intTypePromotion=1
ADSENSE

Bước đầu ứng dụng kĩ thuật sinh học phân tử để đánh giá sự lưu hành của một số chủng Pseudomonas Aeruginosa và Staphilococcus Aureus gây nhiễm trùng bệnh vi

Chia sẻ: Thi Thi | Ngày: | Loại File: PDF | Số trang:6

62
lượt xem
2
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Trong nghiên cứu này, từ các 4 chủng P. aeruginosa và 4 chủng S. aureus đã được phân lập tại bệnh viện Đa khoa Trung ương Thái Nguyên, chúng tôi tiến hành phân tích sự tương đồng trong cấu trúc genome giữa các chủng của mỗi loài bằng kỹ thuật RAPD nhằm xác định sơ bộ xem thực chất có bao nhiêu chủng khác nhau về cấu trúc di truyền trong số các chủng được phân lập.

Chủ đề:
Lưu

Nội dung Text: Bước đầu ứng dụng kĩ thuật sinh học phân tử để đánh giá sự lưu hành của một số chủng Pseudomonas Aeruginosa và Staphilococcus Aureus gây nhiễm trùng bệnh vi

Nguyễn Phú Hùng và cs<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> 64(02): 91 - 96<br /> <br /> BƢỚC ĐẦU ỨNG DỤNG KĨ THUẬT SINH HỌC PHÂN TỬ ĐỂ ĐÁNH GIÁ<br /> SỰ LƢU HÀNH CỦA MỘT SỐ CHỦNG PSEUDOMONAS AERUGINOSA VÀ<br /> STAPHILOCOCCUS AUREUS GÂY NHIỄM TRÙNG BỆNH VIỆN<br /> TẠI BỆNH VIỆN ĐA KHOA TRUNG ƢƠNG THÁI NGUYÊN<br /> Nguyễn Phú Hùng , 2Nguyễn Đắc Trung<br /> Trường Đại học Khoa học – ĐH Thái Nguyên,<br /> 2<br /> Trường Đại học Y-Dược- ĐH Thái Nguyên)<br /> <br /> 1<br /> 1<br /> <br /> TÓM TẮT<br /> Ứng dụng các kỹ thuật sinh học phân tử là phƣơng pháp có hiệu quả cao trong việc đánh giá bản chất<br /> di truyền và định loại vi sinh vật. Các phƣơng pháp này ngày càng đƣợc sử dụng rộng rãi trong các<br /> nghiên cứu y sinh học, kiểm soát sự lƣu hành của các vi sinh vật gây bệnh. Trong nghiên cứu này, từ<br /> các 4 chủng P. aeruginosa và 4 chủng S. aureus đã đƣợc phân lập tại bệnh viện Đa khoa Trung ƣơng<br /> Thái Nguyên, chúng tôi tiến hành phân tích sự tƣơng đồng trong cấu trúc genome giữa các chủng của<br /> mỗi loài bằng kỹ thuật RAPD nhằm xác định sơ bộ xem thực chất có bao nhiêu chủng khác nhau về<br /> cấu trúc di truyền trong số các chủng đƣợc phân lập. Sau đó, tiến hành nhân gen 16S - rRNA của các<br /> chủng bằng kỹ thuật PCR nhằm phục vụ cho việc đọc trình tự và định tên chủng bằng phân loại học<br /> phân tử . Kết quả, bằng kỹ thuật RAPD với việc sử dụng các mồi ngẫu nhiên khác nhau, chúng tôi đã<br /> xác định đƣợc có thể có 2 chủng P. aeruginosa và 3 chủng S. aureus khác nhau có mặt trong số các<br /> chủng phân lập tại bệnh viện. Bằng kỹ thuật PCR, chúng tôi đã khuếch đại thành công đoạn gen mã<br /> hóa cho 16S - rRNA thuộc các chủng đã đƣợc xác định.<br /> Từ khóa: Tương đồng di truyền, RAPD, PCR, Nhiễm trùng bệnh viện.<br /> <br /> ĐẶT VẤN ĐỀ<br /> Nhiễm trùng bệnh viện (NTBV) là trƣờng<br /> hợp nhiễm trùng mắc phải trong bệnh viện<br /> khi nằm điều trị, làm việc hoặc chăm sóc<br /> bệnh nhân. Theo thống kê, số ngƣời bị mắc<br /> NTBV ngày càng tăng, không chỉ riêng ở các<br /> bệnh viện Việt Nam mà đây còn là thực trạng<br /> chung đối với nhiều bệnh viện trên thế giới.<br /> Các tác nhân gây NTBV thƣờng là các vi sinh<br /> vật nhƣ vi khuẩn, virus, các loại ký sinh trùng<br /> và nấm. Khoảng 90% trong số đó là vi khuẩn.<br /> Trong đó, Pseudomonas aeruginosa và<br /> Staphylococcus aureus đƣợc đánh giá là các<br /> đối tƣợng gây NTBV hàng đầu và rất nguy<br /> hiểm. Nhiễm trùng do P. aeruginosa và S.<br /> aureus rất khó điều trị vì chúng có khả năng đề<br /> kháng cao với các loại thuốc sát khuẩn cũng<br /> nhƣ hầu hết các loại kháng sinh thông dụng.<br /> Đây là các loại vi khuẩn có độc lực cao và gây<br /> nhiễm trùng cơ hội nguy hiểm. Vì vậy, công<br /> tác đánh giá sự lƣu hành của các vi sinh vật<br /> gây NTBV nói chung, của P. aeruginosa và S.<br /> aureus nói riêng là vấn đề đặc biệt quan trọng<br /> đối với tất cả các bệnh viện trên toàn thế giới.<br /> Tại Việt Nam, vấn đề này cũng đang là mối<br /> <br /> *<br /> <br /> *<br /> <br /> Tel: 0914791904, Email: hungnguyenphu@gmail.com<br /> <br /> quan tâm hàng đầu. Trong bài báo này chúng<br /> tôi đã bƣớc đầu ứng dụng một số kỹ thuật sinh<br /> học phân tử nhƣ RAPD và PCR để kiểm soát<br /> các vi sinh vật gây NTBV - P. aeruginosa và<br /> S. aureus tại bệnh viện ĐKTW Thái Nguyên.<br /> NGUYÊN LIỆU VÀ PHƢƠNG PHÁP<br /> NGHIÊN CỨU<br /> Nguyên liệu nghiên cứu là các chủng P.<br /> aeruginosa (Pa 34, Pa 45, Pa 47 và Pa 63) và<br /> S. aureus (Sa 54, Sa 217.1, Sa 411 và Sa 220)<br /> đƣợc phân lập từ bệnh phẩm của các bệnh<br /> nhân bị nhiễm trùng bệnh viện tại bệnh viện<br /> ĐKTW Thái Nguyên do Bộ môn Vi sinh vật Bệnh viện ĐKTW Thái Nguyên cung cấp.<br /> Hóa chất dùng cho tách chiết DNA tổng số và<br /> các loại hóa chất chuyên dụng dùng cho các<br /> kỹ thuật sinh học phân tử có chất lƣợng tốt,<br /> do các hãng có uy tín cung cấp.<br /> Phương pháp nghiên cứu bao gồm phƣơng<br /> pháp tách chiết DNA tổng số từ các chủng vi<br /> khuẩn làm nguyên liệu cung cấp cho các phản<br /> ứng RAPD để phân tích sự tƣơng đồng trong<br /> cấu trúc genome của các chủng vi khuẩn sau<br /> đó tiến hành PCR nhân đoạn gen mã hóa cho<br /> 16S - rRNA với cặp mồi đặc hiệu.<br /> KẾT QUẢ VÀ THẢO LUẬN<br /> Phân tích sự tƣơng đồng trong cấu trúc<br /> genome giữa cá chủng bằng kỹ thuật RAPD<br /> <br /> 91<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> http://www.Lrc-tnu.edu.vn<br /> <br /> Nguyễn Phú Hùng và cs<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> Đối với nhiễm trùng bệnh viện do trực khuẩn<br /> P. aeruginosa và vi khuẩn S. aureus, điều đáng<br /> lo ngại nhất là các đối tƣợng vi sinh vật này có<br /> tính biến chủng mạnh với khả năng kháng<br /> thuốc rất cao. Với mục đính xác định sơ bộ xác<br /> định sơ bộ xem các chủng nghiên cứu đƣợc<br /> phân lập tại bệnh viện Đa khoa Trung ƣơng<br /> Thái Nguyên thực chất là thuộc một hay nhiều<br /> chủng khác nhau, chúng tôi đã sử dụng<br /> phƣơng pháp phân tích sự tƣơng đồng trong<br /> cấu genome bằng kỹ thuật RAPD với 5 mồi<br /> ngẫu nhiên: RA36, RA40, RA45, RA142 và<br /> RA143. Các phân đoạn ngẫu nhiên bằng kỹ<br /> thuật RAPD đƣợc điện di trên gel agarose 2%.<br /> Kết quả điện di sản phẩm RAPD cho thấy:<br /> Đối với tất cả các chủng P. aeruginosa đều<br /> xuất hiện các phân đoạn đƣợc nhân lên giống<br /> nhau khi tiến hành nhân bản với các mồi<br /> RA40, RA45, RA142 và RA143. Riêng đối<br /> với mồi RA36, kết cho thấy có sự khác biệt<br /> trong cấu trúc genome giữa các chủng về số<br /> phân đoạn đƣợc khuếch đại. Đối với mồi này,<br /> chủng Pa 47 (đƣờng chạy số 3, hình 2a) xuất<br /> hiện một phân đoạn đặc trƣng khác biệt với<br /> M<br /> <br /> a<br /> <br /> 1 2<br /> <br /> 3<br /> <br /> 4<br /> <br /> M<br /> <br /> 64(02): 91 - 96<br /> <br /> các chủng còn lại. Rất có thể đây là một<br /> chủng khác biệt so với các chủng còn lại.<br /> Tƣơng tự nhƣ vậy, tất cả các chủng S. aureus<br /> cũng đều xuất hiện các phân đoạn đƣợc nhân<br /> bản ngẫu nhiên giống nhau khi sử dụng các<br /> mồi RA40 và RA46 (hình 1b,1c). Nhƣng khi<br /> sử dụng các mồi RA142 và RA143 đã cho<br /> thấy có sự khác nhau trong cấu trúc genome<br /> giữa các chủng. Với mồi RA142, ở tất cả các<br /> chủng Sa 54, Sa 217.1 và Sa 411 đều xuất<br /> hiện 3 phân đoạn đƣợc nhân bản giống nhau,<br /> riêng chủng Sa 220 thì chỉ thấy xuất hiện một<br /> phân đoạn duy nhất (hình 2b - đƣờng chạy số<br /> 4). Với mồi RA143, ở tất cả các chủng đều<br /> xuất hiện 11 phân đoạn đƣợc nhân bản giống<br /> nhau, riêng chủng Sa 411 thiếu hụt một phân<br /> đoạn so với các chủng còn lại (Hình 2 b đƣờng chạy số 3). Phân tích kết quả nghiên<br /> cứu cho phép chúng tôi rút kết luận sơ bộ nhƣ<br /> sau, có ít nhất 2 chủng P. aeruginosa và 3<br /> chủng S. aureus khác nhau trong số các chủng<br /> đã phân lập tại bệnh viện Đa khoa Trung<br /> ƣơng Thái Nguyên.<br /> 1<br /> <br /> 2<br /> <br /> b<br /> <br /> 3<br /> <br /> M<br /> <br /> 4<br /> <br /> 1<br /> <br /> 2<br /> <br /> c<br /> <br /> Hình 1. Sự đồng nhất về các phân đoạn RAPD của P. aeruginosa (a - mồi RA40)<br /> và S. aureus (b- mồi RA40 và c-RA46)<br /> <br /> 92<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> http://www.Lrc-tnu.edu.vn<br /> <br /> 3<br /> <br /> 4<br /> <br /> Nguyễn Phú Hùng và cs<br /> <br /> M<br /> <br /> 1<br /> <br /> 2<br /> <br /> 3<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> 4 M<br /> <br /> M<br /> <br /> a<br /> <br /> 1<br /> <br /> 2<br /> <br /> 3<br /> <br /> 4<br /> <br /> b<br /> <br /> 64(02): 91 - 96<br /> <br /> M<br /> <br /> 1<br /> <br /> 2<br /> <br /> 3<br /> <br /> 4<br /> <br /> c<br /> <br /> Hình 2. Sự khác biệt trong cấu trúc genome của một số chủng vi khuẩn: Mồi RA36 đối với chủng P.<br /> aeruginosa (a); mồi RA142 (b) và RA143 (c) của các chủng S. aureus<br /> <br /> Phân tích sự tƣơng đồng di truyền bằng<br /> chƣơng trình phần mềm NTSYST, chúng tôi<br /> thu đƣợc bảng hệ số tƣơng đồng di truyền và<br /> sơ đồ hình cây đƣợc lập theo hệ số giống<br /> nhau (Jaccard) và kiểu phân nhóm UPGMA<br /> nhƣ sau:<br /> Bảng 1. Hệ số tƣơng đồng di truyền giữa 4 chủng<br /> Pa 34, Pa 45, Pa 47 và Pa 63<br /> Chủng<br /> P. aeruginosa Pa 34 Pa 45 Pa 47 Pa 63<br /> Pa 34<br /> 100%<br /> Pa 45<br /> <br /> 100%<br /> <br /> 100%<br /> <br /> Pa 47<br /> <br /> 93,8%<br /> <br /> 93,8%<br /> <br /> 100%<br /> <br /> Pa 63<br /> 100% 100% 93,8% 100%<br /> Bảng 2. Hệ số tƣơng đồng di truyền giữa 4 chủng<br /> Sa 54, Sa 220, Sa 217.1 và Sa 411<br /> Chủng<br /> Sa 54 Sa<br /> Sa<br /> Sa 220<br /> S. aureus<br /> 217.1 411<br /> Sa 54<br /> 100% 100% 91,7% 83,3%<br /> Sa 217.1<br /> <br /> 100%<br /> <br /> 100%<br /> <br /> 91,7%<br /> <br /> 83,3%<br /> <br /> Sa 411<br /> Sa 220<br /> <br /> 91,7%<br /> 83,3%<br /> <br /> 91,7%<br /> 83,3%<br /> <br /> 100%<br /> 75%<br /> <br /> 75%<br /> 100%<br /> <br /> Từ kết quả phân tích sơ đồ cây hình 3 cho<br /> thấy, ba chủng pa63, pa54 và pa34 có cùng<br /> một gốc hay nói cách khác 3 chủng này có thể<br /> là một chủng duy nhất nhƣng bị nhiễm sang<br /> các bệnh nhân khác nhau. Chủng pa47 có thể<br /> thể là chủng khác biệt so với 3 chủng nêu trên<br /> <br /> do phân tách thành một nhánh riêng biệt.<br /> tƣơng tự nhƣ vậy, kết quả hình 4 cho thấy có<br /> 3 nhánh khác nhau của cây phát sinh chủng<br /> loại, rất có thể 4 chủng này thực chất là 3<br /> chủng khác nhau trong đó Sa220 và Sa411 là<br /> hai chủng riêng biệt còn Sa54 và Sa217.1 là<br /> một chủng duy nhất.<br /> Sau khi sơ bộ nhận định số lƣợng chủng khác<br /> nhau bằng kỹ thuật phân tích đa hình RAPD,<br /> chúng tôi tiếp tục phân lập gen 16S - rRNA từ<br /> các chủng thuộc hai nhóm này nhằm phục vụ<br /> cho việc xác định trình tự và định tên chủng<br /> bằng các kỹ thuật phân loại học phân tử. Đây<br /> là vấn đề đặc biệt quan trọng giúp cho việc<br /> kiểm soát các chủng vi sinh vật gây bệnh.<br /> Kết quả nhân đoạn gen 16S - rRNA của<br /> các chủng nghiên cứu bằng kỹ thuật PCR<br /> Để tiếp tục phân tích, định loại các chủng vi<br /> khuẩn nêu trên, chúng tôi tiến hành phản<br /> ứng PCR sử dụng cặp mồi đặc hiệu ChF và<br /> ChR đƣợc thiết kế dựa trên vùng DNA mã<br /> hóa cho phân tử 16S – rRNA. Trình tự của<br /> cặp mồi sử dụng là:<br /> Mồi xuôi:<br /> (ChF):5’AGAGTTTGATCCTGGCTCAG 3’<br /> Mồi ngƣợc<br /> (ChR): 5’AAAGGAGGTGATCCA 3’<br /> <br /> 93<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> http://www.Lrc-tnu.edu.vn<br /> <br /> Nguyễn Phú Hùng và cs<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> 64(02): 91 - 96<br /> <br /> Hình 3. Biểu đồ mô tả quan hệ di truyền của các chủng Pa 34, Pa 45, Pa 47 và PaSa6354<br /> <br /> Sa 217.1<br /> <br /> Sa 411<br /> <br /> Sa 220<br /> 0.81<br /> <br /> 0.85<br /> <br /> 0.90<br /> <br /> 0.95<br /> <br /> 1.00<br /> <br /> Hình 4. Biểu đồ mô tả quan hệ di truyền của các chủng Sa 54, Sa 217.1, Sa 411, Sa 220<br /> <br /> Theo tính toán lý thuyết, cặp mồi này cho<br /> phép nhân đoạn gen mã hóa 16S - rRNA có<br /> kích thƣớc khoảng 1,5kb, nhiệt độ bắt cặp<br /> mồi là 520C. Kết quả nhân bản đƣợc kiểm<br /> tra bằng phƣơng pháp điện di trên gel<br /> agarose 0,8% (Hình 5 (a) và (b)). Dựa vào<br /> marker chuẩntrong bản điện di, chúngtôi<br /> nhận thấy ở tất cả các chủng nghiên cứu đều<br /> xuất hiện một băng DNA có kích thƣớc<br /> khoảng 1,5 kb, điều này hoàn toàn phù hợp<br /> với tính toán lý thuyết. Các băng tƣơng đối<br /> rõ và tập trung, chứng tỏ sản phẩm PCR<br /> tƣơng đối đặc hiệu với đoạn gen mã hóa 16S<br /> - rRNA. Sản phẩm PCR tiếp tục đƣợc chúng<br /> tôi nhân dòng và đọc trình tự để định<br /> <br /> loại tên khoa học của các chủng này. Nghiên<br /> cứu này chỉ mới chỉ dừng lại ở giai đoạn thử<br /> nghiệm trên một vài mẫu bệnh phẩm phân<br /> lập từ bệnh nhân. Đây là tiền đề để chúng<br /> tôi có thể tiến hành khảo sát trên một quy<br /> mô rộng, với lƣợng mẫu lớn phân lập trên<br /> ngƣời bệnh khi đang điều trị tại bệnh viện<br /> cũng nhƣ các mẫu lấy từ dụng cụ y tế,<br /> mẫu phân lập từ môi trƣờng xung quanh<br /> bệnh viện để có thể có những nhận xét<br /> khái quát thành phần các chủng vi sinh vật<br /> gây bệnh, mối liên quan giữa các chủng ở<br /> các mẫu phân lập khác nhau, trên cơ sở đó<br /> có thể đƣa ra những đánh giá về công tác<br /> phòng chống nhiễm trùng bệnh viện tại địa<br /> điểm nghiên cứu.<br /> <br /> 94<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> http://www.Lrc-tnu.edu.vn<br /> <br /> Nguyễn Phú Hùng và cs<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> M<br /> <br /> 1 2 3<br /> <br /> 4<br /> <br /> M 1<br /> <br /> 2<br /> <br /> 3<br /> <br /> 64(02): 91 - 96<br /> <br /> 4<br /> <br /> 1.5 kb<br /> <br /> 1.5 kb<br /> <br /> b<br /> <br /> a<br /> <br /> Hình 5. Hình ảnh điện di sản phẩm nhân bản đoạn gen mã hóa cho 16S - rRNA bằng kỹ thuật PCR<br /> của các chủng P. aeruginosa (a) và S. aureus (b)<br /> <br /> KẾT LUẬN<br /> Bằng kỹ thuật RAPD, với các mồi ngẫu nhiên<br /> chúng tôi đã xác định đƣợc có ít nhất 2 chủng<br /> P. aeruginosa và 3 chủng S. aureus khác nhau<br /> trong số các chủng đƣợc phân lập tại bệnh<br /> viện Đa khoa Trung ƣơng Thái Nguyên. Sau<br /> đó, phân đoạn gen 16S – rRNA đã đƣợc<br /> khuếch đại thành công bằng kỹ thuật PCR,<br /> phục vụ cho đọc trình tự và xác định tên<br /> chủng.<br /> TÀI LIỆU THAM KHẢO<br /> [1].<br /> Lê Huy Chính (Chủ biên) (2007), Vi sinh<br /> vật học y học, NXB Y học HN, Hà Nội, Tr. 218221<br /> [2].<br /> Nguyễn Anh Diệp, Trần Ninh, Nguyễn<br /> Xuân Quýnh (2007), Nguyên tắc phân loại sinh<br /> vật, NXB KH - KT, Hà Nội<br /> [3].<br /> Campbell M., Mahenthiralingam E.,<br /> Speert D.P. (2000), “Evaluation of random<br /> amplified polymorphic DNA typing of<br /> Pseudomonas aeruginosa”, Journal of Clinical<br /> <br /> Microbiology, Erope, Vol. 38, No. 12, Pp. 46144615<br /> [4].<br /> Maribel O. H., Armando G. G., Lorenzo<br /> P. F., Rafael C.J. (2004), “RAPD-PCR<br /> characterization of Pseudomonas aeruginosa<br /> strains obtained from cystic fibrosis patients”,<br /> Salud publica de Mexico, Mexico, Vol. 46, No. 2,<br /> Pp. 149-157<br /> [5].<br /> Nicole R., Ute R., Henri V. and Alex<br /> V.B.<br /> (1996),<br /> “Comparative<br /> Typing<br /> of<br /> Pseudomonas<br /> aeruginosa<br /> by<br /> Random<br /> Amplification of Polymorphic DNA or PulsedField<br /> Gel<br /> Electrophoresis<br /> of<br /> DNA<br /> Macrorestriction Fragments”, Journal of Clinical<br /> Microbiology, Erope, Vol. 40, No. 12, Pp. 31903195<br /> [6].<br /> Philippe L., Stephane W., Laurent M.,<br /> Nathalie D., Aziz R.L., Alain G. and Roland Q.<br /> (2004), “Genetic features of Pseudomonas<br /> aeruginosa isolates from cystic fibrosis patients<br /> compared with those of isolates from other<br /> origins”, The Journal of Medical Microbiology,<br /> France, No. 53, Pp. 73-81<br /> <br /> 95<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> http://www.Lrc-tnu.edu.vn<br /> <br />
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2