intTypePromotion=1

Báo cáo nghiên cứu nông nghiệp " Báo cáo sơ bộ kết quả nghiên cứu biến dị di truyền microsatellite loci cá rô phi "

Chia sẻ: Nguyen Nhi | Ngày: | Loại File: PDF | Số trang:12

0
60
lượt xem
9
download

Báo cáo nghiên cứu nông nghiệp " Báo cáo sơ bộ kết quả nghiên cứu biến dị di truyền microsatellite loci cá rô phi "

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Để nghiên cứu biến dị di truyền của quần đàn cá rô phi (Oreochromis niloticus) lai tạo, 1065 mẫu cá rô phi trong 9 quần đàn lai tạo được đánh giá về kiểu gene thông qua 4 microsatellite markers bao gồm IGF-MSO3, UNH 104, UNH 124 và UNH 216. Tỷ lệ dị hợp tử thực tế và lý thuyết cùng tần số các alleles được tính toán để xác định biến dị di truyền trong mỗi quần đàn và trong các quần đàn với nhau. Cả 4 microsatellite loci đều thể hiện đa hình trong đó số alleles là 5,...

Chủ đề:
Lưu

Nội dung Text: Báo cáo nghiên cứu nông nghiệp " Báo cáo sơ bộ kết quả nghiên cứu biến dị di truyền microsatellite loci cá rô phi "

  1. Báo cáo sơ bộ kết quả nghiên cứu biến dị di truyền microsatellite loci cá rô phi TS. Phạm Anh Tuấn CN. Nguyễn Thị Tần KS Lê Quang Hưng Tóm tắt Để nghiên cứu biến dị di truyền của quần đàn cá rô phi (Oreochromis niloticus) lai tạo, 1065 mẫu cá rô phi trong 9 quần đàn lai tạo được đánh giá về kiểu gene thông qua 4 microsatellite markers bao gồm IGF-MSO3, UNH 104, UNH 124 và UNH 216. Tỷ lệ dị hợp tử thực tế và lý thuyết cùng tần số các alleles được tính toán để xác định biến dị di truyền trong mỗi quần đàn và trong các quần đàn với nhau. Cả 4 microsatellite loci đều thể hiện đa hình trong đó số alleles là 5, 4, 3 và 3 tương ứng với các locus IGF-MSO3, UNH216, UNH 124 và UNH 104. Tỷ lệ dị hợp tử lý thuyết cao nhât ở locus IGF-MSO3 (0.77) và thấp nhất ở locus UNH124 (0.66), trong khi đó tỷ lệ dị hợp tử thực tế cao nhất ở locus UNH 216 (0.98) và thấp nhất ở locus UNH 104 (0.57). Tỷ lệ dị hợp tử lý thuyết trên các quần đàn dao động từ 0,63 đến 0,69 còn tỷ lệ dị hợp tử thực tế dao động từ 0,56 đến 0,83 trên tất cả các loci. Có hai nhánh chính trong cây di truyền, nhánh thứ nhất gồm các quần đàn 1, 7, 8, và 9 và nhánh thứ hai gồm quần đàn 2, 3, 4, 5, 6. Trong đó, quần đàn 3 và 4, 5 và 6, 8 và 9 là rất gần nhau về khoảng cách di truyền. 1. Đặt vấn đề Mặc dù cá rô phi có nguồn gốc từ châu Phi và vung Trung Đông, nhưng chúng đã trở thành đối tượng nuôi thủy sản quan trọng hầu khắp thế giới và được nuôi rộng rãi trên 100 quốc gia (Romana- Eguia et al., 2004). Sản lượng lớn nhất của cá rô phi là từ châu á và vùng Đông Dương. Theo ước tính, 80% sản lượng cá rô phi nuôi trên thế giới là từ châu á, trong đó Trung Quốc là nước cung cấp cá rô phi lớn nhất. Loài O. niloticus đứng thứ 8 trong bảng sếp hạng sản lượng nuôi của thế giới năm 2004 (sấp xỉ 1,5 triệu tấn với giá trị 1,6 tỷ USD). Sản lượng cá rô phi cũng tăng mạnh từ năm 1995 đến 2004 là khoảng 2,6 lần về sản lượng và 2,2 lần về giá trị. Theo ước tính, sản lượng và giá trị kinh tế của cá rô phi năm 2004 là 1,82 triệu tấn và đạt 2,2 tỷ USD (FAO, 2005). Cá rô phi không 1
  2. chỉ được nuôi rộng rãi ở nhiều nước, chúng còn là nguồn cung cấp protein thiết thực ở các nước đang phát triển (Agnese et al., 1997). Cá rô phi, nhất là loài O. niloticus sở hữu một trong những đặc điểm nổi bật là dễ dàng cho sinh sản, có sức chống chịu cao với điều kiện môi trường thay đổi, chúng sử dụng có hiệu quả nguồn thức ăn hàm lượng protein thấp và có sức chống đỡ cao với nguồn lây bệnh và stress (Hassanien & Gilbey, 2005). Mặc dù chúng được nuôi phổ biến ỏ nhiều nước, nhưng hiểu biết của chúng ta về cơ sở di truyền quần đàn tự nhỉên còn rất hạn chế (Agnese et al., 1999). Trong khi đó, kỹ thuật nuôi trồng thủy sản bền vững lại đòi hỏi có sự quản lý về mặt di truyền và việc này là rất quan trọng để hiểu hơn nữa về các nhóm di truyền quần đàn so với các quần đàn ban đầu (Hassanien & Gilbey, 2005). Việc hiểu biết về cấu trúc di truyền quần đàn có thể giúp ích nhiều trong các công việc như nghiên cứu đa dạng di truyền quần đàn, nghiên cứu bảo tồn di truyền hoặc dùng trong nâng cao phẩm giống. Có nhiều phương pháp đánh giá và xác định di truyền cá rô phi đã được sử dụng. Trong đó phải kể đến là phương pháp đánh giá enzyme (Rognon et al., 1996), phương pháp đa hình độ dài phân đoạn giới hạn trong ty thể ADN (mt DNA - RFLPs), phương pháp ADN đa hình khuếch đại ngẫu nhiên (RAPD)(Romana-Eguia et al., 2005) và phương pháp microsatellite marker. Trong các phương pháp trên, microsatellite marker là phương pháp hiệu quả đa năng được ứng dụng nhiều trong nghiên cứu hệ sinh thái, tiến hóa và bảo tồn (Wirgin & Waldman, 1994; O'Connell & Wright, 1997). Ơr cá rô phi, phương pháp này được áp dụng rộng rãi để đánh giá đa dạng di truyền (Hassanien & Gilbey, 2005), mức độ cận huyết (Palti et al., 2002), cấu trúc quần thể và dòng chảy gene. Với nhiều ứng dụng trong di truyền quần thể như trên, chúng tôi sử dụng các microsatellite loci để nghiên cứu đánh giá mức độ biến dị di truyền quần đàn cá rô phi lại tạo ở Viện nghiên cứu nuôi trồng thủy sản 1. Chúng tôi đã tiến hành nghiên cứu đa hình của 4 microsatellite markers trên 9 quần đàn cá rô phi lai tạo. 2
  3. 2. Vật liệu và phương pháp nghiên cứu 2.1. Phương pháp thu mẫu Thu mẫu trên 9 quần đàn cá rô phi lai tạo theo bảng 1. Ba muơi mẫu vây cá rô phi từ mỗi quần đàn được thu ngẫu nhiên và cố định trong cồn ethanol 100% và đựng trong lọ effendof 1,7ml. Các mẫu được ghi số theo công thức (ct) hay quần đàn từ 1 đến 9. Các mẫu cá rô phi này được thu từ Trung tâm quốc gia giống thủy sản nước ngọt Hải Dương và được đưa về Phòng di truyền, Viện nghiên cứu nuôi trồng Thủy sản I để xử lý và làm tiếp các bước tiếp sau. Bảng 1. Các công thức lai của các quần đàn giữa các dòng GIFT, RIA#1, Taiwan ♂ GIFT RIA#1 TAIWAN (DL) ♀ CT 1 CT 4 CT 7 GIFT ♀ GIFT x ♂ GIFT ♀ GIFT x ♂ RIA#1 ♀ GIFT x ♂ TAIWAN CT 2 CT 5 CT 8 RIA#1 ♀ RIA#1 x ♂ GIFT ♀ RIA#1 x ♂ RIA#1 ♀ RIA#1 x ♂TAIWAN CT 3 CT 6 CT 9 TAIWAN (DL) ♀ TAIWAN x ♂ GIFT ♀ TAIWAN x ♂ RIA#1 ♀ TAIWAN x ♂ TAIWAN (CT: công thức lai) 2.2. Tách chiết ADN Trọng lượng trung bình của mẫu tách chiết ADN tổng số khoảng 20-30mg. ADN tổng số tách bằng dung dịch nghiền mẫu Cell Lysis Solution (10 mM Tris, 100 mM EDTA, 2% SDS pH 8.0) kết hợp với proteinaseK, ủ ở 65oC trong 2 giờ. Kết tủa và ly tâm loại bỏ protein bằng 7.5M ammonium acetate. Kết tủa ADN trong isopropanol và rửa bằng ethanol 70%. Hoà tan và bảo quản ADN trong dung dịch TE pH 8.0 (10 mM Tris, 0.1 mM EDTA). 2.3. Microsattellite Lựa chọn primer: Bốn cặp primer đã được nghiên cứu trong thí nghiệm này là: IFG-MSO3, UNH216, UNH104, UNH124. Chúng đựoc mua từ hãng Alpha DNAvà được trình bày theo bảng 2. 3
  4. Bảng 2. Microsatellite loci, trình tự nucleotide từ đầu 5’ tới 3’ và nhiệt độ gắn mồi Nhiệt gắn mồi (oC) Trình tự (5’ -3’) Primers (Tann) UNH 104 F GCAGTTATTTGTGGTCACTA 54 UNH 104 R GGTATATGTCT¢CTGAATCC 54 UNH 124 F AATTTGGCAGCTTCTTTT 50 UNH 124 R CCCACAAGCATAGTAAACT 50 UNH 216 F GGGAAACTAAAGCTGAAATA 50 UNH 216 R TGCAAGGAATATCAGCA 50 IGF-MSO3 F ATGCTAGCAAACATCAAAGGTC 58 IGF-MSO3 R GATATGCTGATGATGCACAGAGTC 58 Tối ưu phản ứng PCR Trước hết tối ưu phản ứng PCR với nồng độ MgCl2 và nồng độ dNTPs để có kết quả PCR tốt nhất. Chu trình nhiệt của phản ứng PCR: Chế độ chạy tối ưu là 7 chu kỳ ở 94oC trong 1phút; 30 giây cho nhiệt gắn mồi tối ưu, 72oC trong 30giây và 33 chu kỳ ở 90oC trong 1 phút; 30giây nhiệt gắn mồi tối ưu và 72oC trong 30 giây (Romana-Eguia et al., 2004). Tuỳ từng Primer mà có nhiệt độ bắt cặp mồi khác nhau: primer UNH216 nhiệt độ gắn mồi là 50oC, primer UNH104 là 54oC, primer UNH124 là 50oC, primer IFG-MSO3 là 58oC. Chuẩn bị chạy microsatellite Xử lý các tấm kính Các tấm kính được xử lý với ethanol 70% v/v, sau đó là nước cất khử ion, rồi đến một lượng nhỏ cồn 70%, rồi lau khô kính. Tấm kính to bên ngoài được xử lý bằng hỗn hợp 5 ỡL dung dịch Bind Silane (Sigma) và 2 mL dung dịch xử lý kính (95% v/v cồn, 0.5% v/v acetic acid). Sau 5 phút, 4
  5. tấm kính được lau nhẹ nhàng với cồn 95% v/v theo một hướng, và vuông góc với hướng đó. Năm phút sau lặp lại bước này. Tấm kính nhỏ (bao gồm buồng chứa dung dich đệm phía trên) được phủ một 1 mL Repel Silane (Pharmacia). Năm phút sau, rửa tấm kính nhỏ với nước cất khử ion và để khô trong 5 phút ở 37oC. Xử lý và cài đặt các thiết bị sequencing phụ trợ Máng và lược của máy điện di được rửa sạch với cồn 70% v/v. Các trang thiết bị Sequi-Gen được lắp ráp theo hướng dẫn của nhà cung cấp máy (Bio-Rad). Chuẩn bị bản Gel Hỗn hợp ở bảng 3 được chuẩn bị bằng cách lắc tất cả hóa chất trong một ống đong có bịt kín bằng giấy parafin. Dung dịch này được đổ vào khay đúc ở đó thiết bị máy Sequi-Gen được đặt thẳng đứn tới khi gel đông được lắp đặt. Bảng 3. 6% v/v dung dịch gel gốc polyacrylamide, gel plug và hỗn hợp gel siêu mỏng. Gel siêu mỏng2 Thành phần 6% dd gốc1 Gel 2 Dung dịch 40 % Acrylamide/bis (19:1) 150 mL Urea (siêu tinh khiết) 480.5 g 30 mL 60 mL 5 x TBE 200 mL sdH2O 650 mL TEMED - 150 µL 60 µL Ammonium persulphate (25% v/v) - 150 µL - Ammonium persulphate (10% v/v)3 - - 280 µL 1 Urea siêu tinh khiết được hòa trong 500 mL dH2O, cho thêm 150 mL dung dịch acrylamide/bis và 200 ml dung dịch 5 x TBE . Sau đó cho nước cất khử trùng và ion để đạt tới 1 lít dung dịch. 2 Ammonium persulphate và TEMED luôn được cho cuối cùng theo thứ tự trên. 3 10% ammonium persulphate được pha tươi. Đổ bản gel siêu mỏng Hỗn hợp đổ gel siêu mỏng dựa theo bảng 3. Các thiết bị của máy Sequi-Gen đã được chuẩn bị sẵn và đặt nghiêng khoảng 45 độ so với mặt phẳng. Dung dịch gel được tiêm vào từ phía góc dưới của phần mở cuối do vậy không khí sẽ dồn lên trên khi dung dịch tràn vào, nhằm tránh bọt khí 5
  6. hình thành trong bản gel. Lược giếng mẫu được cắm phần cuối vào thẳng khoảng 0.5 mm vào bản gel . Bản gel để đông khoản 60-90 phút ở nhiệt độ phòng. Chạy thử gel Khoang dung dịch đệm được đổ 350 mL TBE 1x , trong khi đó phần khoang trên được đổ khoảng 0.5 cm tính từ đỉnh máng bằng TBE 1x (xấp sỉ 500 mL). Lược giếng mẫu được nhấc ra từ giữa hai tấm kính. Các giếng mẫu được rửa kỹ băng TBE 1x để loại Urea tích tũy. Chỉ thị nhiệt độ được điều chỉnh một nửa dựa theo mặt ngoài của tấm khính ngoài. Bản gel được chạy thử ở 60 W trong khoản 1 giờ để làm nóng bản gel tới 50-55oC. Các giếng được rửa lại như trên. Luợc giếng được làm sạch bằng cồn, sấy khô, cắm theo chiều lược vào bản gel. Chuẩn bị, chấm mẫu và chạy mẫu PCR Các mẫu được chuẩn bị với tỷ lệ 4 ỡL dung dịch đệm formamide loading (FLB) tới 12 ỡL mẫu PCR. Các mẫu này được denatured ở 95oC trong 4 phút sau đó giữ trong đá. Một thang chuẩn được chuẩn bị bằng trộn 2 ỡL thang 10 bp DNA (Invitrogen) với 10 ỡL FLB và denature mẫu này ở 70oC trong 5 phút. Năm ỡL của mỗi mẫu được chấm vào giếng từ 2-23. Hai mẫu chuẩn được cho vào giếng 1 và 24. Bản gel được chạy đầu tiên ở 30 W trong 5 phút để giúp mẫu di chuyển trong bản gel, sau đó chạy ở 52 W khoản 1.5-2.5 giờ. Quá trình sản phẩm PCR chạy xuống trong bản gel được theo dõi bằng tỷ lệ di chuyển của bromophenol blue và chất nhuộm cylene cyanol (có trong FLB). Sau khi chạy xong, bỏ các cặp điện ra, tách nhẹ các miếng kính ra để nhuộm bản gel. Nhuộn bạc ADN Chất nhuộm bạc không gây đột biến dược mô tả theo Ludwig et al. (1989) và Caetano- Anolles et al. (1991) được sử dụng để phân giải các mảnh PCR. Tất cả các bước được tiến hành trong máy lắc (Edwards Instruments Company) trừ trường hợp đặc biệt. Các bản Gel được rửa và cố định bằng dung dịch Fix 1 trong 30 phút (1 lần), sau đó đặt vào dung dịch tươi Fix 2 khoảng 15 min (2 lần). Bản gel được oxy hóa với dung dịch acid nitric 1% v/v 6
  7. đúng 5 phút. Rồi bản Gel được nhúng trong nước mới cất dH2O (2 lần) và đặt trong dung dịch Bạc nitrate 0.012 M trong 30 phút. Bản gel được ngâm nước mới cất đúng 5 giây (2 lần). Sự xuất hiện băng vạch phải nhờ vào 3 lần thay đổi dung dịch phát triển đã làm lạnh ở 10oC khoản 30 giây, 5 phút và cho tới khi băng đạt tiêu chuẩn xuất hiện. Phản ứng lên màu được ngưng bằng việc ngâm bản gel vào dung dịch 10% acetic acid trong 5 phút. Bản gel được nhúng vào nước cất và làm khô ở nhiệt độ phòng để giúp giữ bản gel lâu hơn. 2.4. Ghi và phân tích số liệu Bản gel được chụp ảnh và ghi kết quả với những băng vạch được đối chiếu với các bản gel khác nhau. Nếu cá thể xuất hiện một băng là allele đơn, hay ở trang thái đồng hợp tử. Cá thể là dị hợp tử khi có hai allele hay hai băng với độ nét tương đương. Kết quả đọc các alleles được mã hóa bằng phần mềm Excel sau đó được nhập vào chương trình phân tích di truyền quần thể TFPGA (Miller, 1997). 3. Kết quả 3.1. Biến dị của cá rô phi trên các microsatellite loci Các microsatellite loci trong nghiên cứu này đều thể hiện sự đa hình trong cả 9 quần đàn cá rô phi (bảng 4). Số lượng allelles dao động từ 3-5, ở locus IGF-MSO3 là thể hiện sự đa hình nhất, có 5 alleles tất cả và tần suất cao nhất là ở allele D (26,85%) , rồi đến B (24,54%) và C (23,84%) trong khi tần suất allele E rất thấp (0,0625) khoảng 6,25%. Locus UNH216 chỉ có 4 alleles (ABCD), còn lại loci UNH124 và UNH104 chỉ xuất hiện 3 alleles (ABC). Ơ loci UNH216, alleles A và C là xấp xỉ nhau, chiếm 32,74% và 31,17%, còn alleles B và D là 18,16% và 17,94%. Ơ loci UNH104, tần suất của các alleles là khá đều nhau, với 30,62%, 35,02% và 34,36% tương ứng với allele A, B, C. Ơ loci UNH124, allele A và B là có tần suất cao nhất, 44,95% và 36,30% tương ứng, còn allele C chỉ có 18,75%. Bảng 4 cũng thể tỷ lệ dị hợp tử lý thuyết và thực tế theo từng loci trên toàn bộ các quần đàn cá rô phi nghiên cứu. Tỷ lệ dị hợp tử cao nhất là ở locus IGF-MSO3 với tần suất là (0,7726), tiếp đó là ở loci UNH216 (0,7305), sau đó mới đến UNH104 (0,6655) và cuối cùng là UNH124 (0,7305). Trái 7
  8. với tỷ lệ dị hợp lý thuyết, tỷ lệ dị hợp tử thực tế lại thấp nhất ở loci IGF-MSO3 (0,5324) và cao nhất ở loci UNH216 (0,9821). Tỷ lệ dị hợp thực tế ở loci UNH 124 và UNH104 là gần tương đương nhau (0,5817 và 0,5727) tương ứng. Bảng 4. Biến dị của cá rô phi ở 4 microsatellite loci và tần suất alleles và dị hợp tổ Locus Alleles He Ho A B C D E IGF-MSO3 5 0.7726 0.5324 0.1852 0.2454 0.2384 0.2685 0.0625 UNH 216 4 0.7305 0.9821 0.3274 0.1816 0.3117 0.1794 - UNH 124 3 0.6310 0.5817 0.4495 0.3630 0.1875 - - UNH 104 3 0.6655 0.5727 0.3062 0.3502 0.3436 - - 3.2. Biến dị di truyền của các quần đàn thông qua 4 microsatellite loci Biến dị di truyền của các quần đàn Ct1 đến Ct9 được trình bày ở bảng 5. Tỷ lệ dị hợp tử thực tế và lý thuyết cũng thay đổi theo mỗi locus và các quần đàn khác nhau. Tỷ lệ dị hợp tử thực tế trên locus UNH216 là hầu hết bằng 1, trừ quần đàn 1 (Ct1). Tỷ lệ dị hợp tử lý thuyết (He) trung bình trên các quần đàn dao động từ 0,63 đến 0,69, cao nhất là ở ba quần đàn Ct4, Ct5, Ct6 (0,69) còn và thấp nhất ở hai quần đàn Ct1 và Ct2 (0,63). Tuy nhiên, tỷ lệ dị hợp tử thực tế lại dao động nhiều hơn, từ 0,56 tới 0,83, thấp nhất là ở công thức 8 (Ct8) và cao nhất là ở công thức 5 (Ct5). Bảng 5. Tần số dị hợp tử lý thuyết (He) và thực tế (Ho) của các quần đàn Loci IFG-MSO3 UNH216 UNH124 UNH104 Trung bình Ct He Ho He Ho He Ho He Ho He Ho 0,63 0,44 0,67 0,80 0,56 0,41 0,67 0,72 Ct1 0,63 0,59 0,68 0,36 0,74 1 0,57 0,58 0,56 0,75 Ct2 0,63 0,67 0,74 0,90 0,74 1 0,56 0,39 0,64 0,73 Ct3 0,67 0,76 0,78 0,56 0,74 1 0,61 0,70 0,65 0,40 Ct4 0,69 0,67 8
  9. 0,74 0,68 0,73 1 0,64 0,69 0,63 0,95 Ct5 0,69 0,83 0,73 0,57 0,73 1 0,66 0,75 0,63 0,70 Ct6 0,69 0,75 0,68 0,55 0,73 1 0,57 0,77 0,62 0,33 Ct7 0,65 0,66 0,75 0,47 0,69 1 0,65 0,50 0,62 0,27 Ct8 0,68 0,56 0,70 0,28 0,73 1 0,54 0,50 0,59 0,52 Ct9 0,64 0,58 3.3. Khoảng cách di truyền Bảng 6. Khoảng cách di truyền của các quần đàn tính theo Nei (1972) Quần đàn 1 2 3 4 5 6 7 8 9 1 ***** 2 0.2498 ***** 3 0.1913 0.0755 ***** 4 0.1872 0.0660 0.0290 ***** 5 0.0720 0.1266 0.0922 0.0562 ***** 6 0.1444 0.1616 0.0893 0.0597 0.0466 ***** 7 0.1628 0.2116 0.0823 0.1225 0.1658 0.1153 ***** 8 0.1192 0.1509 0.1079 0.0676 0.0915 0.0778 0.0809 ***** 9 0.0791 0.2720 0.1751 0.1974 0.1773 0.1855 0.0790 0.0783 ***** Khoảng cách di truyền được trình bày ở bảng 6 và được minh họa bằng cây di truyền ở hình 1. Khoảng cách di truyền càng lớn thì các quần đàn càng xa nhau hơn trong cây di truyền. Ơ bảng này cho thấy, quần đàn 1 và 2 có giá trị là 0,2498 còn quần đàn 9 và 2 cũng có giá trị rất cao 0,2720, tương tự quần đàn 2 với quần đàn 7 cũng lớn (0,2116), đây là những quần đàn không gần nhau về quan hệ huyết thống. Ngược lại, khoảng cách càng nhỏ thì các quần đàn càng gần nhau về huyết thống, qua bảng 6 cũng cho thấy, quần đàn 3 và 4 là có giá trị bé nhất (0,029), tiếp sau đó là quần đàn 5 và 6 có gái trị bằng 0,0466. Qua hình 1 cho thấy, cây di truyền được thể hiện rất rõ ràng bằng các liên hệ giữa các quần đàn. Hình 1 về cây di truyền thể hiện rõ hai nhánh di truyền giữa các dòng lai, nhánh một bao gồm các quần đàn 2, 3, 4, 5, 6; nhánh còn lại bao gồm quần đàn 1, 7, 8, 9. Ơ nhánh thứ nhất, quần đàn 3 và 4 là gần nhau nhất, có chung một nhánh nhỏ, tương tự như kết quả ở bảng 6. Quần đàn 5 và 6 cũng rất gần nhau về mặt di truyền. Quần đàn hai tuy ở nhánh này nhưng cũng khác về cây di 9
  10. truyền so với quần đàn 3, 4 và 5, 6. Trong khi đó, ở nhánh hai, quần đàn 8 và 9 là cùng chung một nhánh, và khoảng cách hai nhánh này cũng gần bằng quần đàn 7. Quần đàn 1 ở nhánh thứ hai này có mức độ di truyền cũng khá xa so với quần đàn 7, 8, 9. Hình 1. Cây di truyền UPGMA của các quần đàn cá rô phi thí nghiệm dựa vào tần suất alleles 4. Thảo luận và đề xuất Qua việc nghiên cứu trên 4 microsatellite locus, tất cả các locus này đều thể hiện đa hình. Đã thấy xuất hiện 5 alleles ở locus IGF-MSO3 và 4 allele ở locus UNH216, còn lại 3 allele ở loci UNH104 và UNH124. Tuy nhiên, số lượng các alleles trên mỗi locus là thấp, 4 allele ở locus UNH216 trong nghiên cứu này so với 6 - 11 alleles trên cùng locus trong nghiên cứu về cá rô phi sông Nile và cá rô phi đỏ (Romana-Eguia et al., 2004; Romana-Eguia et al., 2005). Tương tự như trong nghiên cứu của (Hassanien & Gilbey, 2005), locus UNH104 đều thấy xuất hiện 9-10 allele trong các đàn cá rô phi O. nilloticus, trong khi đó nghiên cứu hiện tại chỉ xuất hiện có 3 allele. Tuy nhiên, ở locus IGF-MSO3 cho kết quả là 5 allele trong nghiên cứu này sấp xỉ bằng số allele (6) xuất hiện ở cá rô phi sông Nile (O. niloticus) và 12 allele ở cá rô phi Mozambique (O. mossambicus) (Yue & Orban, 2002). 10
  11. Tần số di hợp tử lý thuyết trong nghiên cứu này dao động trong khoảng từ 0,63 đến 0,77 giữa các locus, còn trong mỗi quần đàn là từ 0,63 đến 0,69. So sánh locus IGF-MSO3 và locus UNH216 với cùng locus này ở các nghiên cứu trước cho thấy chúng không dao động nhiều, ở nghiên cứu này là 0,77 và 0,73 tương ứng, còn locus IFG-MSO3 là 0,89 trong báo cáo của Yue & Orban (2002) và UNH126 là 0,56 – 0,76 ở nghiên cứu của Romana-Eguia và ctv (2005). Tần số dị hợp tử của 9 quần đàn nghiên cứu này không khác nhiều so với các nghiên cứu trước đây trên cùng các locus. Dựa vào khoảng cách di truyền và cây di truyền, có thể phân biệt được là quần đàn cá rô phi nào mang vật liệu di truyền gần nhau. Việc này có thể rất hữu ích cho công tác lai tạo trong các quần đàn và giữa các quần đàn. 5. Tài liệu tham khảo Agnese, J. F., AdepoGourene, B., Abban, E. K., & Fermon, Y. (1997). Genetic differentiation among natural populations of the nile tilapia Oreochromis niloticus (Teleostei, Cichlidae). Heredity, 79, 88-96. Agnese, J. F., Adepo-Gourene, B., Owino, J., Pouyaud, L., & Aman, R. (1999). Genetic characterization of a pure relict population of Oreochromis esculentus, an endangered tilapia. Journal of Fish Biology, 54(5), 1119-1123. FAO. (2005). Food and Agriculture Organisation Yearbook of fishery statistics summary tables, from ftp://ftp.fao.org/fi/STAT/summary/default.htm#aqua Hassanien, H. A., & Gilbey, J. (2005). Genetic diversity and differentiation of Nile tilapia (Oreochromis niloticus) revealed by DNA microsatellites. Aquaculture Research, 36(14), 1450-1457. Miller, M. P. (1997). Tools for population genetic analyses {TFPGA} 1.3. A window program for the analysis of allozyme and molecular population genetic data. Computer software distributed by author. O'Connell, M., & Wright, J. M. (1997). Microsatellite DNA in fishes. Reviews in Fish Biology and Fisheries, V7(3), 331-363. Palti, Y., Shirak, A., Cnaani, A., Hulata, G., Avtalion, R. R., & Ron, M. (2002). Detection of genes with deleterious alleles in an inbred line of tilapia (Oreochromis aureus). Aquaculture, 206(3-4), 151-164. Rognon, X., Andriamanga, M., McAndrew, B., & Guyomard, R. (1996). Allozyme variation in natural and cultured populations in two tilapia species: Oreochromis niloticus and Tilapia zillii. Heredity, 76, 640-650. Romana-Eguia, M. R. R., Ikeda, M., Basiao, Z. U., & Taniguchi, N. (2004). Genetic diversity in farmed Asian Nile and red hybrid tilapia stocks evaluated from microsatellite and mitochondrial DNA analysis. Aquaculture, 236(1-4), 131-150. 11
  12. Romana-Eguia, M. R. R., Ikeda, M., Basiao, Z. U., & Taniguchi, N. (2005). Genetic changes during mass selection for growth in Nile tilapia, Oreochromis niloticus (L.), assessed by microsatellites. Aquaculture Research, 36(1), 69-78. Wirgin, II, & Waldman, J. R. (1994). What DNA Can Do for You. Fisheries, 19(7), 16-27. Yue, G. H., & Orban, L. (2002). Microsatellites from genes show polymorphism in two related Oreochromis species. Molecular Ecology Notes, 2, 99-100. 12

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản