intTypePromotion=1
ADSENSE

Đặc điểm lâm sàng, mô bệnh học và methyl hóa gen SFRP2, RNF180 ở bệnh nhân ung thư biểu mô dạ dày điều trị phẫu thuật tại Bệnh viện Quân Y 103

Chia sẻ: ViMoskva2711 ViMoskva2711 | Ngày: | Loại File: PDF | Số trang:6

19
lượt xem
1
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Bài viết trình bày việc tìm hiểu đặc điểm lâm sàng, mô bệnh học và tình trạng methyl hóa gen SFRP2, RNF180 ở bệnh nhân ung thư biểu mô dạ dày điều trị phẫu thuật tại Bệnh viện Quân y 103.

Chủ đề:
Lưu

Nội dung Text: Đặc điểm lâm sàng, mô bệnh học và methyl hóa gen SFRP2, RNF180 ở bệnh nhân ung thư biểu mô dạ dày điều trị phẫu thuật tại Bệnh viện Quân Y 103

t¹p chÝ y - d−îc häc qu©n sù sè 9-2019<br /> <br /> ĐẶC ĐIỂM LÂM SÀNG, MÔ BỆNH HỌC VÀ METHYL HÓA<br /> GEN SFRP2, RNF180 Ở BỆNH NHÂN UNG THƯ BIỂU MÔ<br /> DẠ DÀY ĐIỀU TRỊ PHẪU THUẬT TẠI BỆNH VIỆN QUÂN Y 103<br /> Nguyễn Minh Phúc1; Trần Văn Khoa2; Nguyễn Thúy Vinh3<br /> TÓM TẮT<br /> Mục tiêu: tìm hiểu đặc điểm lâm sàng, mô bệnh học và tình trạng methyl hóa gen SFRP2,<br /> RNF180 ở bệnh nhân ung thư biểu mô dạ dày điều trị phẫu thuật tại Bệnh viện Quân y 103.<br /> Đối tượng và phương pháp: nghiên cứu tiến cứu, mô tả cắt ngang có đối chứng trên 98 bệnh<br /> nhân ung thư biểu mô dạ dày điều trị phẫu thuật từ tháng 12 - 2015 đến 12 - 2018 và 40 bệnh<br /> nhân viêm dạ dày mạn được chẩn đoán bằng nội soi và mô bệnh học. Kết quả và kết luận:<br /> ung thư biểu mô dạ dày gặp ở nam nhiều hơn nữ, tỷ lệ nam/nữ 2,27/1. Tuổi trung bình của ung<br /> thư biểu mô dạ dày 61,5 ± 10,88, gặp nhiều nhất ở nhóm tuổi 60 - 69. Theo phân loại Lauren,<br /> tỷ lệ ung thư biểu mô dạ dày thể ruột cao hơn thể lan tỏa (p > 0,05). Theo phân loại của WHO<br /> (2000), ung thư biểu mô tuyến thể ống nhỏ gặp nhiều nhất, tiếp theo là thể không biệt hóa và<br /> thể nhẫn, thấp nhất là thể nhày (9,18%). Hầu hết bệnh nhân ung thư biểu mô dạ dày phẫu thuật<br /> ở giai đoạn II - IV (95,92%). Tỷ lệ methyl hóa SFRP2 ở nhóm ung thư biểu mô dạ dày 74,49%<br /> và nhóm chứng là 25,51% (OR = 6,07; 95%CI: 3,28 - 11,21). Methyl hóa gen SFRP2 có thể là<br /> dấu hiệu chuẩn sinh học trong chẩn đoán ung thư dạ dày.<br /> * Từ khóa: Ung thư biểu mô dạ dày; Methyl hóa gen SFRP2; Đặc điểm lâm sàng; Đặc điểm<br /> mô bệnh học.<br /> <br /> ĐẶT VẤN ĐỀ đến thay đổi trình tự nucleotid của ADN,<br /> bao gồm biến đổi histone và methyl hóa<br /> Ung thư dạ dày (UTDD) là bệnh vùng promoter. Methyl hóa là hiện tượng<br /> thường gặp ở nước ta và nhiều nước trên một gốc methyl được thêm vào carbon ở<br /> thế giới. Theo số liệu của Tổ chức Nghiên vị trí số 5 của cytosine trong CpG - vùng<br /> cứu Ung thư Quốc tế (IARC) năm 2018, giàu GC của gen. Methyl hóa làm bất hoạt<br /> Việt Nam có 17.527 ca mắc mới UTDD, các gen ức chế khối u, do đó được coi là<br /> chiếm 10,6% các loại ung thư và là loại chìa khóa của sự khởi đầu và phát triển<br /> ung thư phổ biến đứng thứ ba sau ung ung thư. Nghiên cứu của Zhang X (2014)<br /> thư gan và ung thư phổi [5]. Do UTDD cho thấy, tỷ lệ methyl hóa gen SFRP2<br /> thường được chẩn đoán ở giai đoạn tiến trong huyết tương nhóm UTDD là 71,93%<br /> triển nên có tiên lượng xấu, tỷ lệ sống sau so với nhóm chứng (42,86%) (p = 0,0036),<br /> 5 năm chỉ khoảng 10 - 20% . tỷ lệ methyl hóa gen RNF180 trong huyết<br /> Di truyền ngoại gen là biến đổi biểu tương nhóm UTDD là 57,89% so với nhóm<br /> hiện gen, có thể di truyền, không liên quan chứng (23,81%) (p = 0,0007) [6].<br /> <br /> 1. Đại học Y Dược Thái Bình<br /> 2. Học viện Quân y<br /> 3. Đại học Y tế Công cộng<br /> Người phản hồi (Corresponding): Nguyễn Minh Phúc (minhphucytb@yahoo.com)<br /> Ngày nhận bài: 08/10/2019; Ngày phản biện đánh giá bài báo: 16/11/2019<br /> Ngày bài báo được đăng: 22/11/2019<br /> <br /> 112<br /> t¹p chÝ y - d−îc häc qu©n sù sè 9-2019<br /> <br /> Ở Việt Nam, nghiên cứu tình trạng bệnh, Bệnh viện Quân y 103 cắt mẫu mô<br /> methyl hóa các gen liên quan đến ung làm xét nghiệm mô bệnh học và xét nghiệm<br /> thư nói chung, bao gồm UTDD còn khá methyl hóa.<br /> mới. Vì vậy, chúng tôi tiến hành nghiên - Nhóm đối chứng: chẩn đoán nội soi<br /> cứu đề tài này nhằm: Tìm hiểu đặc điểm dạ dày là viêm dạ dày mạn, sinh thiết làm<br /> lâm sàng, mô bệnh học và tình trạng mô bệnh học và xét nghiệm methyl hóa.<br /> methyl hóa gen SFRP2, RNF180 ở bệnh - Xét nghiệm mô bệnh học: thực hiện<br /> nhân ung thư biểu mô dạ dày điều trị tại Khoa Giải phẫu bệnh, Bệnh viện<br /> phẫu thuật tại Bệnh viện Quân y 103 từ Quân y 103 gồm:<br /> tháng 12 - 2015 đến 12 - 2018. + Chẩn đoán xác định có hoặc không<br /> UTBMDD.<br /> ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP<br /> + Trên tiêu bản UTBMDD, phân loại<br /> NGHIÊN CỨU<br /> mô bệnh học theo Lauren [7] gồm thể<br /> 1. Đối tượng nghiên cứu. ruột, thể lan tỏa; phân loại theo WHO<br /> - Nhóm nghiên cứu: 98 bệnh nhân (BN) (2000) [1] gồm 9 thể: ung thư biểu mô<br /> ung thư biểu mô dạ dày (UTBMDD) nguyên tuyến thể ống nhỏ; ung thư biểu mô tuyến<br /> phát, điều trị phẫu thuật tại Khoa Ngoại thể nhày; ung thư biểu mô thể tế bào<br /> bụng, Bệnh viện Quân y 103. nhẫn; ung thư biểu mô thể tuyến vảy; ung<br /> * Tiêu chuẩn loại trừ: UTBMDD thứ phát thư biểu mô thể tế bào vảy; ung thư biểu<br /> hoặc đã điều trị bằng hóa - xạ trị. mô thể tế bào nhỏ; ung thư biểu mô thể<br /> - Nhóm chứng: 40 BN viêm dạ dày mạn không biệt hóa và ung thư biểu mô khác.<br /> được chẩn đoán bằng nội soi dạ dày và Mức độ biệt hóa chia thành biệt hóa cao,<br /> xét nghiệm mô bệnh học. biệt hóa vừa và biệt hóa kém.<br /> - Xét nghiệm methyl hóa gen SFRP2,<br /> 2. Phương pháp nghiên cứu.<br /> RNF180 bằng kỹ thuật MSP: thực hiện<br /> - Thiết kế nghiên cứu: mô tả cắt ngang tại Phòng Chẩn đoán Sinh học Phân tử,<br /> có đối chứng. Bộ môn Sinh học và Di truyền Y học,<br /> - Thiết bị: máy cô đặc ADN Speed vac Học viện Quân y, gồm các bước:<br /> Eppendorf AG 5305 (Đức); máy đo độ + Tách chiết ADN: tách chiết ADN<br /> tinh sạch ADN Quikdrop Spectroprotometer bằng kít ADN Blood Minikit (Qiagen) theo<br /> (Mỹ); máy PCR Eppendorf ProS (Mỹ); quy trình hướng dẫn của nhà sản xuất.<br /> máy realtime Rotor-Gene Q Qiagen (Đức); Kiểm tra nồng độ, độ tinh sạch mẫu ADN<br /> máy điện di Mupid-one (Nhật Bản); hệ tách chiết được bằng máy Quick drop và<br /> thống nội soi dạ dày OLYMPUS CV-170 lưu giữ ở nhiệt độ -20oC.<br /> (Nhật Bản).<br /> + Biến đổi Bisulfite: thực hiện theo quy<br /> * Quy trình nghiên cứu: trình của bộ kít EZ ADN methylation-Gold<br /> - Nhóm nghiên cứu: khám lâm sàng (Zymo research) của nhà sản suất. Lưu trữ<br /> trước phẫu thuật. Phần dạ dày có khối u 10 µl dung dịch ADN thu được sau khi biến<br /> được cắt bỏ gửi đến Khoa Giải phẫu đổi ở nhiệt độ -20˚C.<br /> <br /> 113<br /> t¹p chÝ y - d−îc häc qu©n sù sè 9-2019<br /> <br /> + MSP (Methylation Specific PCR): sử dụng các cặp mồi đặc hiệu để đánh giá<br /> promoter methyl hóa và không methyl hóa của gen SFRP2 (bảng 1). Nếu cặp mồi<br /> methyl cho kết quả có thể kết luận các CpG khảo sát bị methyl hóa hoàn toàn. Nếu cặp<br /> mồi không methyl cho kết quả, kết luận các CpG khảo sát không bị methyl hóa. Nếu cả<br /> 2 cặp mồi cho kết quả, các CpG khảo sát bị methyl hóa không hoàn toàn.<br /> Thành phần phản ứng PCR sau khi được điều chỉnh và tối ưu: 12,5 µl Mastermix;<br /> 0,5 µl mỗi mồi, 2 µl ADN đã xử lý; H2O vừa đủ để tổng thể phản ứng là 25 µl. Chu trình<br /> nhiệt của phản ứng MSP sau khi tối ưu: 95°C trong 5 phút; 35 chu kỳ gồm 95°C trong<br /> 30 giây, 55°C trong 60 giây, 72°C trong 30 giây và kết thúc ở 72°C.<br /> <br /> Bảng 1: Trình tự mồi dùng cho phản ứng MSP.<br /> <br /> Mồi Trình tự Kích thước sản phẩm PCR<br /> <br /> SFRP2 MF GGGTCGGAGTTTTTCGGAGTTGCGC<br /> 138 bp<br /> SFRP2 MR CCGCTCTCTTCGCTAAATACGACTCG<br /> <br /> SFRP2 UF TTTTGGGTTGGAGTTTTTTGGAGTTGTGT<br /> 145 bp<br /> SFRP2 UR AACCCACTCTCTTCACAAATACAACTCA<br /> <br /> RNF180 MF GGAGAAAAATTTTTTTACGGTTTC<br /> 109<br /> RNF180 MR CACGTCTACGAATTCCCAC<br /> <br /> RNF180 UF AGGGAGAAAAATTTTTTTATGGTTTT 109<br /> <br /> RNF180 UR CACATCTACAAATTCCCACCC<br /> <br /> + Điện di sản phẩm PCR, sau đó điện di agarose 2% trong 30 phút với hiệu điện<br /> thế 100 V và cường độ dòng điện 100 mA, nhuộm ethidium bromide, soi UV, chụp<br /> hình và phân tích kết quả.<br /> * Xử lý số liệu: bằng phần mềm SPSS 20.0.<br /> <br /> KẾT QUẢ NGHIÊN CỨU VÀ về tỷ lệ mắc UTDD được giải thích do<br /> BÀN LUẬN vai trò bảo vệ cơ thể trước UTDD của nội<br /> 1. Đặc điểm về tuổi và giới. tiết tố nữ (estrogen) và nam giới tiếp xúc<br /> * Đặc điểm giới tính: 68 BN (69,39%) với các tác nhân gây UTDD nhiều hơn.<br /> nam; 30 BN (30,61%) nữ. Trong nghiên cứu của chúng tôi, tỷ lệ<br /> UTDD có mối liên quan với giới tính. nam/nữ là 2,27/1, tương đồng với nghiên<br /> UTDD gặp ở nam thường cao hơn so với cứu của Lê Viết Nho [2] là 2,75/1 và<br /> nữ, tỷ lệ nam/nữ khoảng 2 - 3/1. Khác biệt Nguyễn Quang Bộ [3] là 2,5/1.<br /> <br /> 114<br /> t¹p chÝ y - d−îc häc qu©n sù sè 9-2019<br /> <br /> Bảng 2: Cơ cấu tuổi của nhóm nghiên cứu.<br /> Giới tính<br /> <br /> Nhóm tuổi (n = 98) Nam Nữ Tỷ lệ chung<br /> <br /> n % n %<br /> <br /> < 50 7 70,0 3 30,0 10,20<br /> <br /> 50 - 59 19 63,33 11 36,67 30,61<br /> <br /> 60 - 69 27 79,41 7 20,59 34,70<br /> <br /> ≤ 70 15 62,50 9 37,50 24,49<br /> <br /> UTDD ít gặp ở tuổi < 40, tỷ lệ tăng lên cùng với tuổi và đạt đỉnh ở độ tuổi 60 - 70 [1].<br /> Trong nghiên cứu của chúng tôi, BN cao tuổi nhất 85, nhỏ tuổi nhất 35, tuổi trung bình<br /> UTDD 61,5 ± 10,88. Hầu hết BN UTBMDD ≥ 50 tuổi (89,8%), trong đó gặp nhiều nhất<br /> ở nhóm tuổi 60 - 69. Kết quả của chúng tôi phù hợp với nghiên cứu của Phan Văn<br /> Cương (2017) với tuổi trung bình 59,8 - 61,9 [4], Zhang X (2014) 61,49 ± 12,02 tuổi [6].<br /> <br /> 2. Đặc điểm lâm sàng, mô bệnh học. nôn là những triệu chứng thường gặp.<br /> * Đặc điểm lâm sàng: Các triệu chứng khác ít gặp hơn. Kết quả<br /> này phù hợp với nghiên cứu của một số<br /> - Lý do vào viện: 76 BN (77,56%) đau<br /> tác giả khác khác [2, 3].<br /> thượng vị; 11 BN (11,22%) xuất huyết<br /> tiêu hóa; 7 BN (7,14%) nôn, buồn nôn; - Triệu chứng thực thể: triệu chứng<br /> 1 BN (1,02%) sút cân; triệu chứng khác thực thể của BN UTBMDD hay gặp nhất<br /> 3 BN (3,06%). Như vậy, không có BN nào trong nghiên cứu là ấn thượng vị đau<br /> phát hiện UTDD qua khám sàng lọc hoặc (73 BN = 74,49%), rất ít gặp BN có u cục<br /> khám sức khỏe định kỳ. Kết quả này phù vùng thượng vị (11 BN = 11,22%) hoặc<br /> hợp với nhiều nghiên cứu khác, lý do gan to (3 BN = 3,06%). Không gặp BN<br /> chính khiến BN đến khám bệnh là đau nào có hạch to hoặc cổ trướng, phù hợp<br /> thượng vị [2, 3]. với nghiên cứu của Nguyễn Quang Bộ,<br /> với đa số BN UTDD có ấn thượng vị đau,<br /> - Triệu chứng toàn thân và cơ năng:<br /> rất ít gặp các triệu chứng khác [3].<br /> 92 BN (93,87%) đau thượng vị; 50 BN<br /> (51,02%) sút cân; 41 BN (41,84%) nôn, * Đặc điểm mô bệnh học:<br /> buồn nôn; 17 BN (17,35%) xuất huyết tiêu - Phân loại mô bệnh học theo Lauren:<br /> hóa; 33 BN (33,67%) đầy bụng, ợ hơi, ợ trong nghiên cứu của chúng tôi, UTBMDD<br /> chua; 46 BN (46,94%) thiếu máu. Trong thể ruột (52 BN = 53,06%) gặp nhiều hơn<br /> nghiên cứu của chúng tôi, không có triệu thể lan tỏa (46 BN = 46,94%), phù hợp<br /> chứng đặc hiệu của UTDD. Đau bụng với nghiên cứu của Lê Viết Nho [2],<br /> thượng vị, sút cân, thiếu máu, nôn, buồn Zhang Zh [8].<br /> <br /> 115<br /> t¹p chÝ y - d−îc häc qu©n sù sè 9-2019<br /> <br /> Bảng 3: Phân loại mô bệnh học theo M0 94 95,92<br /> M<br /> WHO (2000). M1 4 4,08<br /> <br /> Đặc điểm Số lượng Tỷ lệ (%) Giai đoạn I 4 4,08<br /> Giai đoạn Giai đoạn II 25 25,51<br /> Thể mô bệnh học: UTDD<br /> Giai đoạn IIII 65 66,33<br /> Thể ống nhỏ 51 52,04<br /> Giai đoạn IV 4 4,08<br /> Thể nhày 8 8,16<br /> Tổng cộng 98 100,00<br /> Thể tế bào nhẫn 17 17,35<br /> Toàn bộ BN UTBMDD trong nghiên<br /> Thể không biệt hóa 22 22,45<br /> cứu được phẫu thuật khi khối u đã xâm<br /> Độ biệt hóa: lấn qua lớp dưới niêm mạc, từ T2 đến T4.<br /> Biệt hóa cao 31 31,63<br /> Hầu hết BN có di căn hạch từ N2 đến N3<br /> (93,88%), một số BN có di căn xa. Như vậy,<br /> Biệt hóa vừa 25 25,51<br /> đa số BN đã ở giai đoạn tiến triển, từ giai<br /> Biệt hóa kém 42 42,86 đoạn II đến giai đoạn IV (95,92%).<br /> Tổng cộng 98 100,00 3. Đặc điểm methyl hóa.<br /> Bảng 5: Tỷ lệ methyl hóa của gen SFRP2.<br /> Theo phân loại của WHO (2000), thể ống<br /> Nhóm<br /> nhỏ gặp nhiều nhất, rất ít gặp thể nhày và Nhóm<br /> không<br /> Tình trạng UTBMDD OR<br /> không gặp các thể khác. Kết quả này methyl hóa UTBMDD 95%CI<br /> tương tự với nghiên cứu của Lê Viết Nho, n % n %<br /> với thể ống nhỏ chiếm tỷ lệ cao nhất [2]. Methyl hóa 73 74,49 13 32,5<br /> 6,06<br /> Về độ biệt hóa khối u, độ biệt hóa kém gặp Không<br /> 25 25,51 27 67,5 (3,28 - 11,21)<br /> nhiều nhất. methyl hóa<br /> Tổng cộng 98 100,00 40 100,00<br /> Bảng 4: Phân giai đoạn ung thư theo<br /> AJCC/UICC (2010). Methyl hóa làm bất hoạt các gen liên<br /> Số Tỷ lệ quan đến ung thư, đặc biệt là gen ức chế<br /> Phân loại giai đoạn<br /> lượng (%) khối u dẫn đến phát sinh UTDD. SFRP2<br /> T2 20 20,41 là gen có chức năng ức chế khối u. Kết<br /> T T3 47 47,96<br /> quả của chúng tôi cho thấy, tỷ lệ methyl<br /> hóa gen SFRP2 ở nhóm UTBMDD cao<br /> T4 31 31,63<br /> hơn nhóm không ung thư và methyl hóa<br /> N0 6 6,12 gen SFRP2 làm tăng nguy cơ UTBMDD<br /> N1 18 18,37 cao hơn 6,06 lần so với không methyl<br /> N<br /> N2 63 64,29<br /> hóa, với OR = 6,06 (95%CI: 3,28 - 11,21).<br /> Kết quả này phù hợp với nghiên cứu của<br /> N3 11 11,22<br /> Zhang X [6].<br /> <br /> 116<br /> t¹p chÝ y - d−îc häc qu©n sù sè 9-2019<br /> <br /> KẾT LUẬN 3. Nguyễn Quang Bộ. Nghiên cứu kết quả<br /> điều trị UTDD 1/3 dưới bằng phẫu thuật triệt<br /> - Ung thư biểu mô dạ dày gặp ở nam căn có kết hợp hóa chất. Luận án Tiến sỹ<br /> nhiều hơn nữ, tỷ lệ nam/nữ 2,27/1, tuổi Y học. Trường Đại học Y Dược, Đại học Huế.<br /> trung bình 61,5 ± 10,88. Nhóm tuổi hay 2017.<br /> gặp 60 - 69. 4. Phan Văn Cương. Tỷ suất mắc mới<br /> - Theo phân loại Lauren: UTBMDD thể UTDD giai đoạn 2009 - 2013. Hội nghị Khoa<br /> ruột gặp nhiều hơn thể lan tỏa. học toàn quốc lần thứ VI năm 2017 “Phòng<br /> - Theo phân loại của WHO (2000): ung chống các bệnh không lây nhiễm”. Tạp chí<br /> Y học Việt Nam. 2017, tr.25-30.<br /> thư biểu mô tuyến thể ống nhỏ gặp nhiều<br /> nhất, tiếp theo là thể không biệt hóa và 5. Bray F et al. Global cancer statistics<br /> 2018: GLOBOCAN estimates of incidence<br /> thể tế bào nhẫn, ít gặp nhất là ung thư<br /> and mortality worldwide for 36 cancers in 185<br /> biểu mô thể nhày. UTBMDD chủ yếu có<br /> countries. CA Cancer J Clin. 2018, 68 (6),<br /> độ biệt hóa kém. pp.394-424.<br /> - Methyl hóa gen SFRP2 làm tăng 6. Zhang X, Xuesong Zhang et al.<br /> nguy cơ UTDD, với OR = 6,06 (95%CI: Detection of aberrant promoter methylation of<br /> 3,28 - 11,21). Điều này cho thấy methyl RNF180, DAPK1 and SFRP2 in plasma DNA<br /> hóa gen SFRP2 có thể là dấu hiệu chuẩn of patients with gastric cancer. Oncol Lett. 2014,<br /> sinh học trong chẩn đoán UTDD. Oct, 8 (4), pp.1745-1750.<br /> 7. Lauren P. The two histological main<br /> TÀI LIỆU THAM KHẢO types of gastric carcinoma: Diffuse and so-called<br /> 1. Phạm Duy Hiển. Ung thư dạ dày. Nhà intestinal-type carcinoma. An attempt at a<br /> xuất bản Y học. 2007. histo-clinical classification. Acta Pathol<br /> 2. Lê Viết Nho. Nghiên cứu sự biểu lộ của Microbiol Scand. 1965, 64, pp.31-49.<br /> EGFR, HER2 và mối liên quan với lâm sàng, 8. Zhang Zh, Yu W. Methylation of claudin-3<br /> nội soi, mô bệnh học ở BN UTBMDD. Luận promoter predicts the prognosis of advanced<br /> án Tiến sỹ Y học. Trường Đại học Y Dược, gastric adenocarcinoma. Oncology Report.<br /> Đại học Huế. 2014. 2018, 40, pp.49-60.<br /> <br /> <br /> <br /> <br /> 117<br />
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2