu tiên xuất
hiện trên cá tra nuôi ở ĐBSCL vào cuối năm 1998 với tên gọi BNP (Bacillary
Necrosis of Pangasius) và trở nên trầm trọng vào năm 1999 (Ferguson et al.,
2001) .
Theo Brown và Cratzek (1980) bệnh do vi khuẩn thường xuất hiện vào mùa
nước ấm và sốc giữ vai trò quan trọng trong các bệnh do vi khuẩn, ký sinh
trùng. Vi khuẩn xâm nhập vào cơ thể ký chủ tạo nên sự nhiễm khuẩn hay
không còn tùy thuộc vào khả năng gây bệnh của vi khuẩn. Như vậy, tùy thuộc
vào số lượng vi khuẩn và độc lực của vi khuẩn. Cũng theo tác giả, mật độ
ương nuôi cao sẽ làm tăng khả năng tiếp xúc giữa ký chủ và mầm bệnh. Đồng
thời, cũng tạo điều kiện cho mầm bệnh tăng nhanh trong một nhóm cá. Do đó
tình hình dịch bệnh ngày càng tăng với nhiều dạng bệnh khác nhau và nguyên
nhân gây bệnh ngày càng phức tạp hơn.
Theo Từ Thanh Dung (2004) khi cá nhiễm bệnh, tỉ lệ chết tăng cao từ 10-90%
tùy thuộc vào cách quản lý và cỡ cá nuôi. Đồng thời trên gan, thận và tỳ tạng
xuất hiện nhiều đốm trắng đường kính 1-3 mm, bên trong chứa dịch màu trắng
đục nên người dân thường gọi là bệnh mủ gan, không có những biểu hiện bất
thường bên ngoài.
Ở giai đoạn mới chớm bệnh cá vẫn bắt mồi. Tuy nhiên, một số trường hợp cá
có biểu hiện gầy, bơi lờ đờ, da nhợt nhạt, có hiện tượng xuất huyết trên da và
hậu môn. Bệnh thường xuất hiện vào mùa lũ cao điểm là vào tháng 7 và tháng
8. Những khu vực bị ảnh hưởng chủ yếu là những vùng có nghề nuôi cá tra
phát triển mạnh như An Giang, Đồng Tháp, Cần Thơ (huyện Thốt Nốt, Phụng
Hiệp) và sau đó lan dần ra các tỉnh lân cận như Trà Vinh, Bến tre, Vĩnh Long,
Tiền Giang,... (Từ Thanh Dung, 2004).
Bệnh gây ảnh hưởng đáng kể trên cá tra ở giai đoạn cá giống và cá lứa với tỉ
lệ chết rất cao (60-80%) và nó còn kéo dài đến giai đoạn cá thịt với tỷ lệ chết
thấp hơn (Lê Thị Bé Năm, 2002).
Phan Thị Mỹ Hạnh (2004) đã tiến hành thí nghiệm một số yếu tố ảnh hưởng
đến bệnh mủ gan do vi khuẩn E. ictaluri gây ra trên cá tra ở ĐBSCL đã đưa ra
kết luận rằng mật độ vi khuẩn khác nhau sẽ ảnh hưởng khác nhau đến khả
năng nhiễm bệnh mủ gan trên cá tra. Khi ngâm cá với mật độ vi khuẩn là 1,5
x 102 và 1,5 x 103 CFU/ml thì tỉ lệ chết dao động từ 56,6-56,7%.
Theo Từ Thanh Dung và ctv (2004) ở Việt Nam, bệnh mủ gan chủ yếu xuất
hiện trên cá tra (ở tất cả các giai đoạn phát triển). Thỉnh thoảng xuất hiện trên
cá basa. Tỉ lệ hao hụt lớn ở cá tra giống, nhưng gây thiệt hại về kinh tế lớn
nhất ở giai đoạn cá tra thịt cỡ 300-500 g.
Bệnh mủ gan xuất hiện phụ thuộc vào điều kiện nhiệt độ. Ở Việt Nam, nhiệt
độ nước dao động từ 26-28oC (Trương Quốc Phú, 2004) là điều kiện thích hợp
cho vi khuẩn mủ gan phát triển. Sự thay đổi của môi trường và nguồn nước ô
nhiễm có ảnh hưởng lớn đến tần số xuất hiện của bệnh. Thường đến mùa lũ
nước mang nhiều phù sa, chất lượng nước thay đổi làm sức khỏe cá giảm dẫn


5

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
đến sức đề kháng của chúng kém tạo điều kiện cho mầm bệnh dễ dàng xâm
nhập và nhanh chóng bộc phát thành bệnh. Trong một vụ nuôi bệnh mủ gan
có thể xuất hiện 3-4 lần.
Tuy nhiên, tác động từ việc nuôi cá tra và cá basa đến môi trường nước và hệ
sinh thái đang ngày càng trở nên nghiêm trọng, đe dọa sự phát triển bền vững
của nghề nuôi cá. Thức ăn dư thừa trong quá trình nuôi, các hóa chất vệ sinh
cải tạo ao nuôi, chế phẩm sinh học, thuốc kháng sinh,…là nguyên nhân chính
gây ô nhiễm môi trường. Đồng thời, việc lạm dụng kháng sinh và thuốc thú y
thủy sản làm cho sản phẩm cá tra và cá basa gặp khá nhiều khó khăn trong
vấn đề xuất khẩu, ngoài ra còn gây ảnh hưởng đến sức khỏe con người.

2.3.3 Đặc điểm hình thái, sinh lý và sinh hóa của vi khuẩn E. ictaluri

Vi khuẩn E. ictaluri được mô tả đầu tiên bởi Hawke et al., (1981) là vi khuẩn
thuộc họ Enterobacteriaceae, vi khuẩn gram âm, hình que ngắn, kích thước
khoảng 0,75x1,5-2,5µm, di động ở 25-30°C và di động yếu hoặc không di
động khi nhiệt độ cao hơn 30°C.
Năm 1986, Shotts et al., tiếp tục nghiên cứu về đặc điểm sinh hoá của vi
khuẩn E. ictaluri, ngoài các đặc điểm trên thì vi khuẩn này còn cho phản ứng
cytochrome, oxidase âm tính, có khả năng lên men glucose và sinh sản phẩm
NO3- từ NO2-.
Vi khuẩn E. ictaluri phát triển trên môi trường thạch rất chậm, trên môi trường
TSA sau 48 giờ ở 28°C hình thành khuẩn lạc nhỏ, tròn, có màu trắng trong
(Plumb, 1999). Theo Từ Thanh Dung và ctv (2005) E. ictaluri là vi khuẩn
thuộc họ Enterobacteriaceae, gram âm hình que ngắn, kích thước biến đổi
0,75x1,5-2,5µm, cho phản ứng oxidase âm tính và catalase dương tính, phản
ứng indole và H2S âm tính, di động yếu ở 25-30oC nhưng không di động ở
những nhiệt độ cao hơn. Loài vi khuẩn này phát triển tốt ở 28oC sau 24-48 giờ
tạo thành những khuẩn lạc có kích thước rất nhỏ.
Vi khuẩn E. ictaluri chỉ thích hợp với điều kiện nhiệt độ khoảng 18-28oC.
(Plumb, 1999). Do đó bệnh do vi khuẩn E. ictaluri xảy ra trên cá trơn rơi vào
mùa có nhiệt độ thấp. Trên cá nheo, bệnh ESC thường xảy ra vào cuối mùa
xuân đến đầu mùa hè và trong suốt mùa thu, khi nhiệt độ nước khoảng 18-
28oC (Plumb, 1999). Trong điều kiện thí nghiệm gây cảm nhiễm trên cá nheo
giống thì ở 25oC cho tỉ lệ cá chết cao nhất, thấp nhất ở các nghiệm thức có
nhiệt độ 23oC và 28oC, không có cá chết ở các nhiệt độ 17oC, 21oC và 32oC
(Francis-Floy et al., 1987)

2.3.4 Một số cơ quan thường bị E. ictaluri tấn công

Mygolomba và Plumb (1992) đã phân lập vi khuẩn E. ictaluri trên cá nheo Mỹ
trong máu và tại các cơ quan khác như thận trước, thận sau, não, tỳ tạng,
buồng trứng, tuyến tụy và cơ.
Ở Việt Nam, Từ Thanh Dung và ctv (2005) đã phân lập được vi khuẩn E.
ictaluri trên các cơ quan thận, gan và tỳ tạng của cá tra.


6

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Ngoài ra, Lương Trần Thục Đoan (2006) sau khi gây cảm nhiễm thấy rằng vi
khuẩn E. ictaluri xuất hiện ở các cơ quan máu, não, cơ tim, gan, mang, thận,
tỳ tạng và bóng hơi.
Theo Nguyễn Quốc Thịnh (2002) cho rằng khi cá bệnh mủ gan cấu trúc vi thể
của thận bị hủy hoại trầm trọng, xảy ra các phản ứng sưng viêm ở toàn bộ tổ
chức. Thận sưng to đồng thời bị nhủn do xung huyết một phần có thể do tích
tụ nước trong thận mà không thể đào thải được do hệ thống tiểu cầu thận và
ống thận bị hư hại.
Theo Từ Thanh Dung & ctv (2004) thì cá bị bệnh thường không có biểu hiện
bất thường bên ngoài ở giai đoạn chớm bệnh. Tuy nhiên khi bệnh nặng cá gầy,
bơi lờ đờ, da nhợt nhạt, cá có hiện tượng xuất huyết ở da và hậu môn. Bên
trong, các nội quan gan, thận, tỳ tạng xuất hiện những đóm trắng có đường
kính 1-3 mm, các cơ quan này sưng to và có hiện tượng nhủn ở thận, xoang
nội quan có dịch lỏng đục màu đỏ, đôi khi có màu vàng.

2.4 Một số nghiên cứu khác trên vi khuẩn E. ictaluri

Theo Hawke (1981), Plumb và Sanchez (1983) vi khuẩn E. ictaluri còn có
khả năng gây bệnh trên một số nhóm cá da trơn khác như cá nheo xanh
(Ictalurus furcatus) và cá nheo (Ictalurus catus).
Những nghiên cứu trước đây ghi nhận rằng bệnh chỉ xuất hiện trên cá tra,
không tìm thấy bệnh trên cá basa. Nguyên nhân được Ferguson et al., (2001)
cho rằng đó là kết quả của sự khác biệt về tính nhạy cảm của loài.
Vi khuẩn E. ictaluri còn gây bệnh trên một số loài cá trong điều kiện thí
nghiệm như Chinook salmon Oncarhynchus tshauytscha và Rainbow trout
Oncarhynchus mykiss (Baxa et al., 1990)
Theo Cedric và Zilong (2003) cũng phân lập vi khuẩn E. ictaluri trên cá tra
nuôi bè ở Việt Nam, với dấu hiệu có nhiều nốt trắng trên gan
Theo Plumb (1999), khuẩn lạc phát triển trên môi trường thạch rất chậm, trên
môi trường TSA sau 48 giờ ở 28oC hình thành khuẩn lạc nhỏ, tròn, màu trắng
đục. Môi trường đặc trưng là EIA (Edwardsiella ictaluri agar).
Tuy nhiên, theo Từ Thanh Dung và ctv (2004) cho rằng vi khuẩn E. ictaluri
phân lập từ cá tra có một số đặc điểm khác so với mô tả của Plumb (1993) như
có dạng que và kích thước biến đổi, phát triển tốt ở 28oC và phát triển yếu ở
37oC. Dựa vào đó ta có thể giải thích tại sao vi khuẩn E. ictaluri cho tới nay
chỉ phát hiện trên cá mà chưa tìm được trên bất kỳ một loài động vật máu
nóng nào khác như chim, gia súc, heo, hay động vật hữu nhủ ở biển.

2.5 Tình hình sử dụng thuốc thú y thủy sản

Theo Gesamp (2001) thì thuốc hóa chất dùng trong nuôi trồng thủy sản bao
gồm các loại liên quan đến vật tư công trình, xử lý đất và nước, tác nhân
kháng khuẩn, thuốc trị bệnh, thuốc trừ sâu, thuốc gây tê và hormon.



7

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Kháng sinh là các chất hữu cơ có cấu tạo phức tạp, có nguồn gốc sinh học hay
do con người tạo nên, có tác động một cách chuyên biệt trên một giai đoạn
chính yếu của sự biến dưỡng của các vi khuẩn (tác nhân kháng khuẩn), của
các nấm (tác nhân kháng nấm), của các vi rút (tác nhân kháng vi rút) (Lê Thị
Kim Liên và Nguyễn Quốc Thịnh, 2006).
Có nhiều phương pháp đưa thuốc và hóa chất vào cơ thể động vật thủy sản
không chỉ qua đường miệng bằng cách trộn vào thức ăn mà còn bằng phương
pháp ngâm hoặc tắm. Theo FAO (2005) sử dụng kháng sinh bằng cách trộn
vào thức ăn được sử dụng rộng rãi nhất.
Theo Nguyễn Thanh Phương và ctv (2004) thì chi phí thuốc và hoá chất có thể
đến 500-700 đồng cho sản xuất mỗi kg cá thương phẩm. Mặc khác dư lượng
kháng sinh còn lưu tồn trong sản phẩm sẽ ảnh hưởng đến sức khỏe người tiêu
dùng. Dư lượng kháng sinh thải ra môi trường nuôi cũng góp phần gây ô
nhiễm môi trường nuôi, ảnh hưởng chất lượng nước sông và sức khỏe cộng
đồng.
Theo Lê Xuân Sinh và Nguyễn Thị Phương Nga (2005) thì chi phí mà các hộ
sử dụng hoá chất, thuốc thú y thủy sản ương cá bột lên cá giống chiếm bình
quân khoảng 14% tổng chi phí. Theo Nguyễn Phú Son và ctv (2003) thì chi
phí hoá chất và thuốc thú y thủy sản chỉ dao động quanh mức 5% (2-10%)
tổng chi phí cho nuôi cá thịt trong ao, bè/vụ.
Theo Trần Thị Hồng Tơ (2004), giống vi khuẩn Edwardsiella kháng hoàn
toàn với Chloramfenicol (30), tỷ lệ kháng từ 62,5-97,5% với các kháng sinh
còn lại. Trong đó kháng cao nhất với Tetracycline (30) và thấp nhất với
Nitrofurantion.
Theo các nghiên cứu cho thấy bệnh mủ gan có thể điều trị bằng kháng sinh
khi phát hiện ở giai đoạn sớm, florfenicol là loại kháng sinh được cục quản lý
lương thực và dược phẩm (FDA) cho phép sử dụng từ năm 2005 được Từ
Thanh Dung (2005) khuyến cáo sử dụng để điều trị bệnh mủ gan là 10 mg/kg
cá hoặc 0,1-0,2g/kg thức ăn, cho cá ăn liên tục từ 5-7 ngày. Kết quả kiểm tra
kháng sinh đồ của Từ Thanh Dung và ctv (2004) cho thấy vi khuẩn này kháng
với một số loại kháng sinh như oxytetracycline, oxolinic acid và
sulphonamides. Vì vậy không nên dùng những loại thuốc này để điều trị bệnh
mủ gan.
Hawke (1979) là nhà khoa học đầu tiên đã làm kháng sinh đồ trên 10 chủng vi
khuẩn E. ictaluri. Sau đó, Shotts and Waltman (1986) kiểm tra sự kháng thuốc
trên 118 E. ictaluri phân lập được ở Hoa Kỳ với 37 loại thuốc kháng sinh.
Kết quả nghiên cứu cho thấy đa số vi khuẩn Gram âm nhạy với hầu hết các
loại thuốc đã thí nghiệm. Tuy nhiên, hơn 90% số chủng vi khuẩn kháng với
colistin và sulfamids. Reger et al.,(1993) cùng xác định các chủng E. ictaluri
ở Hoa Kỳ đều nhạy với enrofloxacin, gentamicine và doxycycline.




8

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
2.6 Phương pháp PCR

Kỹ thuật PCR (Polymerase Chain Reaction) là kỹ thuật khuếch đại trình tự
DNA chuyên biệt trong ống nghiệm một đoạn DNA với sự hiện diện của một
hoặc hai đoạn mồi (Oligonucleotides), enzym tổng hợp DNA, các nucleotide
tự do, dung dịch đệm (buffer) theo các chu kỳ nhiệt. Kỹ thuật này được phát
minh và đặt tên bởi Mullis và các cộng sự (Mỹ) vào tháng 10 năm 1985. Đây
là một kỹ thuật rất nhạy bén và đặc biệt, cho phép tìm ra nhanh chóng, thậm
chí chỉ với một tiểu phân vi rút. Những vi rút ẩn, không có các biến đổi về mô
học cũng có thể tìm thấy bằng kỹ thuật này. Hiện nay, kỹ thuật này được ứng
dụng rộng rãi trong nhiều lĩnh vực nghiên cứu như để phát hiện và tạo ra đột
biến gen, chẩn đoán bệnh, phát hiện các mầm bệnh,…(Khuất Hữu Thanh,
2006)
Theo Trần Linh Phước (2003) thì PCR là một chuỗi phản ứng gồm nhiều chu
kỳ lặp lại nối tiếp nhau, mỗi chu kỳ 3 bước là:
- Bước 1: (bước biến tính - denaturation): trong một dung dịch phản ứng bao
gồm các thành phần cần thiết cho sự sao chép, phân tử DNA được biến tính ở
nhiệt độ cao hơn nhiệt độ nóng chảy (Tm) của phân tử, thường là 94-95oC
trong vòng 30-60 giây. Mạch đôi DNA tách đôi thành dạng mạch đơn.
- Bước 2: (bước lai – anealation): trong bước này nhiệt độ được hạ thấp hơn
Tm của các mồi cho phép các mồi bắt cặp với khuôn. Trong thực nghiệm
nhiệt độ dao động trong khoảng 40-70oC, tùy theo Tm của các mồi sử dụng và
kéo dài từ 30-60 giây.
- Bước 3: (bước tổng hợp – extension): nhiệt độ được tăng lên 72 oC giúp cho
DNA polymease hoạt động tổng hợp được tốt nhất. Thời gian của các bước
này tùy thuộc độ dài của trình tự DNA cần khuếch đại, thường kéo dài 30 giây
đến nhiều phút.
Mỗi chu kỳ 3 bước trên sẽ được lặp đi lặp lại nhiều lần, mỗi lần lại tăng gấp
đôi lượng mẫu của lần trước. Đây là sự khuếch đại theo cấp số nhân. Theo
tính toán thì sau 30-40 chu kỳ, sự khuếch đại sẽ cho ra 106 bản sao. Sau phản
ứng PCR các DNA được nhuộm bởi ethidium bromide và có thể quan sát thấy
thông qua việc điện di sản phẩm PCR trong gel agarose và đọc kết quả dưới
bàn đọc UV.

2.6.1 Các nhân tố ảnh hưởng đến phản ứng PCR

PCR là phương pháp được thực hiện dưới mức độ phân tử nên có nhiều nhân
tố ảnh hưởng. Theo Khuất Hữu Thanh (2003) thì PCR chịu ảnh hưởng bởi các
nhân tố sau:
Khuôn DNA có vai trò rất quan trọng, ảnh hưởng rõ rệt đến hiệu quả PCR.
Phản ứng PCR tối ưu với các đoạn khuôn hoàn toàn tinh sạch, khi các đoạn
khuôn không sạch có lẫn các protein, hiệu quả PCR giảm theo tỉ lệ thuận với
độ tinh sạch của DNA khuôn.




9

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Enzym DNA polymerase càng mạnh thì phản ứng PCR càng triệt để. Tùy các
đặc tính của enzym DNA polymerase mà hiệu quả phản ứng khác nhau.
Mồi là yếu tố quan trọng nhất quyết định hiệu quả của phản ứng PCR. Chọn
mồi cần tính toán để đảm bảo Tm của mồi xuôi và mồi ngược không chênh
lệch nhau quá lớn, các mồi phải có trình tự nucleotide để chỉ có thể bắt cặp bổ
sung ở hai đầu của các mạch khuôn, nếu mồi bắt cặp giữa khuôn PCR không
thành công. Các mồi chọn phải đặc trưng cho trình tự DNA cần khuếch đại.
Trình tự DNA cần khuếch đại là trình tự giữa hai mồi không lớn quá 1 kb.
Nồng độ các loại nucleotide (dATP, dGTP, dCTP, dTTP) khoảng 20-200
µM/mỗi loại, khi nồng độ nucleotide quá thấp giảm hiệu quả PCR, ngược lại
nồng độ nucleotide quá cao dễ dẫn đến sự khuếch đại "kí sinh".
Nồng độ Mg++, MgCl2 cũng ảnh hưởng, cần đảm bảo các thành phần dung
dịch đệm, nhiệt độ và các chất cần thiết khi thực hiện phản ứng PCR. Sự mất
cân bằng trong thành phần các nucleotide lại làm tăng các lỗi sao chép của
polymerase.
Ngoài ra, theo Hồ Huỳnh Thùy Dương (1998) thì phản ứng PCR còn bị ảnh
hưởng bởi số lượng chu kỳ của phản ứng PCR, thông thường không vượt quá
40 chu kỳ cho một phản ứng PCR. Bên cạnh đó, thiết bị và dụng cụ cho phản
ứng PCR cũng góp phần ảnh hưởng đến kết quả của phản ứng.

2.6.2 Ưu và nhược điểm của phương pháp PCR

Theo Trần Thị Xô và Nguyễn Thị Lan (2005) thì phương pháp PCR có các ưu
điểm như: thời gian thực hiện nhanh, chỉ cần 3 giờ là có thể khuếch đại được
một trình tự đáng quan tâm; thực hiện đơn giản và ít tốn kém; yêu cầu về độ
tinh sạch của mẫu cũng không cao.
Tuy nhiên, bên cạnh những ưu điểm cũng còn nhiều hạn chế như: Cần phải có
DNA mồi đặc trưng cho DNA cần khuếch đại. Để có đoạn mồi này ít nhất
phải biết được trình tự nucleotide cần khuếch đại. Kích thước DNA cần
khuếch đại không vượt quá 3kb. Khả năng ngoại nhiễm lớn (do thao tác nhiều
lần). Sai sót còn do sử dụng E-Taq-polymerase khoảng 104 (sai sót cho một
lần sao chép).

2.7 Các nghiên cứu về nồng độ ức chế tối thiểu (MIC-Minimal Inhibitory
Concentration)

Nồng độ ức chế tối thiểu là nồng độ thuốc nhỏ nhất để có tác dụng với vi
khuẩn. Với cùng một kháng sinh, nồng độ ức chế tối thiểu thay đổi tuỳ theo vi
khuẩn gây bệnh; vì thế liều thuốc cũng thay đổi (Bùi Kim Tùng và ctv, 2001).
Từ Thanh Dung và ctv (2008) đã kiểm tra giá trị MIC của 64 chủng vi khuẩn
E. ictaluri trên 15 loại thuốc kháng sinh bao gồm: chloramphenicol,
nitrophurantion, amoxicillin, amoxicillin+clavilanic, florfenicol, gentamicin,
kanamicin, streptomycin, neomycin, enrofloxacin, oxolinic acid, flumiquin,
oxytetracycline, trimethoprim và colistin. Kết quả không tìm thấy sự kháng
thuốc của vi khuẩn đối với kháng sinh chloramphenicol, nitrophurantion,


10

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
amoxicillin, amoxicillin + clavilanic, florphenicol, gentamicin, kanamicin,
neomycin; có 83% chủng vi khuẩn kháng với streptomycin, 81% chủng vi
khuẩn kháng với oxytetracycline, 71% kháng với trimethoprim, flumequin
(8%), oxolinic acid (6%) và enrofloxacin (5%).

Ở Thái Lan, Ho et al, (2000) đã xác định giá trị MIC của kháng sinh
florfenicol trên E. tarda, Aeromonas hydrophyla, Pseudomonas fluorescens,
Vibrio cholerae và Salmonella spp, kết quả là các loài vi khuẩn này đã kháng
với florfenicol. Điều này được các nhà khoa học giải thích rằng trước đây ở
Thái Lan đã sử dụng choloramphenicol cho nên các dòng vi khuẩn này đã
kháng thuốc, florfenicol cũng là thành phần của choloramphenicol nên các
dòng vi khuẩn này vẫn kháng với florfenicol.
Năm 2007, Nguyễn Thị Tiên đã nghiên cứu và xác định giá trị MIC của
chloramphenicol trên một số loài vi khuẩn Virio gây bệnh phân trắng trên tôm
sú là 2-256 µg/ml.




11

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
PHẦN III
VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU

3.1 Thời gian và địa điểm nghiên cứu
3.1.1 Thời gian nghiên cứu

Từ tháng 01/2009 đến tháng 06/2009

3.1.2 Địa điểm nghiên cứu

Đề tài được thực hiện tại Mỹ Xương (Đồng Tháp), Chánh An (Vĩnh Long) và
Thốt Nốt (Cần Thơ).

3.1.3 Đối tượng nghiên cứu

Cá tra có dấu hiệu bệnh mủ gan.

3.2 Vật liệu nghiên cứu
3.2.1 Dụng cụ thí nghiệm

- Bộ tiểu phẩu, khay nhựa
- Que cấy, đèn cồn, bình xịt cồn, hộp quẹt
- Ống nghiệm, đĩa Petri thủy tinh
- Cốc thủy tinh, chai nấu môi trường 100ml, 250ml, 500ml
- Viết lông dầu, giấy vệ sinh
- Tủ ấm, tủ cấy vi khuẩn, tủ lạnh, nồi autoclave, tủ sấy.
- Kính hiển vi
- Bếp nấu môi trường, cân điện tử
- Các vật liệu nghiên cứu khác, v.v…
3.2.2 Hóa chất và môi trường
3.2.2.1 Hóa chất

Dung dịch nhuộm Gram:
- Dung dịch 1: Crystal violet, ethanol 95%, ammonium oxalate, n ước cất
- Dung dịch 2: iodine, potassium iodide, nước cất
- Dung dịch 3: 95% ethanol; 5% acetone
- Dung dịch 4: safranin, ethanol 95%, nước cất
Cồn tuyệt đối, cồn đốt, paraffin, …
Các loại đĩa kháng sinh: amoxycillin (AMX-25µg), florfenicol (FFC-30µg),
norfloxacin (NOR-10µg), colistin (CS-50µg), ciprofloxacin (CIP-5µg),
streptomycin (S-10µg), doxycycline (DO-30µg), oxolinic acid (OA-2µg).
Kháng sinh nguyên liệu: streptomycin.
3.2.2.2 Môi trường

Môi trường nuôi cấy vi khuẩn: TSA (Tryptone soya agar), EIA (Edwadsiella
ictaluri agar)


12

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Các hóa chất môi trường kiểm tra sinh hóa: O/F test, H2O2, giấy test oxidase,
VP, Nitrate, Citrate, Decarboxylase với các acid amin (Arginine, Lysine và
Ornithine), các loại đường (mannitol, sucrose, glucose, arabinose, inositol,
sorbitol, rhamnose) cùng các loại dụng cụ và hóa chất cần thiết khác.
Các hoá chất cần thiết cho phản ứng PCR
- NB (Nutrient broth)
- TE (pH 8.0) gồm 10 mM Tris HCl và 1 mM EDTA.
- Hoá chất dùng trong khuếch đại DNA: Buffer 10X, MgCl2, dNTPs (10
mM), Taq polymerase (5U), mồi, nước cất 2 lần.
- Loading dye 6X, ethidium bromide, agarose, dung dịch chạy điện di TAE
(Tris HCl: acetate: EDTA)

3.3 Phương pháp nghiên cứu
3.3.1 Phương pháp thu mẫu

Thu 4 cá bệnh và 2 cá khoẻ cho mỗi ao. Dùng vợt vớt cá hoặc dùng chày để
bắt cá và chứa trong thùng mốp (có sục khí). Nếu cá bị chết thì phải đóng gói
riêng từng con và trữ trong thùng đá chuyển về phòng thí nghiệm khoa Thủy
Sản-Đại học Cần Thơ để phân tích mẫu.

3.3.2 Phương pháp lấy mẫu vi sinh

Theo bài thực hành bệnh vi khuẩn trên động vật thủy sản (Từ Thanh Dung và
Nguyễn Thị Như Ngọc, 2006).

Dùng cồn 70% sát trùng mặt ngoài của cơ thể cá, dùng giấy lau sạch chất nhầy
trên cá. Phân lập vi khuẩn từ gan, thận, tỳ tạng. Khi giải phẩu, để tránh các tạp
khuẩn bên ngoài thì các dụng cụ sử dụng phải được tiệt trùng bằng đèn cồn và
để nguội trước khi lấy mẫu ở các cơ quan. Dùng kéo tiệt trùng mổ cá (tránh
làm vỡ các cơ quan nội tạng), kiểm tra đầy đủ các cơ quan nội tạng, ghi nhận
tất cả các hiện tượng không bình thường hoặc các dấu hiệu bệnh lý như: màu
sắc, hình dạng, các dấu hiệu bất thường trên gan, thận, tỳ tạng. Quan sát vị trí
các cơ quan, kiểm tra trong xoang có chất dịch không (nếu có thì ghi nhận ít
hay nhiều, màu gì, độ đục ra sao). Dùng dao mổ đã tiệt trùng rạch một đường
trên gan, dùng que cấy tiệt trùng đặt vào vị trí vừa rạch, xoay nhẹ để lấy mẫu
bệnh phẩm và cấy trên mặt thạch TSA hoặc NA. Tương tự lấy mẫu bệnh phẩm
trên thận và tỳ tạng.

Gan, thận và tỳ tạng của từng con cá được cấy trên hai môi trường TSA
(Tryptone Soya Agar), và môi trường E. ictaluri agar (EIA) của vi khuẩn E.
ictaluri trong điều kiện tiệt trùng. Những khuẩn lạc rời và có hình dạng đặc
trưng của Edwardsiella được tách ròng và lưu giữ để định danh.
Các thao tác phải được thực hiện trong điều kiện vô trùng.




13

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Ghi nhận các đặc điểm hình thái của khuẩn lạc sau 24-48 giờ
Hình thái và kích thước của khuẩn lạc trên môi trường TSA/EIA.
Màu sắc khuẩn lạc.
Tách ròng cho đến khi đạt đĩa cấy thuần.

3.3.3 Tách ròng mẻ cấy

Tách ròng vi khuẩn bằng cách dùng que cấy nhặt từng loại khuẩn lạc từ đĩa có
chứa nhiều loại khuẩn lạc cấy vào các đĩa agar mới, đem ủ trong tủ ấm 28oC
trong 48 giờ.
Khi đã đạt được đĩa cấy thuần, tiến hành kiểm tra các chỉ tiêu cơ bản: nhuộm
gram, kiểm tra tính di động, phản ứng oxidase, phản ứng catalase, tình di
động, phản ứng O/F, sau đó tiến hành định danh vi khuẩn.

3.3.4 Định danh vi khuẩn theo phương pháp truyền thống

Hình dạng, kích thước, tính ròng và đặc điểm sinh hóa của vi khuẩn được xác
định bằng phương pháp của Barrow và Feltham (1993).
Cách tiến hành, thành phần hóa chất và môi trường cũng như cách pha chế
được trình bày trong Phụ lục 1.
3.3.5 Định danh vi khuẩn bằng bộ Kit API 20E

Định danh theo hướng dẫn của nhà sản xuất (BioMerieux)
Các bước chuẩn bị và thực hiện (Phụ lục 2)
3.3.6 Phương pháp PCR
Chiết tách Acid nucleic (Bartie et al, 2006)
- Nuôi tăng sinh vi khuẩn (48 giờ) trong ống nghiệm có chứa 5 ml môi trường
NB.
- Chuyển 1,5 ml dung dịch vi khuẩn sang ống eppendorf và cho vào 100 µl
dung dịch TE (10 mM Tris HCl và 1 mM EDTA).
- Ủ ở 95oC trong vòng 15 phút.
- Làm lạnh nhanh ống eppendorf trong nước đá.
- Ly tâm 14000 vòng/phút trong 2 phút. Rút phần dung dịch. Đo hàm lượng
DNA bằng máy so màu quang phổ (Biomate 5) ở 260nm.
- Xác định hàm lượng DNA:
Hàm lượng DNA (ng/µl) = A 260nm x 50 x độ pha loãng
Khuếch đại AND (theo Panangala et al., (2007) có chỉnh sửa bởi Đặng Thị
Hoàng Oanh và ctv, 2008)
- Thành phần cho phản ứng
Đoạn mồi xuôi (EiFd-1): GTAGCAGGGAGAAAGCTTGC

14

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Đoạn mồi ngược (EiRs): GAACGCTATTAACGCTCACACC
Bảng 3.1: Thành phần hoá chất tham gia vào phản ứng khuếch đại của qui
trình phát hiện vi khuẩn E. ictaluri (theo Panangala et al., 2007 có chỉnh sửa
bởi Đặng Thị Hoàng Oanh và ctv, 2008)
Hàm lượng cần
STT Hoá chất/ dung dịch Thể tích (µl)
dùng
1 PCR Buffer (10X) 1X 2,5
2 MgCl2 (25mM) 1,5 mM 1,5
3 dNTPs (10mM) 200 µM 0,5
4 Taq DNA polymerase 5UI/µl 2,5 UI 0,5
5 Đoạn mồi (EiFd-1) (10µM) 0,4 µM 1
6 Đoạn mồi (EiRs) (10µM) 0,4 µM 1
7 Mạch khuôn 20 ng 1
8 Nước cất 17
Tổng (µl) 25
- Chu kỳ nhiệt
1. Giai đoạn tiền biến tính: 95oC trong 4 phút
2. Tiếp theo là 30 chu kỳ gồm:
- Giai đoạn biến tính: 95oC trong 30 giây
- Giai đoạn gắn mồi: 55oC trong 45 giây
- Giai đoạn kéo dài chuỗi: 72oC trong 30 giây
3. Giai đoạn kéo dài chuỗi cuối cùng: 72 oC trong 10 phút
Điện di
Quá trình điện di được thực hiện với dung dịch TAE 0,5X và bản thạch chứa
1,5% agarose. Đun nóng dung dịch agarose tan hoàn toàn. Sau đó để dung
dịch nguội khoảng 50-60oC cho ethidium bromide vào và đổ agarose vào
khay. Thể tích gel tùy thuộc vào kích cỡ của khay đựng gel. Độ dày của gel
chỉ cần cao hơn đáy của lược gel khoảng 0,3-0,5 cm và bề dày gel không quá
0,8 cm. EtBr được chuẩn bị từ nguyên liệu tinh 10 mg/ml. Pha loãng 10 mg/ml
nguyên liệu gốc 20.000 lần.
Điện di
Cho gel vào bồn điện di. Thêm dung dịch điện di cho vừa bao phủ gel. Dùng
pipet hút 10 µl mẫu cần phân tích trộn với một giọt dung dịch nạp mẫu 6X cho
vào từng giếng một. Sử dụng thang DNA để xác định khối lượng phân tử của
sản phẩm PCR. Nối bồn điện di với nguồn điện và sử dụng dòng điện 100 V.
Ngừng điện di khi màu xanh đậm di chuyển khoảng 1/2 đến 2/3 gel.
Đọc kết quả
Đặt gel lên bàn UV để đọc kết quả. Kết quả điện di được ghi nhận bằng máy
đọc gel Vilber Lourmat (Pháp). Căn cứ vào thang DNA 1 kb plus ladder
(Invitrogen) để xác định trọng lượng phân tử. Trọng lượng phân tử đoạn DNA
của vi khuẩn E. ictaluri cần phát hiện là 407 bp.



15

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
3.3.7 Phương pháp lập kháng sinh đồ

Khả năng kháng thuốc của vi khuẩn được xác định theo phương pháp của
Huys et al., 2005
Vi khuẩn sau khi được phục hồi trên môi trường TSA, kiểm tra tính thuần.
Sau 48 giờ nuôi cấy, dùng que cấy tiệt trùng lấy một ít khuẩn lạc cho vào ống
nghiệm chứa 5 ml dung dịch nước muối sinh lý (0,85% NaCl) đã tiệt trùng
để tạo dung dịch có độ đục tương đương với độ đục dung dịch chuẩn 3,0
McFarland. Sau đó lấy 100µl dung dịch vi khuẩn tán đều trên môi trường
TSA bằng que thủy tinh đã tiệt trùng. Sau 1 phút dùng 8 loại kháng sinh đặt
lên mặt thạch và ủ trong tủ ấm 28oC trong 48 giờ. Đường kính vòng vô trùng
được tính bằng milimet (mm). Đường kính vòng vô trùng đó được phân
thành 3 loại là kháng, trung bình nhạy và nhạy. Dựa theo Bảng 3.2 để xác
định tính nhạy hay kháng của các chủng vi khuẩn.
Bảng 3.2: Giới hạn xác định mức độ kháng, trung bình nhạy và nhạy của các
loại kháng sinh theo đường kính chuẩn trung bình của công ty Bio-rad
Kháng sinh Kháng (mm) Trung bình nhạy (mm) Nhạy (mm)
AMX-25µg ≤13 14-17 ≥18
FFC-30µg ≤16 17-19 ≥20
NOR-10µg ≤12 13-16 ≥17
CS-50µg ≤8 9-10 ≥11
CIP-5µg ≤15 16-20 ≥21
S-10µg ≤11 12-14 ≥15
DO-30µg ≤12 13-15 ≥16
OA-2µg ≤14 - ≥15
3.3.8 Phương pháp xác định MIC

Phương pháp xác định nồng độ ức chế tối thiểu (MIC) của vi khuẩn dựa trên
phương pháp pha loãng môi trường loãng (Clinical and Laboratory Standards
Institute (CLSI). 2006).

Các bước tiến hành như sau
Chuẩn bị môi trường và hoá chất
Vi khuẩn được lấy từ tủ -80oC sau khi rã đông thì được cấy lên môi trường
TSA, ủ trong tủ ấm 28oC trong 48 giờ.
Kiểm tra và ghi nhận các đặc điểm hình thái của vi khuẩn, hình dạng, kích
thước, màu sắc khuẩn lạc và nhuộm Gram để xác định tính thuần. Nếu vi
khuẩn chưa thuần thì tiếp tục tách ròng cho đến khi đạt được đĩa cấy thuần.
Khi vi khuẩn đã thuần, lấy một ít khuẩn lạc trên đĩa TSA cho vào ống nghiệm
chứa 5ml NB (Nutrient broth), ủ ở 28oC trong 48 giờ.
Chuẩn bị dung dịch thuốc
Chuẩn bị dung dịch thuốc gốc: Chuẩn bị hai chai dung dịch thuốc gốc có
nồng độ 1024 và 256 µg/ml bằng dung môi thích hợp cho mỗi loại thuốc
kháng sinh.


16

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Pha loãng hai lần để có các nồng độ: 0,5; 1; 2; 4; 8; 16; 32; 64; 128; 256; 512;
1024 µg/ml. Pha loãng bằng nước muối sinh lý.
Chú ý:
Ống nghiệm có nồng độ thuốc 512 và 256 µg/ml sẽ được pha loãng từ dung
dịch thuốc gốc 1024 µg/ml. Những ống nghiệm thuốc còn lại 128; 64; 32;…;
0,5 µg/ml được pha loãng từ dung dịch thuốc gốc 256 µg/ml. Cần lắc đều
dung dịch thuốc trước khi pha loãng các dung dịch thuốc tiếp theo. Nồng độ
thuốc sẽ giảm đi một nữa khi cho dung dịch vi khuẩn vào. Ghi tên thuốc và
nồng độ trước khi bắt đầu thí nghiệm.
Mỗi nồng độ thuốc được lặp lại 3 lần.
Chuẩn bị dung dịch vi khuẩn
Xác định mật số vi khuẩn bằng máy so màu quang phổ ở bước sóng 610 nm
và điều chỉnh mật độ vi khuẩn bằng NB (không dùng nước cất) ở điểm OD =
0,1 ± 0,02 mật số vi khuẩn khoảng 1x108 CFU/ml) rồi pha loãng xuống 1000
lần để mật độ vi khuẩn còn khoảng 1x105 CFU/ml. Sau đó, mỗi chủng vi
khuẩn đều được cấy trên môi trường TSA để kiểm tra sự thuần chủng vi
khuẩn và được ủ trong điều kiện với các ống MIC.
Cho 2ml dung dịch vi khuẩn vào từng ống nghiệm có chứa 2ml dung dịch
thuốc ở các nồng độ khác nhau: 0,5; 1; 2;...; 512 µg/ml (lắc đều)
Thí nghiệm có 2 đối chứng:
Đối chứng âm: (2ml NB + 2ml nước muối sinh lý)
Đối chứng dương: (2ml dung dịch vi khuẩn + 2ml nước muối sinh lý)
Tất cả các ống nghiệm được ủ ở 28oC, trong 48 giờ (đến khi thấy vi khuẩn
trong đối chứng dương phát triển).
Đọc kết quả
Kiểm tra sự thuần chủng của vi khuẩn, nếu có tạp khuẩn thì loại bỏ kết quả
hoặc loạt ống nghiệm của chủng vi khuẩn nào phát triển không liên tục thì
làm lại thí nghiệm.
Đọc kết quả bằng cách so sánh độ đục của ống MIC với ống đối chứng âm và
dương.
Giá trị nồng độ MIC được xác định là nồng độ thấp nhất của thuốc kháng
sinh, ở đó không có vi khuẩn phát triển.
3.4 Phương pháp xử lý số liệu
Microsoft Word được sử dụng để đánh văn bản và Microsoft exell được dùng
để vẽ biểu đồ và xử lý số liệu.




17

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
PHẦN IV
KẾT QUẢ VÀ THẢO LUẬN

4.1 Kết quả phân lập và định danh vi khuẩn
4.1.1 Kết quả phân lập vi khuẩn

Kết quả sau 7 đợt thu mẫu tại 3 tỉnh: Vĩnh Long, Đồng Tháp và thành phố Cần
Thơ, thu ở 18 ao với tổng số 101 con cá, trong đó gồm có 32 cá khỏe và 69 cá
bệnh. Cá được thu từ những ao có dấu hiệu bệnh. Các cơ quan gan, thận và tỳ
tạng của cá có dấu hiệu bệnh mủ gan và cả cá khỏe được cấy trên môi trường
dinh dưỡng chung TSA (Tryptone soya agar) và môi trường EIA (E. ictaluri
agar) ủ trong tủ ấm ở 28oC (48 giờ), những khuẩn lạc có dấu hiệu đặc trưng
của nhóm vi khuẩn E. ictaluri về màu sắc (trắng đục), kích thước nhỏ li ti,
hình dạng (que ngắn)... theo mô tả của Hawke et al., (1981), Plumb, (1999),
Từ Thanh Dung (2005) được tách ròng. Kết quả được 84 chủng, trong đó có
31 chủng phân lập trên gan, 23 chủng phân lập trên thận và 30 chủng phân lập
trên tỳ tạng. Bên cạnh việc phân lập vi khuẩn các dấu hiệu bên trong và bên
ngoài của cá cũng được ghi nhận. Kết quả ghi nhận được có 54/101 cá thể có
dấu hiệu xuất huyết, 38/101 cá thể có dịch trong xoang bụng trong đó có 16/38
trường hợp có dịch màu vàng và 22/38 trường hợp có dịch màu trắng trong
(hoặc đục, có thể có mùi hôi). Một số cá thể có các đốm trắng trên gan, thận,
tỳ tạng với kích thước từ 1-3mm, cụ thể có 40/101 cá thể có đốm trắng trên
thận, 34/101 cá thể có đốm trắng trên tỳ tạng, 29/101 cá thể có đốm trắng trên
gan và 22/101 cá thể có gan trắng nhạt.

Dựa vào dấu hiệu khi phân tích mẫu vi sinh cùng với kết quả các chỉ tiêu cơ
bản: nhuộm Gram, oxidase, catalase, tính di động chọn ra 10 chủng (7 chủng ở
Vĩnh Long và 3 chủng ở Đồng Tháp) đặc trưng nhất để tiến hành định danh vi
khuẩn theo phương pháp truyền thống và bằng bộ kit API 20E.

4.1.2 Kết quả định danh vi khuẩn theo phương pháp truyền thống
Kết quả kiểm tra các chủng vi khuẩn với 22 chỉ tiêu sinh lý, sinh hóa đã xác
định hầu hết các chủng vi khuẩn này có đặc điểm giống nhau (Bảng 4.1).




A B

Hình 4.1: (A) Đĩa cấy thuần; (B)Vi khuẩn E. ictaluri gram âm, hình que ngắn.




18

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Bảng 4.1 Các chỉ tiêu hình thái sinh lý và sinh hoá của vi khuẩn E. ictaluri
bằng phương pháp truyền thống
Chủng vi khuẩn
S
CA CA MX MX
T Chỉ tiêu CA CA CA CA CA MX
3.4 4.3 5.3 13.2
T 3.1G 3.2T 4.1G 4.3G 4.4G 3.3G
TT TT T T
1 Gram - - - - - - - - - -
2 Hình dạng Que Que Que Que Que Que Que Que Que Que
3 Oxidase - - - - - - - - - -
4 Catalase + + + + + + + + + +
5 Di động + + + + + + + + + +
6 O/F +/+ +/+ +/+ +/+ +/+ +/+ +/+ +/+ +/+ +/+
7 Arginine - - - - - - - - - -
8 Lysin + + + + + + + + + +
9 Ornithine - - - - - - - - - -
10 Citrate - - - - - - - - - -
11 Nitrate + + + + + + + + + +
12 H2S - - - - - - - - - -
13 Ure - - - - - - - - - -
14 Indole - - - - - - - - - -
15 VP - - - - - - - - - -
16 Arabinose - - - - - - - - - -
17 Glucose + + + + + + + + + +
18 Innositol - - - - - - - - - -
19 Mannitol - - - - - - - - - -
20 Rhamnose - - - - - - - - - -
21 Sorbitol - - - - - - - - - -
22 Sucrose - - - - - - - - - -

Ghi chú: CA: Chánh An; MX: Mỹ Xương
G: gan; T: thận; TT: tỳ tạng
Số trước dấu chấm ".": chỉ số ao
Số sau dấu chấm ".": số thứ tự của mẫu cá

Qua Bảng 4.1 cho thấy kết quả kiểm tra 22 chỉ tiêu hình thái, sinh lý, sinh hóa
của vi khuẩn E. ictaluri đều có hình que, gram âm. Tất cả các chủng vi khuẩn
đều cho phản ứng dương tính với 6 chỉ tiêu: catalase, tính di động, phản ứng
O/F, lysine, khả năng tạo nitrit từ nitrate, glucose. Các chỉ tiêu còn lại đều cho
phản ứng âm tính.




A B


Hình 4.2: (A) Khả năng sử dụng các loại đường (Sucrose, Mannitol, Sorbitol, Glucose, Arabinose,



19

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Innositol, Rhamnose); (B) Các phản ứng Nitrate, ure, lên men và oxi hoá đường glucose (O/F), VP,
citrate, indole, H2S (Theo thứ tự từ trái sang phải).

Kết quả cho thấy tất cả các chủng vi khuẩn có đặc điểm giống với mô tả của
Từ Thanh Dung (2005) là vi khuẩn gram âm, hình que ngắn, di động yếu,
catalase dương tính, oxidase âm tính, có khả năng lên men glucose, không sinh
H2S và Indole âm tính được chọn ra để kiểm tra các chỉ tiêu sinh hóa truyền
thống.
Ngoài các chỉ tiêu trên thì Crumlish et al., (2002) khi phân lập vi khuẩn trên cá
tra bệnh mủ gan ở ĐBSCL trong các trường hợp bệnh cho kết quả với vi
khuẩn E. ictaluri ở các chỉ tiêu còn lại đều âm tính ngoại trừ khả năng thủy
phân lysine và khả năng sử dụng đường glucose. Trong đề tài này, kết quả
kiểm tra các chỉ tiêu sinh hóa truyền thống cho thấy ngoài các chỉ tiêu cơ bản
trên thì các chỉ tiêu còn lại đa số đều âm tính trên tất cả các chủng vi khuẩn
ngoại trừ khả năng thủy phân lysin và khả năng sử dụng đường glucose là
dương tính. Như vậy, kết quả nghiên cứu của đề tài phù hợp với kết quả
nghiên cứu của Crumlish et al., (2002) và Từ Thanh Dung (2005).

4.1.3 Kết quả định danh vi khuẩn bằng bộ Kit API 20E

Bên cạnh việc xác định các chỉ tiêu hình thái, sinh lý và sinh hoá của vi khuẩn
bằng phương pháp truyền thống, đề tài cũng tiến hành xác định các chỉ tiêu
sinh hoá của vi khuẩn bằng bộ Kit API 20E. Kết quả được trình bày ở Bảng
4.2.

Qua Bảng 4.2 cho thấy đa số các chỉ tiêu đều âm tính, kết quả dương tính ở
các chỉ tiêu lysine, glucose và citrate. Kết quả này phù hợp với nghiên cứu của
Lê Minh Đương (2007). Nhưng đối với khả năng sử dụng đường glucose của
chủng CA4.4G cho kết quả âm tính, sự sai khác này có thể do trong quá trình
thực hiện thí nghiệm vi khuẩn có khả năng bị nhiễm tạp khuẩn hoặc do hóa
chất thí nghiệm không đảm bảo chất lượng.




Hình 4.3: Kết quả kiểm tra vi khuẩn E. ictaluri trên Kit API 20E
Ghi chú: ONPG; ADH; LDC; ODC; CIT; H 2S; URE; TDA; IND; VP; GEL; GLU; MAN; INO; SOR;
RHA; SAC; MEL; AMY; ARA (theo thứ tự từ trái sang phải)




20

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Bảng 4.2. Kết quả phân tích các chỉ tiêu hình thái, sinh lý và sinh hoá các
chủng vi khuẩn bằng bộ kit API 20E.

Chủng vi khuẩn
CA CA
Chỉ tiêu CA CA CA CA CA MX MX MX
3.2 3.4T
3.1G 4.1G 4.3G 4.3TT 4.4G 3.3G 5.3T 13.2T
T T
Gram - - - - - - - - - -
Hình dạng que que que que que que que que que Que
Oxidase - - - - - - - - - -
Catalase + + + + + + + + + +
Di động + + + + + + + + + +
O/F +/+ +/+ +/+ +/+ +/+ +/+ +/+ +/+ +/+ +/+
ONPG - - - - - - - - - -
ADH - - - - - - - - - -
LDC + + + + + + + + + +
ODC - - - - - - - - - -
CIT - + + - + - + + - +
H2S - - - - - - - - - -
URE - - - - - - - - - -
TDA - - - - - - - - - -
IND - - - - - - + - - -
VP - - - - - - - - - -
GEL - - - - - - - - - -
GLU + + + + + + - + + +
MAN - - - - - - - - - -
INO - - - - - - - - - -
SOR - - - - - - - - - -
RHA - - - - - - - - - -
SAC - - - - - - - - - -
MEL - + + - - - - - - -
AMY - - - - - - - - - -
ARA - d d - - - - - - -
Ghi chú: ONPG: ortho-nitrophenyl galactosidase; ADH: arginine decarboxylase; LDC: lysine
decarboxylase; ODC: ornithine decarboxylase; CIT: citrate; H2S: H2S production; URE: urea; TDA:
tryptophane deaminase; IND: indole; VP: phản ứng voges-proskauer; GLE: gelatin; GLU: glucose;
MAN: mannitol; INO: inositol; SOR: sorbitol; RHA: rhamnose; SAC: sucrose; MEL: melibiose;
AMY: amigdaline; ARA: arabinose.

Bên cạnh đó, chỉ tiêu kiểm tra khả năng sử dụng citrate cũng cho kết quả âm
tính ở các chủng vi khuẩn CA3.1G, CA4.1G, CA4.3TT và MX5.3T, kết quả
này giống với nghiên cứu của Nguyễn Trúc Phương (2008) trên chủng vi
khuẩn tham khảo E223. Tuy nhiên các chủng còn lại cho kết quả dương tính
với chỉ tiêu này. Năm 2006, Lương Trần Thục Đoan đã kiểm tra đặc điểm sinh
hoá của vi khuẩn E. ictaluri 224 phân lập trên cá tra ở Việt Nam thì chỉ tiêu
citrate cho kết quả dương tính. Đến năm 2007, Lê Minh Đương đã tiến hành
gây cảm nhiễm cá tra bằng dòng vi khuẩn EHO2, khi kiểm tra bằng bộ Kit
API 20E cho kết quả là 8 chủng vi khuẩn tái phân lập từ các cơ quan máu, lớp
nhớt trên da, não, tim, gan, tỳ tạng, thận và ruột trước thì chỉ có chỉ tiêu
glucose và lysine là dương tính, tất cả các chỉ tiêu còn lại đều âm tính. Nhưng
cũng với kết quả tái định danh thì 9 chủng vi khuẩn phân lập từ lô E223 và 1
chủng phân lập từ lô đối chứng ngoài kết quả dương tính với glucose và lysine


21

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
còn cho kết quả dương tính với chỉ tiêu citrate. Như vậy chỉ tiêu citrate có thể
thay đổi giữa các chủng vi khuẩn E. ictaluri khác nhau.
Chủng CA4.4G ngoài việc cho kết quả âm tính với đường glucose còn cho kết
quả dương tính với chỉ tiêu Indole, sự sai khác biệt này có thể có liên quan với
nhau do đặc tính của chủng vi khuẩn.
Ngoài ra, kết quả giống nhau giữa 2 chủng vi khuẩn CA3.2T và CA3.4TT là
dương tính với chỉ tiêu đường melibiose và có phản ứng không rõ ràng với
đường arabinose.
Định danh vi khuẩn E. ictaluri bằng phương pháp truyền thống hay phương
pháp API 20E đều cho kết quả phù hợp với kết quả định danh của các tác gải
trước đây. Tuy nhiên ở mỗi phương pháp đều có ưu và nhược điểm riêng. Đối
với phương pháp sinh hóa truyền thống thì cần nhiều thời gian, quá trình thao
tác dễ bị tạp nhiễm và khá phức tạp. Bộ Kit API 20E hạn chế được những
nhược điểm này, tuy nhiên chi phí cho việc sử dụng kit lại khá cao và vì đây là
bộ kit được chế tạo để sử dụng trên người với nhiệt độ tối ưu là 37oC trong khi
áp dụng vào thí nghiệm trong thủy sản cho nhóm vi khuẩn E. ictaluri với mức
nhiệt độ tối ưu thấp hơn khá nhiều (28oC) thì mức độ chính xác của kết quả
phân tích cần được lưu ý. Góp phần khắc phục những nhược điểm của hai
phương pháp này đó là phương pháp PCR (Polymerase Chain Reaction) vừa
tiết kiệm được nhiều thời gian vừa mang tính chính xác cao.

4.2 Kết quả định danh vi khuẩn bằng phương pháp PCR

PCR là công cụ giúp phát hiện nhanh mầm bệnh vi sinh vật trên tôm, cá. Qua
qui trình chiết tách DNA cho kết quả ở Bảng 4.3
Bảng 4.3 Hàm lượng DNA chiết tách (theo Bartie và ctv, 2006)
Chủng vi kkhuẩn Giá trị đo được ở 260 nm Hàm lượng DNA (ng/µl)
MX13.2T 0,38 1900
CA4.1G 0,353 1765
CA3.1G 0,355 1775
MX3.3G 0,367 1835
CA4.3G 0,342 1710
CA4.4G 0,474 2370
CA3.4TT 0,426 2130
CA3.2T 0,428 2140
MX5.3T 0,338 1690
CA4.3TT 0,339 1695
Từ kết quả chiết tách DNA ở trên cho thấy hàm lượng DNA khá cao (dao
động từ 1690-2370 ng/µl) trong khi hàm lượng DNA cần cho phản ứng chỉ có
20 ng/µl. Vì vậy kết quả hàm lượng DNA chiết tách được pha loãng để đảm
bảo giá trị hàm lượng DNA cần sử dụng trong phản ứng.
Kết quả điện di được trình bày ở Hình 4.4




22

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
407bp


M 1 2 3 4 5 6 7 8 9 10 11 12
Hình 4.4. Kết quả chạy PCR phát hiện E. ictaluri

Giếng M: thang đo DNA (1 kb plus Invitrogen)
Giếng 1: đối chứng âm (nước)
Giếng 2: đối chứng dương
Giếng 3: MX13.2T
Giếng 4: CA4.1G
Giếng 5: CA3.1G
Giếng 6: MX3.3G
Giếng 7: CA4.3G
Giếng 8: CA4.4G
Giếng 9: CA3.4TT
Giếng 10: CA3.2T
Giếng 11: MX5.3T
Giếng 12: CA4.3TT.
Qua kết quả Hình 4.4 cho thấy cả 10 chủng vi khuẩn đều hiện vạch tại vị trí
407 bp chứng tỏ có sự hiện diện của vi khuẩn E. ictaluri, trên tất cả các mẫu
đều không có sản phẩm phụ. Kết quả này phù hợp với nghiên cứu của Nguyễn
Trúc Phương (2008). Trong đó vạch hiện rõ nhất ở giếng thứ 5 là chủng
CA3.1G. Các giếng thứ 3; 4; 6; 8; 9; 11; 12 vạch sáng hiện lên cũng khá rõ.
Riêng ở giếng thứ 7 và 10 các vạch không rõ như các giếng còn lại có thể do
thao tác trong quá trình tách chiết.

4.3 Kết quả kháng sinh đồ

Tất cả các chủng vi khuẩn được tiến hành lập kháng sinh đồ với 8 loại thuốc
kháng sinh: AMX, FFC, NOR, CS, CIP, S, DO và OA. Kết quả được trình
trong Bảng 4.4
Qua Bảng 4.4 cho thấy 100% các chủng vi khuẩn kháng hoàn toàn với
streptomycin (S) và oxolinic acid (OA). Bên cạnh đó đối với kháng sinh FFC
tất cả các chủng vi khuẩn trên đều cho kết quả đường kính vòng vô trùng rất
bé so với giới hạn mức độ kháng của vi khuẩn. Vậy 100% vi khuẩn phân lập
được đều kháng với FFC.




23

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Bảng 4.4: Kết quả kháng sinh đồ của các chủng vi khuẩn E. ictaluri
Vi khuẩn Đường kính vòng vô trùng của thuốc kháng sinh (mm)
AMX FFC NOR CIP CS S DO OA
CA3.1G 46 13 26,5 32 15,5 - 27 -
CA3.2T 46 12 24,5 34 15,5 - 43 -
CA3.4TT 44,5 12 24,5 32 15 - 35 -
CA4.1G 46,5 11 26 34,5 14 - 21 -
CA4.3G 48,5 12 26,5 36 15,5 - 41,5 -
CA4.3TT 45 11 26 33 16 - 22 -
CA4.4G 50 11 20 26 15 - 12 -
MX3.3G 47,5 11,5 27 35 15,5 - 26,5 -
MX5.3T 43 12 26 29 15,5 - 32 -
MX13.2T 46 12 19,5 25 16 - 14 -




Hình 4.5: Kết quả kháng sinh đồ trên vi khuẩn E. ictaluri

Theo Reger et al., (1993) cho rằng các chủng E. ictaluri ở Hoa Kỳ đều nhạy
với DO. Trong nghiên cứu này kết quả cho thấy DO có vòng vô trùng thể hiện
cả 3 mức là kháng, trung bình nhạy và nhạy. Trong đó có chủng CA4.4G
kháng, chiếm 10%; chủng MX13.2T ở mức trung bình nhạy chiếm 10%; 8
chủng còn lại nhạy với loại kháng sinh này, chiếm 80%. Như vậy, tính nhạy
của DO đối với nhóm vi khuẩn này đang giảm dần, vì vậy người nuôi nên thận
trọng khi sử dụng.
Trái ngược với 3 loại kháng sinh S, OA và FFC, kết quả đường kính vòng vô
trùng trên kháng sinh AMX rất lớn. Kết quả này cho thấy vi khuẩn E. ictaluri
gây bệnh trên cá tra ở Chánh An (Vĩnh Long) và Mỹ Xương (Đồng Tháp) còn
rất nhạy với loại kháng sinh này. Trong nghiên cứu của Châu Hồng Thuý
(2008) ở tỉnh Trà Vinh cho thấy có 53,5% chủng kháng với NOR và 30%
chủng trung bình nhạy nhưng trong nghiên cứu này kết quả 100% vi khuẩn
nhạy với loại kháng sinh này. Kết quả tương tự trên tất cả các chủng vi khuẩn
đối với 2 loại kháng sinh CIP và CS. Đường kính vòng vô trùng trên CIP và
CS thể hiện tính nhạy của vi khuẩn đối với 2 loại kháng sinh này. Như vậy, cả
4 loại kháng sinh này đều nhạy với các chủng vi khuẩn phân lập được ở Vĩnh
Long và Đồng Tháp, trong đó nhạy nhất là AMX. Vì vậy ta có thể dùng để
điều trị cho cá khi cần thiết, tuy nhiên ở mỗi vùng nuôi khác nhau vi khuẩn sẽ


24

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
phản ứng khác nhau với từng loại kháng sinh. Vì vậy, việc sử dụng kháng sinh
phải hết sức cẩn thận và hợp lý để tránh hiện tượng kháng thuốc kháng sinh
gây thiệt hại đến môi trường sinh thái, sức khỏe động vật thủy sản nuôi đồng
thời cũng gây khó khăn cho vấn đề điều trị bệnh sau này. Ngoài ra, còn ảnh
hưởng đến kinh tế và quan trọng hơn là ảnh hưởng đến sức khỏe con người.

4.4 Kết quả MIC

Kết quả kháng sinh đồ cho thấy tất cả các chủng vi khuẩn đều kháng hoàn toàn
với streptomycin và oxolinic acid. Qua kết quả này, đề tài chọn ngẫu nhiên hai
chủng CA3.4TT và MX3.3G để làm thí nghiệm xác định nồng độ ức chế tối
thiểu của chúng trên kháng sinh streptomycin (S). Kết quả được thể hiện ở
Bảng 4.5
Bảng 4.5: Giá trị MIC của thuốc kháng sinh streptomycin trên 2 chủng vi
khuẩn E. ictaluri
Chủng vi Khoảng giá trị MIC (µg/ ml)
khuẩn 0,25 0,5 1 2 4
CA3.4TT x
MX3.3G x




Hình 4.6: Kết quả MIC của vi khuẩn E. ictaluri

Qua kết quả ở Bảng 4.5 cho thấy giá trị MIC của kháng sinh streptomycin lên
2 chủng vi khuẩn nằm trong khoảng 2-4 µg/ml. Nguyên nhân có thể do mật độ
vi khuẩn thấp nên chưa đủ sức kháng lại thuốc kháng sinh ở nồng độ cao và đã
bị thuốc ức chế ở nồng độ thấp.
Theo nghiên cứu sự kháng thuốc của Stock and Wiedemann (2001) trong số
102 chủng thuộc 3 loài E. ictaluri, E. tarda và E. hoshinae thì chỉ có 2 chủng
(1,96%) kháng với streptomycin. Tuy nhiên, năm 2008 kết quả nghiên cứu của
Từ Thanh Dung cho thấy có 83% vi khuẩn E. ictaluri kháng với streptomycin,
có thể nói đây là lần đầu tiên phát hiện vi khuẩn E. ictaluri kháng với
streptomycin ở tỉ lệ cao nhất.



25

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Trong nghiên cứu này, kết quả lập kháng sinh đồ lại cho thấy tất cả các chủng
vi khuẩn phân lập được đều kháng hoàn toàn với streptomycin.
Năm 2008, Huỳnh Thị Phượng Quyên với đề tài tiêu chuẩn hóa phương pháp
xác định nồng độ ức chế tối thiểu (MIC) của thuốc kháng sinh lên vi khuẩn E.
ictaluri và Aeromonas hydrophyla tại khoa Thủy Sản đã cho kết quả nồng độ
MIC của thuốc kháng sinh DO và cefalexine lên chủng vi khuẩn CAF2 và
CAF133 trải dài ở các nồng độ từ 16 ppm đến 128 ppm. Đồng thời, kết quả
cũng cho thấy trên cùng một loài vi khuẩn A. hydrophyla nhưng với 2 cách xác
định mật độ vi khuẩn khác nhau (so màu quang phổ và so màu Mcfarland) sẽ
cho kết quả nồng độ MIC cũng khác nhau.
Cũng trong nghiên cứu của Huỳnh Thị Phượng Quyên (2008), phương pháp
pha loãng để xác định nồng độ ức chế tối thiểu (MIC) của thuốc kháng sinh
doxycycline và cefalexine lên 2 chủng vi khuẩn E. ictaluri (E223 và E258) kết
quả nằm trong khoảng từ 8-64 µg/ml.
Như vậy, trong nghiên cứu này nồng độ ức chế tối thiểu (MIC) của vi khuẩn
E. ictaluri trên kháng sinh streptomycin là rất thấp so với các nghiên cứu trước
như Từ Thanh Dung (2008) đã nghiên cứu trên kháng sinh streptomycin với
64 chủng vi khuẩn E. ictaluri kết quả cho thấy có 2/64 chủng ở mức 4µg/ml;
9/64 chủng ở mức 8µg/ml; 1/64 chủng ở mức 32µg/ml; 1/64 chủng ở mức
64µg/ml và 51/64 chủng ở mức ≥ 128µg/ml.




26

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
PHẦN V
KẾT LUẬN VÀ ĐỀ XUẤT
5.1 Kết luận

Kết quả định danh được cả 10 chủng đều là vi khuẩn E. ictaluri.
Kết quả kháng sinh đồ cho thấy tất cả các chủng vi khuẩn E. ictaluri kháng
hoàn toàn với streptomycin và oxolinic acid, các chủng vi khuẩn cũng kháng
với florfenicol và vi khuẩn nhạy nhất với kháng sinh amoxycillin. Như vậy,
tùy vào vùng nuôi khác nhau mà ta lựa chọn kháng sinh phù hợp khi cần thiết
để sử dụng.
Kết quả MIC của kháng sinh streptomycin trên 2 chủng vi khuẩn CA3.4TT và
MX3.3G thấp, dao động từ 2-4 µg/ml.

5.2 Đề xuất

Cần khảo sát tính kháng thuốc của vi khuẩn trên nhiều loại kháng sinh để có
cách sử dụng hợp lý thuốc kháng sinh tránh được nhiều thiệt hại.
Nên thu nhiều mẫu hơn ở nhiều địa phương khác nhau để có kết quả đánh giá
tổng quát hơn.
Cần theo dõi trong thời gian dài hơn để biết rõ tình hình xuất hiện bệnh từ đó
có biện pháp quản lý và sử dụng kháng sinh hợp lý.




27

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
TÀI LIỆU THAM KHẢO

1. Barrow, G.I. and R.K.A. Feltham., 1993. Cowan and Steel ‘s manual
for the indentification of medical bacteria, 3 rd edn. Cambridge
Univesity Press, Cambridge. 262.
2. Baxa, D. V., J. M. Groff, A. Wishkovsky and R. P. Hedrick, 1990.
Susceptibility of nonictalurid fishes to experimental infection with
Edwardsiella ictaluri Diseases of Aquatic Organisms Vol.8: 113-117.
3. Brown, E. E. and J. B. Gratzek., 1980. Fish farming handbook.
4. Bùi Kim Tùng, Bùi Kim Hoàng và Bùi Kim Tân, 2001. Thuốc kháng
sinh. Sở khoa học công nghệ và môi trường tỉnh Bà Rịa-Vũng Tàu, 255
trang.
5. Bùi Quang Tề, 1993. Bệnh cá nuôi lồng bè và biện pháp phòng trị
bệnh. Tuyển tập các công trình nghiên cứu khoa học 1988-1992, trang
120-124. Viện Nghiên Cứu Nuôi Trồng Thủy Sản I. Nhà xuất bản
Nông Nghiệp.
6. Cedric Komarl Zilong Tan, and William J. Enright., 2003. Health
management practices for cage aquaculture in Asia - a key component
for sustainability. Aquaculture Society. Bangkok, Thailand.
7. Clinical and Laboratory Standards Institure (CLSI), 2006. Methods for
broth dilution susceptibility testing of bacteria isolate from aquatic
animals; informational supplement, M49-A. Clinical and Laboratory
Standards Institure, Wayne, NJ.
8. Crumlish, M., T.T. Dung, J.F. Turnbull, N.T.N. Ngoc and H.W.
Ferguson, 2002. Indentification of Edwardsiella ictaluri from diseased
freshwater catfish, Pangasius hypophthalmus (Sauvage), culture in the
Mekong Delta, Vietnam. Journal of Fish Diseases 2002, 25, page 733-
736.
9. Đỗ Thị Hòa, Bùi Quang Tề, Nguyễn Hữu Dũng, Nguyễn Thị Muội,
2004. Giáo trình bệnh học thủy sản. Khoa nuôi trồng thủy sản-Đại học
Thủy Sản Nha Trang, 422 trang.
10. Dung, T.T., F. Haesebrouck, N.A.Tuan, P. Sorgeloos, M.Baele and A.
Decostere, 2008. Hiện trạng kháng thuốc kháng sinh trên vi khuẩn
Edwardsiella ictaluri gây bệnh gan, thận mủ trên cá tra Pangasianodon
hypophthalmus ở Đồng Bằng Sông Cửu Long.



28

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
11. Dương Nhựt Long, 2003. Giáo trình Kỹ Thuật Nuôi Thủy Sản Nước
Ngọt-Khoa Thủy Sản-Đại học Cần Thơ.
12. FAO, 2005. Hướng dẫn chẩn đoán bệnh của động vật thủy sản Châu Á.
Nhà xuất bản Nông Nghiệp, 247 trang.
13. Ferguson, H.W., J.F Turnbull, A. Shinn, K. Thomson, T.T. Dung and
M. Crumlish, 2001. Bacillary necrosis in farmed Pangasius
hypophthalmus (Sauvage) from the Mekong delta, Vietnam. Journal of
fish disease 2001, 24, page 509-513.
14. Francis-Floyd, R., Beleau, M. H., Waterstrat, P. R and Bowser, P.R.,
1987. Effect of water temperature on the clinical outcome of infection
with Edwardsiella ictaluri in channel catfish. J.Am. Vet. Med. Ass.
191: 1413-1416.
15. Frerichs. R.M and R.F. Millar, 1993. Mannual for the isolate and
indentification of fish bacterial pathogent. Institure of aquaculture,
University of Sterling, Scotland. 107pp.
16. GESAMP 2001. Planning and Management for Sustainable Coastal
Aquaculture Development.
17. Hawe, J.P. (1979). A bacterial associated with disease of pond culture
channel catfish. Journal of the Fisheries research Board of Canada, 36,
1508-1512.
18. Hawke J.P., A.C. McWhorter, A.G. Steigerwalt and D.J. Brenner,
1981. Edwardsiella ictaluri sp. Nov., the causative agent of enteric
septicemia of catfish. International Journal of Systematic Bacteriology,
31: 396-400
19. Hồ Huỳnh Thùy Dương, 1998. Sinh học phân tử. Nhà xuất bản Giáo
Dục, 304 trang.
20. Ho, S.P., T.Y.Hsu, M.H.Chen and W.S.Wang, 2000. Antibacterial
effect of chloramphenicol, thiamfenicol and flofenicol against aquatic
animal bacteria. J. Vet. Med. Sci.62:479 – 485.
21. Huỳnh Thị Phượng Quyên, 2008. Tiêu chuẩn hoá phương pháp xác
định nồng độ ức chế tối thiểu (MIC) của thuốc kháng sinh lên vi khuẩn
Edwardsiella ictaluri và Aeromonas hydrophila tại khoa Thủy Sản.
Luận văn Đại học-Khoa Thủy Sản-Đại học Cần Thơ, 38 trang.
22. Inglis, V., R.J. Roberts and Niall R. Bromage, 1994. Enteric
septicaemia of catfish. Bacterial Diseases of Fish, page 67-79. 312pp.


29

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
23. Kasornchandra, J., Rogers. W.A and Plumb, J.A. (1987). Edwardsiella
ictaluri from walking catfish Clarias batrachus L., in Thailand. Journal
of Fish Disease. 10, 137-138.
24. Kent, M. L., Lyons, J. M. (1982). Edwardsiella ictaluri in the green
knife fish, Egemannia virescens. Fish Health News 2:2.
25. Khuất Hữu Thanh, 2006. Cơ sở di truyền phân tử và kỹ thuật gen.
Trường Đại học Bách Khoa Hà Nội. Nhà xuất bản Khoa Học và Kỹ
Thuật, 270 trang.
26. Lê Minh Đương, 2007. So sánh khả năng xâm nhập của hai dòng vi
khuẩn E. ictaluri trên cá tra (Pangasius hypophthalmus). Luận văn Đại
học-Khoa Thủy Sản-Đại học Cần Thơ, 63 trang.
27. Lê Thị Bé Năm, 2002. Xác định tác nhân vi khuẩn gây bệnh đốm trắng
ở nội tạng cá tra (Pangasius hypophthalmus, Sauvage 1878). Luận văn
Đại học-Khoa Thủy Sản-Trường Đại học Cần Thơ, 38 trang.
28. Lê Thị Kim Liên và Nguyễn Quốc Thịnh, 2006. Giáo trình thuốc và
hóa chất trong nuôi trồng Thủy Sản-Đại học Cần Thơ.
29. Lê Xuân Sinh và ctv, 2006. Đánh giá sự tiếp nhận và ảnh hưởng của
các thông tin liên quan đến việc quản lý sức khoẻ cá tra (pangasius
hypophthalmus) nuôi ở An Giang. Dự án DFID. Trang 15-17.
30. Lê Xuân Sinh và Nguyễn Thị Phương Nga, 2005. Những nhận xét cơ
bản liên quan tới việc cung cấp và sử dụng hoá chất và thuốc cho nuôi
trồng thủy sản ở Đồng Bằng Sông Cửu Long. Báo cáo hội nghị khoa
học về nuôi trồng thủy sản toàn quốc. Vũng Tàu 22-24/12/2005.
31. Lương Trần Thục Đoan, 2006. Khảo sát sự xâm nhập của vi khuẩn gây
bệnh mủ gan (Edwardsiella ictaluri) trên các cơ quan khác nhau của cá
tra (Pangasius hypophthalmus). Luận văn Đại học-Khoa Thủy Sản-
Trường Đại học Cần Thơ, 47 trang.
32. Mygolomba, T.N. and J.A. Plumb, 1992. Longevity of E. ictaluri in the
organs of experimentally infected channel catfish, Ictalurus puntatus.
Aquaculture. 100: 1-6.
33. Nguyễn Phú Son và ctv, 2003. Nghiên cứu thị trường cá tra, cá basa ở
Đồng Bằng Sông Cửu Long. Dự án nghiên cứu hợp tác giữa Đại học
Stirling – Scotland và Đại học Cần Thơ.




30

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
34. Nguyễn Quốc Thịnh, 2002. Bước đầu nghiên cứu mô bệnh học đốm
trắng trong nội tạng cá tra (Pangasius hypophthalmus). Luận văn Đại
học-Khoa Nông Nghiệp-Đại học Cần Thơ.
35. Nguyễn Quốc Thịnh, 2006. Điều tra đánh giá ảnh hưởng của việc sử
dụng thuốc và hóa chất trong quá trình nuôi cá tra bè. Khoa Thuỷ Sản-
Đại học Cần Thơ.
36. Nguyễn Tấn Duy Phong, 2008. Điều tra hiện trạng nuôi, bệnh và tình
hình sử dụng thuốc-hóa chất trong nuôi thâm canh cá tra ao
(Pangasianodon hypophthalmus). Luận văn Đại học-Khoa Thủy Sản-
Đại học Cần Thơ, 84 trang.
37. Nguyễn Thanh Phương, Phạm Minh Đức, Vũ Nam Sơn và Trần Văn
Bùi, 2004. Báo cáo tổng quan ứng dụng công nghệ nhằm nâng cao chất
lượng và hạ giá thành sản phẩm thủy sản (Tôm càng xanh, Cá tra, Cá
basa và Cá rô phi) ở tỉnh An Giang. Sở khoa học & Công nghệ và Khoa
Thủy Sản-Đại học Cần Thơ.
38. Nguyễn Thị Tiên, 2007. Xác định đặc điểm sinh hóa và khả năng kháng
thuốc của mầm bệnh vi khuẩn phân lập trên tôm sú (Penaeus monodon)
bệnh phân trắng. Luận văn Đại học-Khoa Thủy Sản-Đại học Cần Thơ,
48 trang.
39. Nguyễn Trúc Phương, 2008. Tìm hiểu sự khác nhau về các chỉ tiêu sinh
lý và sinh hóa giữa các dòng vi khuẩn Edwardsiella ictaluri xác định
bằng phương pháp sinh hóa truyền thống và API 20E. Luận văn Đại
học-Khoa Thủy Sản-Đại học Cần Thơ, 42 trang.
40. Nguyễn Văn Kiểm, 2004. Giáo trình kỹ thuật sản xuất cá giống-Khoa
Thủy Sản-Trường Đại học Cần Thơ.
41. Phan Thị Mỹ Hạnh, 2004. Nghiên cứu một số ảnh hưởng bệnh vi khuẩn
do Edwardsiella ictaluri trên cá tra (Pangasius hypophthalmus) ở
ĐBSCL. Luận văn Đại học-Khoa Thủy Sản-Trường Đại học Cần Thơ,
47 trang.
42. Plumb, J.A. and Sanchez, D.J, 1983. Susceptibility of five species of
fish to Edwardsiella ictaluri. Journal of Fish Disease. 6, 261-266.
43. Plumb, J.A., 1999. Edwardsiella Septicaemias. Fish diseases and
disorders, Volume 3: Viral, Bacterial and Fungal infections.
44. Reger. P.J., D.F. Mockler, and M.A. Miller. 1993. Comparison of
antimicrobial susceptibility beta-lactamase production, plasmid analysis


31

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
and serum bactericidal activity in Edwardsiella tarda, E. ictaluri and E.
hoshinae. J. Med. Microbitol. 39: 273-281.
45. Shotts, E.B. and Waltman. W. D.,, 1986. Antimicrobial susceptibility
of Edwardsiella ictaluri, Journal of U’ildife Disrasrs. 21 (21.1986),
pp173-177.
46. Stock, I., and Bernd Wiedemann, 2001. Natural Antibiotic
susceptibilities of Edwardsiella tarda, E. ictaluri and E. hoshinac.
Antibiomicrobial Agenrs and chemotherapy, Aug, 2001, P.2245-2255.
47. Tài liệu hướng dẫn thực tập giáo trình chuyên môn bệnh học thủy sản,
2008. Bộ môn sinh học và bệnh thủy sản-Khoa Thủy Sản-Trường Đại
học Cần Thơ, 52 trang.
48. Trần Linh Phước, 2003. Phương pháp phân tích vi sinh vật trong nước,
thực phẩm và mĩ phẩm. Nhà Xuất Bản Giáo Dục.
49. Trần Thị Hồng Tơ, 2004. Khảo sát một số giống vi khuẩn trong 4 mô
hình nuôi thủy sản ở thành phố Cần Thơ và tính nhạy cảm của chúng
với kháng sinh. Luận văn Đại học-Khoa Thủy Sản-Đại học Cần Thơ,
20 trang.
50. Trương Quốc Phú, 2004. Bài giảng quản lý chất lượng nước ao nuôi
thủy sản. Khoa Thủy sản-Đại học Cần Thơ.
51. Từ Thanh Dung, Đặng Thị Hoàng Oanh và Trần Thị Tuyết Hoa, 2005.
Giáo trình bệnh học Thủy Sản-Khoa Thủy Sản-Đại học Cần Thơ.
52. Từ Thanh Dung, M. Crumlish, Nguyễn Thị Như Ngọc, Nguyễn Quốc
Thịnh và Đặng Thụy Mai Thy, 2004. Xác định vi khuẩn gây bệnh trắng
gan trên cá tra (Pangasius hypophthalmus). Tạp chí khoa học Đại học
Cần Thơ 2004: 137-142.
53. Từ Thanh Dung, Nguyễn Thị Như Ngọc, 2006. Bài giảng thực hành
bệnh vi khuẩn trên động vật thủy sản-Khoa Thủy Sản-Đại học Cần
Thơ.




32

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
PHỤ LỤC
Phụ lục 1: thành phần hóa chất các chỉ tiêu thực phản ứng sinh lý, sinh
hóa truyền thống

v Nhuộm Gram

Cho một giọt nước muối sinh lý lên lame.
Dùng que cấy triệt trùng lấy một ít khuẩn lạc trãi đều lên lame.
Để lame khô tự nhiên.
Hơ lướt lame lên ngọn đèn cồn để cố định vi khuẩn, để nguội.
Nhuộm Crystal violet (dung dịch 1) khoảng 1 phút, rửa lame bằng nước.
Nhuộm iodine (dung dịch 2) trong 1 phút, rửa lame bằng nước.
Rửa lame bằng dung dịch alcohol/acetone (dung dịch 3) từ 2-3 giây.
Rửa lame lại bằng nước sạch.
Nhuộm safranin (dung dịch 4) khoảng 2 phút, rửa lại bằng nước sạch và để
khô.
Quan sát lame trên kính hiển vi quang học (40X và 100X)
Vi khuẩn Gram (+): màu xanh / tím.
Vi khuẩn Gram (-): màu hồng

v Tính di động

Cho Vaseline lên 4 góc của lamelle và đặt ngữa lamelle lên bàn.
Dùng pipet tiệt trùng nhỏ một giọt nước cất (hoặc nước muối sinh lý) lên
lamelle.
Dùng que cấy tiệt trùng lấy một ít khuẩn lạc hòa tan vào giọt nước muối trên
lamelle.
Dùng lame đặt nhẹ nhàng lên lamelle sao cho lame không chạm vào giọt nước
chứa vi khuẩn.
Cẩn thận lật nhanh lame để giọt nước được treo ngược trên lamelle
Đặt lame lên kính hiển vi, quan sát tính di động của vi khuẩn ở vật kính 40X

v Phản ứng Oxidase

Chạm nhẹ que thử oxidase vào một khuẩn lạc trên đĩa agar hoặc dùng que cấy
nhặt một khuẩn lạc cho tiếp xúc trên que thử oxidase.
Quan sát que thử trong 30 giây và quan sát sự thay đổi màu sắc: que thử
chuyển màu xanh đậm cho phản ứng oxidase dương tính (+) và không chuyển
màu là âm tính (-).



33

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
v Phản ứng Catalase

Nhỏ một giọt dung dịch H2O2 3% lên lame.
Dùng que cấy triệt trùng lấy một ít vi khuẩn cho vào dung dịch H2O2 3%
Phản ứng Catalase dương tính khi có hiện tượng sủi bọt và ngược lại catalase
âm tính không sủi bọt.

v Khả năng lên men và oxy hóa đường glucose (O/F test)

Chuẩn bị 2 ống nghiệm chứa môi trường O/F đã tiệt trùng.
Dùng que cấy tiệt trùng lấy vi khuẩn trên đĩa agar và cấy thẳng vào 2 ống
nghiệm chứa môi trường O/F, sau đó phủ 0,5-1 ml dầu paraffin tiệt trùng vào
một ống nghiệm tạo điều kiện yếm khí trong ống nghiệm (F), ống còn lại sẽ
kiểm tra tính hiếu khí của vi khuẩn (O).
Để 2 ống nghiệm vào trong tủ ấm 28oC.
Đọc kết quả sau 1-7 ngày
Lên men (F) khi ống có phủ dầu paraffin chuyển màu vàng.
Oxy hóa (O) khi ống không có phủ dầu paraffin chuyển sang màu vàng
Không phản ứng khi 2 ống nghiệm đều màu xanh.
Bảng 3.3: Bảng kiểm tra kết quả test O/F

Ống tiếp xúc không khí Ống phủ dầu paraffin Kết quả
Không phản ứng với
Xanh lá cây Xanh lá cây
glucose
Xanh lơ ở phần trên Xanh lá cây Phản ứng kiềm tính

Vàng Xanh lá cây Phản ứng oxy hóa

Vàng Vàng Phản ứng lên men

v Khả năng sinh H2S

Các bước thực hiện:
1. Môi trường TSI (60g/1000ml nước cất).
2. Đun và khuấy cho tan hoàn toàn.
3. Tiệt trùng ở 121oC trong 15 phút. Để nguội ở 45oC.
4. Cho khoảng 5ml môi trường vào ống nghiệm.
5. Để nghiêng ống nghiệm tạo một mặt phẳng nghiêng.
6. Cấy vi khuẩn trên bề mặt nghiêng và mặt đứng của ống nghiệm. Ủ ở 28oC.
Đọc kết quả sau 14-28 giờ
Vi khuẩn chỉ lên men đường Glucose cho màu đỏ ở phần thạch nghiêng và


34

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
màu vàng ở phần thạch đứng (K (alkaline)/A (acid))
Vi khuẩn lên men đường Glucose và Lactose hoặc Sucrose cho màu vàng ở
phần thạch nghiêng và màu vàng ở phần thạch đứng (A(acid)/A (acid)).
Vi khuẩn chỉ lên men đường Lactose hoặc Sucrose cho màu vàng ở phần
thạch nghiêng và màu đỏ ở phần thạch đứng (A (acid)/K (alkaline)).
Vi khuẩn không lên men đường Glucose, không lên men đường Lactose hoặc
Sucrose cho màu đỏ ở phần thạch nghiêng và màu đỏ ở phần thạch đứng (K
(alkaline)/K (alkaline)).
Vi khuẩn sinh H2S cho màu đen trong ống nghiệm.

v Khả năng sinh indole

Các bước thực hiện:
1. Cho khoảng 3ml môi trường Nutrient broth vào ống nghiệm.
2. Thanh trùng ở 121oC trong 15 phút. Để nguội.
3. Cấy một ít vi khuẩn vào trong ống nghiệm. Để trong tủ ấm ở 28oC.
4. Sau 48 giờ nhỏ vài giọt thuốc thử Kovac’s vào ống nghiệm.
Kết quả: Vi khuẩn sinh Indole sẽ cho phản ứng (+) với một vòng màu hồng
đến đỏ sậm trên bề mặt của môi trường và ngược lại.

v Phản ứng Decarboxylase

1. Môi trường Decarboxylase. Thêm 1% amino acid (Arginine, Lysine,
Ornithine) cho các phản ứng. Môi trường làm đối chứng không có amino acid.
2. Cho 3ml môi trường vào ống nghiệm.
3. Thanh trùng ở 121oC trong 15 phút.
4. Cấy một ít vi khuẩn vào trong 4 ống nghiệm. Sau đó phủ lên mỗi ống 0,5
ml paraffin tiệt trùng. Để trong tủ ấm ở 28oC.
5. Đọc kết quả từ 1-4 ngày. Phản ứng dương tính khi các ống nghiệm có
amino acid chuyển màu khác với màu của ống đối chứng và ngược lại.

v Phản ứng Voges-Proskauer (VP)

1. Môi trường MR-VP broth
2. Cho 3ml môi trường vào trong ống nghiệm.
3. Thanh trùng ở 121oC trong 15 phút. Để nguội.
4. Cấy một ít vi khuẩn vào trong ống nghiệm. Ủ ở nhiệt độ 28oC.
5. Sau 48 giờ nhỏ 0,6 ml dung dịch thuốc thử A và 0,2 ml dung dịch thuốc thử
B vào ống nghiệm.
6. Lắc đều và để ống nghiệm 30 phút.


35

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
7. Đọc kết quả: phản ứng dương tính khi có màu hồng của môi trường xuất
hiện, và ngược lại.
Thuốc thử: A: Hòa tan 5g alpha naphthol trong 100 ml ethyl alcohol.
B: Hòa tan 40g KOH trong 100 ml nước cất.

v Khả năng sử dụng Citrate

1. Môi trường Simmon’s Citrate agar.
2. Đun sôi và khuấy cho tan.
3. Cho 5ml môi trường vào ống nghiệm và thanh trùng ở 121oC trong 15 phút.
4. Để nghiêng để tạo mặt phẳng nghiêng trong ống nghiệm và để nguội.
5. Cấy vi khuẩn trên mặt nghiêng của ống nghiệm, ủ trong tủ ấm 28oC.
6. Đọc kết quả sau 2-7 ngày. Vi khuẩn sử dụng citrate tạo màu xanh lơ trong
môi trường Simmon’s citrate agar và ngược lại.

v Khả năng sử dụng Ure

1. Môi trường 0,1% Pepton + 0,2% KH 2PO4 + 0,0012% Phenol red + 0,1%
Glucose, thêm 2% Urea cho phản ứng. Môi trường đối chứng không có urea.
2. Cho 3 ml môi trường vào trong ống nghiệm.
3. Thanh trùng ở 121oC trong 15 phút.
4. Cấy một ít vi khuẩn vào trong hai ống nghiệm. Để trong tủ ấm 28oC.
5. Đọc kết quả trong vòng 2 ngày. Phản ứng dương tính khi các ống nghiệm có
urea chuyển sang màu hồng.

v Khả năng sử dụng các loại đường

1. Môi trường: Các dung dịch đường Glucose, Sucrose, Sorbitol, Inositol,
Arabinose, Rhamnose, Trehalose.
2. Cấy vi khuẩn vào các ống nghiệm. Ủ trong tủ ấm ở 28oC.
3. Sau 48 giờ đọc kết quả. Phản ứng dương tính khi ống nghiệm chuyển sang
màu vàng và ngược lại.




36

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Bảng 3.4: Các chỉ tiêu định danh E. ictaluri bằng phương pháp sinh
hóa truyền thống.
STT Chỉ tiêu test
1 Nhuộm Gram
2 Hình dạng
3 Oxidase
4 Catalase
5 Khả năng lên men
6 Tính di động
7 Arginine
8 Lysin
9 Ornithine
10 Khả năng sử dụng nitrate
11 Khả năng sử dụng citrate
12 Khả năng sinh H2S
13 Khả năng sinh urea
14 Khả năng sinh indole
15 Phản ứng VP
Khả năng sử dụng các loại đuờng
16 Arabinose
17 Glucose
18 Innositol
19 Mannitol
20 Rhamnose
21 Sorbitol
22 Sucrose




37

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Phụ lục 2
Các bước chuẩn bị và thực hiện kiểm tra API 20E
Xác định các chỉ tiêu cơ bản như ở trên.
Các bước chuẩn bị
- Cho một ít nước cất hoặc nước máy vào khay nhựa của bộ kít để giữ
ẩm trong quá trình ủ trong tủ ấm.
- Đặt kít API vào khay nhựa
- Dùng que cấy tiệt trùng lấy một ít khuẩn lạc cho vào 5 ml nước muối
sinh lý hoặc nước cất tiệt trùng, lắc trộn đều.
Các bước thực hiện
- Dùng pipet tiệt trùng hút dung dịch vi khuẩn cho vào các ô CIT, VP
và GEL.
- Tương tự cho vi khuẩn vào đầy phần tuýp các ô ADH, LDC, ODC,
H2S và URE. Tiếp theo cho dầu paraffin tiệt trùng vào phần lõm của
các ô này.
- Đậy nắp khay và ủ trong tủ ấm ở 28oC và đọc kết quả sau 48 giờ.
Đọc kết quả
+ Các chỉ tiêu cần sử dụng thuốc thử
- TDA: nhỏ một giọt thuốc thử TDA vào ô TDA, đọc kết quả sau vài
giây. Nếu có một màu nâu đỏ nhạt xuất hiện cho phản ứng dương
tính (+), màu vàng cho phản ứng âm (-).
- IND: cho một giọt thuốc thử IND vào ô IND, đọc kết quả sau vài
giây. Nếu có màu hồng xuất hiện cho phản ứng dương tính (+), màu
vàng hoặc màu xanh nhạt xuất hiện cho phản ứng âm tính (-).
- VP: nhỏ một giọt thuốc thử VP1 sau đó cho một giọt VP2 vào ô VP,
đọc kết quả sau 10-15 phút. Màu hồng hoặc màu đỏ xuất hiện cho
phản ứng dương tính (+), không có màu xuất hiện cho phản ứng âm
tính (-).
+ Các chỉ tiêu còn lại không cần sử dụng thuốc thử, kết quả được đọc dựa
vào bảng chỉ tiêu.
• Sau khi cho thuốc thử vào các ô TDA, IND và VP đậy nắp khay nhựa lại.
• Khi cho thuốc thử vào các chỉ tiêu trên không nên đem ủ trở lại trong tủ
ấm.




38

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Bảng 3.5: Cách đọc kết quả bộ kít API
STT Chỉ tiêu Thành phần Âm tính Dương tính
1 ONPG Ortho-notrophenyl galactoxydase Không màu Vàng
2 ADH Arginine Vàng Đỏ/ cam
3 LDC Lysine Vàng Đỏ/ cam
4 ODC Ornithine Vàng Đỏ/ cam
Xanh nhạt/ Xanh lá cây/
5 CIT Sodium citrate
vàng xanh biển
Không màu/
6 H2S Sodium thiosulphate Đen
xám nhạt
7 URE Urea Vàng Đỏ/ cam
8 TDA L-Tryptophane Vàng Nâu đỏ nhạt
Xanh nhạt/
9 IND L-Tryptophane Hồng
vàng
10 VP Sodium Pyruvate Không màu Hồng/ đỏ
Không xuất Khuếch tán màu
11 GEL Gelatin
hiện màu đen đen
Xanh/ xanh lá
12 GLU D-glucose Vàng
cây
Xanh/ xanh lá
13 MAN D-mannitol Vàng
cây
Xanh/ xanh lá
14 INO Innositol Vàng
cây
Xanh/ xanh lá
15 SOR D-sorbitol Vàng
cây
Xanh/ xanh lá
16 RHA L-rhamnose Vàng
cây
Xanh/ xanh lá
17 SAC D-sucrose Vàng
cây
Xanh/ xanh lá
18 MEL D-melibiose Vàng
cây
Xanh/ xanh lá
19 AMY Amygdalin Vàng
cây
Xanh/ xanh lá
20 ARA L-arabinose Vàng
cây




39

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Phụ lục 3
Bảng 4.6 Dấu hiệu bên trong và bên ngoài của các mẫu cá

Chất dịch Cơ quan
ST Dấu hiệu bên phân lập
KH mẫu Dấu hiệu bên ngoài trong cơ
T trong
thể G T TT
Xuất huyết các vi, da Thận và tỳ tạng có
1 MX2.1 x x
thân, nắp mang đốm trắng
Gan, thận và tỳ
Xuất huyết các vi, da
2 MX2.2 tạng có đốm trắng.
thân, nắp mang
Gan nhạt màu
Xuất huyết cơ bụng, Gan, thận, tỳ tạng
3 MX2.3 x x x
vùng mắt có đốm trắng
Xuất huyết các vi, Thận, tỳ tạng có
4 MX2.4 Dịch trong x x
hậu môn, da bụng đốm. Gan tái nhạt
Xuất huyết vi bụng,
5 MX2.5 Bình thường
hậu môn
6 MX2.6 Bình thường Bình thường
Thận, tỳ tạng có
Xuất huyết các vi, da
7 MX3.1 đốm trắng. Thận bị Dịch trong
bụng
nhủn.
G-T-TT có đốm
8 MX3.2 Xuất huyết các vi Dịch trong
trắng
G-TT có đốm.
9 MX3.3 Xuất huyết vi bụng Thận nhủn. Gan Dịch trong x x x
nhạt màu
Xuất huyết các vi, da G-TT có đốm
10 MX3.4 Dịch trong x
bụng trắng. Thận nhủn
Xuất huyết các vi,
11 MX3.5 Bình thường
miệng
12 MX3.6 Xuất huyết các vi Bình thường
Gan trắng nhạt.
13 MX4.1 Bình thường Bóng hơi sưng. TT Dịch trong
có đốm trắng
Gan trắng nhạt.
14 MX4.2 Bình thường Dịch trong
Bóng hơi sưng
Xuất huyết vi ngực,
15 MX4.3 Gan trắng nhạt
vi bụng
16 MX4.4 Bình thường Gan trắng nhạt Dịch trong
17 MX4.5 Xuất huyết các vi Bình thường
Xuất huyết vi bụng,
18 MX4.6 Bóng hơi sưng
đuôi
Xuất huyết vi ngực, Thận nhủn. TT có
19 MX5.1 x
da bụng đốm.
20 MX5.2 Xuất huyết các vi G-T-TT có đốm Dịch vàng x x x
G-TT có đốm.
21 MX5.3 Xuất huyết các vi Thận nhủn. Bóng x x
hơi trương to
Xuất huyết các vi, da Gan trắng nhạt. TT
22 MX5.4
bụng có đốm



40

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Xuất huyết vi hậu
23 MX5.5 Bình thường
môn
24 MX5.6 Xuất hưyết miệng Bình thường
Vi bị ăn mòn đến hậu Thận nhủn, có đốm
25 MX13.1 Dịch trong x x
môn trắng. TT sưng
26 MX13.2 Cơ đuôi bị ăn mòn Thận có đốm trắng x x
Xuất huyết các vi. Dịch trong,
27 MX13.3 T-TT có đốm trắng
Đuôi bị ăn mòn có mùi hôi
G-T-TT có đốm Dịch trong
28 MX13.4 Đuôi bị ăn mòn x x
trắng có mùi hôi
29 MX13.5 Xuất huyết các vi Bình thường
30 MX13.6 Bình thường Bình thường
31 CA1.1 Bình thướng Gan trắng nhạt
Xuất huyết thành
32 CA1.2 Xuất huyết các vi x x
bụng
Dịch trắng
33 CA1.3 Xuất huyết da bụng Gan nhạt x x
đục và hôi
34 CA1.4 Bình thường Gan vàng Dịch vàng
Xoang bụng có mùi
35 CA1.5 Bình thường
hôi
36 CA1.6 Bình thường Thận có đốm trắng
G-T có nhiều đốm
37 CA2.1 Bình thường x x
trắng
Thận có đốm trắng.
38 CA2.2 Bình thường Dịch trong
Bóng hơi sưng
39 CA2.3 Bình thường G-T có đốm trắng Dịch vàng x
Gan trắng nhạt.
40 CA2.4 Bình thường
Thận có đốm trắng
41 CA2.5 Bình thường Gan nhạt màu
42 CA2.6 Bình thường Bình thường
G-T-TT có đốm
43 CA3.1 Bình thường x x x
trắng
44 CA3.2 Xuất huyết các vi G-T có đốm trắng x x
G-T có đốm trắng.
45 CA3.3 Bình thường
Thận trước sưng
G-T-TT có đốm
46 CA3.4 Bình thường trắng. Bóng hơi Dịch vàng x x
sưng
Gan nhạt màu.
47 CA3.5 Bình thường Xoang bụng có mùi
hôi
48 CA3.6 Bình thường Bình thường
Xuất huyết các vi. Gan có đốm trắng.
49 CA4.1 x x x
Mang nhạt màu T-TT sưng
Gan nhạt màu. T-
50 CA4.2 Xuất huyết da bụng Dịch vàng x x x
TT có đốm trắng
G-T-TT có đốm
51 CA4.3 Xuất huyết thân x
trắng
52 CA4.4 Xuất huyết thân, G-T-TT có đốm x x x


41

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
bụng trắng. T-TT sưng
53 CA4.5 Bình thường Bình thường
Xuất huyết vi đuôi,
54 CA4.6 Bình thường
quanh miệng
Xuất huyết nhẹ. Vi Xuất huyết nội
55 CS1.1
đuôi bị đứt ngang quan
Xuất huyết thành Dịch có
56 CS1.2 Cơ bị thối rửa
bụng mùi hôi
57 CS1.3 Lở loét toàn thân Thận nhủn
58 CS1.4 Xuất huyết các vi Gan có đốm trắng Dịch trong
Lở loét, xuất huyết Gan nhủn, có đốm Dịch nhày,
59 CS2.1
các vi trắng có mùi hôi
Vi đuôi bị đứt, xuất G-T-TT có đốm
60 CS2.2 Dịch trong x x x
huyết các vi trắng
Lở loét nặng. Xuất Gan tái nhạt. TT
61 CS2.3
huyết các vi sưng
G-T-TT có đốm
62 TT1.1 Bình thường Dịch vàng x x
trắng
Gan có màu không
63 TT1.2 Bình thường đồng nhất. T-TT có Dịch vàng x x
đốm trắng
G-T-TT có đốm
64 TT1.3 Xuất huyết hậu môn trắng. Thận nhủn. x x x
Ruột sưng
G-T-TT có đốm
65 TT1.4 Xuất huyết vi lưng Dịch vàng x x
trắng
66 TT1.5 Bình thường Bình thường
67 TT1.6 Bình thường Bình thường
Xuất huyết nắp mang,
68 TT2.1 Gan nhạt màu
phù mắt
69 TT2.2 Xuất huyết các vi Gan nhạt màu
Gan nhạt màu.
70 TT2.3 Bình thường Dịch vàng x x x
Thận có đốm trắng
G-T-TT có đốm
71 TT2.4 Bình thường Dịch vàng x x
trắng
72 TT2.5 Bình thường Gan nhạt màu
73 TT2.6 Bình thường Bình thường
Gan nhạt màu. T-
74 SD1.1 Bình thường Dịch trong x x x
TT có đốm
Gan nhạt màu. T-
75 SD1.2 Bình thường Dịch vàng x x x
TT có đốm trắng
Gan nhạt. Thận
Xuất huyết vi hậu
76 SD1.3 nhủn. TT có đốm Dịch trong x x
môn
trắng
77 SD1.4 Bình thường T-TT có đốm trắng x x x
Gan nhạt màu.
78 SD1.5 Bình thường
Thận có đốm trắng
Gan nhạt màu.
Dịch màu
79 SD1.6 Bình thường Thận sưng, có đốm
hồng
trắng


42

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Gan nhạt màu. Nội
80 SD2.1 Bình thường
quan xuất huyết
81 SD2.2 Sưng hầu Bình thường
G-T-TT có đốm
82 SD2.3 Xuất huyết các vi Dịch vàng x
trắng
83 SD2.5 Bình thường Bóng hơi trương to
84 SD2.6 Bình thường Gan nhạt màu
85 SD3.1 Xuất huyết các vi Bóng hơi trương to
86 SD3.2 Xuất huyết các vi Gan nhạt màu
87 SD3.3 Xuất huyết các vi Gan nhạt màu Dịch vàng
88 SD3.5 Xuất huyết các vi Gan, thận nhạt màu
Xuất huyết các vi.
89 SD3.6 Gan nhạt màu
Đuôi bị ăn mòn
Phù mắt, hàm dưới Xuất huyết nội
90 TN1.1 sưng, xuất huyết tạng. Gan có đốm
quanh mắt trắng
Xuất huyết thân, da
91 TN1.2 Thận có đốm trắng Dịch vàng x x
bụng
T-TT có đốm trắng.
92 TN1.3 Bình thường Dịch vàng x x x
Gan nhạt màu
93 TN1.4 Bình thường Bình thường
Xuất huyết các vi, da
94 TN1.5 Bình thường
bụng
Xuất huyết da bụng,
95 TN1.6 Bình thường
hậu môn
Xuất huyết các vi, Dịch có
96 TN2.1 Xuất huyết nội tạng
hầu, hốc mắt mùi hôi
97 TN2.2 Trắng các vi G-T có đốm trắng x x x
Xuất huyết da bụng, Dịch có
98 TN2.3 Xuất huyết cơ bụng
hậu môn mùi hôi
Xuất huyết hầu, vi Xuất huyết trên
99 TN2.4
ngực. Phù mắt ruột
100 TN2.5 Xuất huyết thân Bình thường
101 TN2.6 Bình thường Bình thường Dịch vàng

Ghi chú : G: Gan
T: Thận
TT: Tỳ tạng




43

PDF created with FinePrint pdfFactory Pro trial version http://www.fineprint.com
Đề thi vào lớp 10 môn Toán |  Đáp án đề thi tốt nghiệp |  Đề thi Đại học |  Đề thi thử đại học môn Hóa |  Mẫu đơn xin việc |  Bài tiểu luận mẫu |  Ôn thi cao học 2014 |  Nghiên cứu khoa học |  Lập kế hoạch kinh doanh |  Bảng cân đối kế toán |  Đề thi chứng chỉ Tin học |  Tư tưởng Hồ Chí Minh |  Đề thi chứng chỉ Tiếng anh
Theo dõi chúng tôi
Đồng bộ tài khoản