Link xem tivi trực tuyến nhanh nhất xem tivi trực tuyến nhanh nhất xem phim mới 2023 hay nhất xem phim chiếu rạp mới nhất phim chiếu rạp mới xem phim chiếu rạp xem phim lẻ hay 2022, 2023 xem phim lẻ hay xem phim hay nhất trang xem phim hay xem phim hay nhất phim mới hay xem phim mới link phim mới

Link xem tivi trực tuyến nhanh nhất xem tivi trực tuyến nhanh nhất xem phim mới 2023 hay nhất xem phim chiếu rạp mới nhất phim chiếu rạp mới xem phim chiếu rạp xem phim lẻ hay 2022, 2023 xem phim lẻ hay xem phim hay nhất trang xem phim hay xem phim hay nhất phim mới hay xem phim mới link phim mới

intTypePromotion=1
ADSENSE

Giải mã kháng nguyên H, phân tích đặc điểm phân tử và xác định phả hệ nguồn gốc của canine distember virus gây bệnh Care ở chó tại Hà Nội

Chia sẻ: _ _ | Ngày: | Loại File: PDF | Số trang:9

18
lượt xem
0
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Phân tích phả hệ 2 chủng CDVHN6 và CDVHN7 thu nhận tại Hà Nội năm 2019 cho thấy sự gần gũi với chủng CDV/dog/HCM/33/140816 của Việt Nam (số GenBank: LC159587) thuộc genotye Asia-1 cùng với các chủng của châu Á bao gồm Trung Quốc, Thái Lan, Đài Loan. Tuy nhiên, hiện nay mới chỉ có được một hệ gen duy nhất CDV Thành phố Hồ Chí Minh 2014 đã công bố trên Ngân hàng gen, do vậy việc bổ sung thêm thông tin về nguồn dữ liệu gen của virus care là rất cần thiết nhằm góp phần nghiên cứu và sản xuất vaccine tái tổ hợp phòng bệnh cho chó tại Việt Nam.

Chủ đề:
Lưu

Nội dung Text: Giải mã kháng nguyên H, phân tích đặc điểm phân tử và xác định phả hệ nguồn gốc của canine distember virus gây bệnh Care ở chó tại Hà Nội

  1. KHOA HỌC KỸ THUẬT THÚ Y TẬP XXVIII SỐ 9 - 2021 GIAÛI MAÕ GEN KHAÙNG NGUYEÂN H, PHAÂN TÍCH ÑAËC ÑIEÅM PHAÂN TÖÛ VAØ XAÙC ÑÒNH PHAÛ HEÄ NGUOÀN GOÁC CUÛA CANINE DISTEMPER VIRUS GAÂY BEÄNH CARE ÔÛ CHOÙ TAÏI HAØ NOÄI Đặng Thị Mai Lan1*, Đỗ Đức Thành1, Đoàn Thị Thanh Hương *Emal: landangmaiorchiddhtn@gmail.com TÓM TẮT Chúng tôi đã xác định và lựa chọn được 2 chủng CDV virus (CDVHN6 và CDVHN7) thu nhận tại Hà Nội năm 2019 để tách chiết và thu được RNA tổng số. Sản phẩm thu được đem chạy RT-PCR và tinh sạch được 2 đoạn DNA có kích thước 2021 nucleotide, chứa hoàn toàn gen H có kích thước 1824bp. Hệ số tương đồng của 2 chủng là cao so với các chủng CDV thuộc genotype Asia - 1 đã được công bố trên Ngân hàng gen có tỷ lệ đồng nhất 97,30% về nucleotide và tỷ lệ tương đồng 97,20% về amino acid. Phân tích phả hệ 2 chủng CDVHN6 và CDVHN7 thu nhận tại Hà Nội năm 2019 cho thấy sự gần gũi với chủng CDV/dog/HCM/33/140816 của Việt Nam (số GenBank: LC159587) thuộc genotye Asia-1 cùng với các chủng của châu Á bao gồm Trung Quốc, Thái Lan, Đài Loan. Tuy nhiên, hiện nay mới chỉ có được một hệ gen duy nhất CDV Thành phố Hồ Chí Minh 2014 đã công bố trên Ngân hàng gen, do vậy việc bổ sung thêm thông tin về nguồn dữ liệu gen của virus care là rất cần thiết nhằm góp phần nghiên cứu và sản xuất vaccine tái tổ hợp phòng bệnh cho chó tại Việt Nam. Từ khóa: Care virus, Canine distemper, gen H, genotype Asia-1,…. H antigen decode, molecular characteristics analysis and original pedigree determine of canine distemper virus of care disease in dog in hanoi Dang Thi Mai Lan, Do Duc Thanh, Doan Thi Thanh Huong SUMMARY We have identified and selected 2 CDV virus strains (CDVHN6 and CDVHN7) collected in Hanoi in 2019 to extract and obtain total RNA. The obtained product was tested RT-PCR and purified 2 DNA fragments with the size of 2021 nucleotides, completely containing the H gene with size 1824bp. The similarity coefficient of the two strains is high compared to the CDV strains of genotype Asia - 1 published in the Gene Bank with 97.30% homogeneity rate of nucleotides and 97.20% amino acid similarity rate. . Genealogy analysis of the two strains CDVHN6 and CDVHN7 collected in Hanoi in 2019 shows the proximity to the Vietnamese strain CDV / dog / HCM / 33/140816 (number GenBank: LC159587) belong to genotye Asia-1 along with the strains of Asia include China, Thailand, and Taiwan. However, at present, there is only one genome, CDV in Ho Chi Minh City, 2014 which has been published in the Gene Bank, so it is very necessary to add more information about the gene data source of care virus to contribute to research and production of recombinant dog vaccines in Vietnam. Keywords: Virus care, Canine distemper, H gene, genotype Asia-1…. 1. ĐẶT VẤN ĐỀ gen là RNA sợi đơn âm, có kích thước khoảng 15.7kb, thuộc loài Canine morbillivirus, họ Bệnh Care hay còn được gọi là bệnh sài sốt Paramixoviridae, chi Morbillivirus. Virus có hệ ở chó là một bệnh truyền nhiễm cấp tính do gen mã hóa cho 8 protein, trong đó, protein H và virus Canine Distemper (Canine Distemper protein F là 2 protein kháng nguyên, quyết định Virus - CDV) gây ra. Virus gây bệnh Care có hệ tính độc lực của virus. Đây là các gen có nhiều biến đổi nhất giữa các chủng và giữa các genotype nên 1. Đại học Nông Lâm Thái Nguyên 2. Viện Công nghệ sinh học 81
  2. KHOA HỌC KỸ THUẬT THÚ Y TẬP XXVIII SỐ 9 - 2021 được chọn là đối tượng chính cho nghiên cứu dịch kết quả dương tính với test thử nhanh One - step tễ phân tử và nguồn gốc phả hệ (Ke và cs.,2015). Canine Distemper Virus Ag test (IMMUNO)). Mẫu được bảo quản lạnh ở -200C đến khi sử dụng. Gen H (mã hóa protein H) là một trong những gen biến đổi nhất được dùng để xác định mối liên 2.2. Phương pháp nghiên cứu hệ di truyền giữa các chủng (Gámiz và cs., 2011). 2.2.1. Phương pháp xác định con vật bệnh Gen H có khả năng biến đổi cao, quyết định tính dinh dưỡng của tế bào và vật chủ bằng cách liên Với những chó nghi mắc bệnh care có các triệu kết với phân tử hoạt hóa tế bào lympho báo hiệu chứng lâm sàng như: sốt cao, giảm ăn hoặc bỏ ăn, (SLAM) và các thụ thể hoại tử -4 của vật chủ. nôn mửa, thời gian nôn kéo dài. Chảy nước mũi, thở khó, ho và viêm phổi. Tiêu chảy kéo dài, phân Trần Văn Nên và cs. (2017) đã so sánh về nhày màu đen hoặc màu cà phê. Chó kiệt sức nhanh, trình tự nucleotide ở gen H giữa 5 chủng virus có triệu chứng thần kinh. Mắt đục dần và có mủ, nghiên cứu với nhau, kết quả thu được chủng loét. Xuất hiện chấm đỏ ở bẹn và bụng dưới... được CDV-VNUA-768 có số lượng vị trí sai khác so chúng tôi ghi chép thông tin và lấy mẫu bệnh phẩm với chủng CDV-HUA-02H, CDVHUA-03R, CDV-HUA-04H và CDV-HUA-05P lần lượt là: 2.2.2. Phương pháp thu thập bệnh phẩm 126, 131, 154, 16 vị trí. Chủng CDVHUA-02H có Dùng tăm bông vô trùng lấy các mẫu bệnh phẩm số lượng vị trí sai khác so với chủng CDV-HUA- (gỉ mắt, gỉ mũi, phân) từ chó nghi mắc bệnh Care, sau 03R, CDV-HUA-04H và CDV-HUA-05P lần lượt đó cho vào tuýp chứa 3ml môi trường vận chuyển để là: 7, 153, 124 vị trí. Chủng CDV-HUA-03R có số bảo quản, đầu tăm bông phải nằm ngập hoàn toàn lượng vị trí sai khác so với chủng CDV-HUA-04H trong môi trường vận chuyển và đóng nắp, siết chặt rồi và CDVHUA-05P lần lượt là 156 và 128 vị trí. cho vào túi nilon và có đánh dấu, ký hiệu để nhận biết. Chủng CDV-HUA-04H có 154 vị trí sai khác so Các mẫu bệnh phẩm được bảo quản lạnh ở với chủng CDV-HUA-05P. nhiệt độ 2 - 80C và đem về phòng Miễn dịch học - Nguyễn Văn Dũng và cs. (2018) đã phát hiện Viện Công nghệ sinh học. và phân lập thành công gen H của CDV, toàn 2.2.3. Phương pháp tách RNA bộ gen của các chủng phân lập được CDV/dog/ HCM/33/140816 và CDV/dog/HCM/38/140827 RNA tổng số bao gồm cả RNA hệ gen của virus được phân tích. Qua phân tích cây phát sinh được tách chiết bằng bộ sinh phẩm QIAamp Viral dòng, kết quả cho thấy các chủng CDV đều thuộc Mini Kit (QIAGEN Inc.) theo hướng dẫn của nhà genotype Asia-1 và có độ tương đồng khá cao sản xuất. Mẫu bệnh phẩm được bảo quản ở -800C (98,4 - 99,3%) với các chủng CDV từ Trung Quốc. cho đến khi sử dụng. Nhằm nghiên cứu, xác định được gen kháng 2.2.4. Phương pháp chuyển từ RNA sang cDNA nguyên H, phân tích được các đặc điểm phân tử, Sợi cDNA được tổng hợp theo phương pháp xác định được phả hệ nguồn gốc của virus CDV, chuyển đổi từ RNA tổng số của virus bằng mồi xác xác định genotype của chủng virus gây bệnh Care suất (hexamer), sử dụng bộ kit chuyển đổi và enzyme trên chó chúng tôi đã tiến hành: “Giải mã gen Maxima Reverse Transcriptase của hãng Fermentas kháng nguyên H, phân tích đặc điểm phân tử và theo hướg dẫn của nhà sản xuất. Thành phần phản xác định phả hệ nguồn gốc của Canine Distemper ứng với dung tích 20µl gồm có: 2µl RNA tổng số virus gây bệnh Care ở chó tại Hà Nội”. (100ng/µl); 1µl (100 picomol/µl) mồi Hexamer; 1µl hỗn hợp dNTP mix (10mM); 10.5µl H2O (nuclease- II. VẬT LIỆU VÀ PHƯƠNG PHÁP free); 4µl 5X RT buffer; 0.5µl RiboLock™ Rnase NGHIÊN CỨU Inhibitor (50U/µl) và 1µl MaximaTM Reverse Transcriptase (20U/µl). Phản ứng được thực hiện ở 2.1. Vật liệu nghiên cứu 500C trong 1 giờ, sau đó dừng phản ứng ở 800C trong - Mẫu bệnh phẩm: gỉ mắt, gỉ mũi, phân... thu 5 phút. Sản phẩm cDNA được bảo quản -200C cho nhận trên chó mắc bệnh Care ở mọi lứa tuổi (cho đến khi được sử dụng để thực hiện phản ứng PCR. 82
  3. KHOA HỌC KỸ THUẬT THÚ Y TẬP XXVIII SỐ 9 - 2021 2.2.5. Phương pháp PCR tổng hợp ở vị trí 3’ có chứa nhóm -OH tự do, khi gặp Phản ứng PCR được thực hiện trên khuôn cDNA nucleotide không chứa nhóm 3’-OH (ddNTP) thì thu vùng gen H của mẫu nghiên cứu. Trong nghiên cứu phản ứng tổng hợp dừng lại. Đặc trưng của phương này chúng tôi dùng bộ kit DreamTaq PCR Mastermix pháp này là dùng ddNTP (bị mất 2 nguyên tử oxy ở vị (2X) do hãng Thermo Scientific (Mỹ) cung cấp và trí cacbon 3 và 4) để dừng phản ứng một cách ngẫu phản ứng thực hiện trên máy PCR (PTC-100). nhiên. Kết quả là tạo ra các đoạn DNA sợi đơn dài ngắn khác nhau và chỉ sai khác nhau một nucleotide. Phản ứng PCR được thực hiện với dung tích là 50 µl, sử dụng kit Dream Taq PCR mastermix (Thermo Các phân đoạn gen được giải trình tự trực tiếp Fisher Scientific, Mỹ), bổ sung 2 µl (10pmol/µl) bằng mồi xuôi và mồi ngược theo phương pháp mỗi loại mồi, 2 µl khuôn cDNA (50ng/µl), 2 µl Sanger. Chương trình GENEDOC 2.7 được sử DMSO (dimethyl sulfoxide), 25 µl Dream Taq PCR dụng để phân tích và so sánh chuỗi gen. Xây dựng mastermix (2X), thêm 17 µl nước khử ion DEPC. phả hệ nguồn gốc bằng chương trình MEGA7, sử dụng phương pháp ”kết nối liền kề” (Neighbour- Phản ứng PCR được thực hiện trên máy MJ joining method) (Kumar và cs., 2016). PTC-100 (USA): 1 chu kỳ ở 940C/5 phút, 35 chu kỳ (940C /30 giây, 520C/30 giây; 720C/3 phút), chu III. KẾT QUẢ VÀ THẢO LUẬN kỳ cuối ở 720C/10 phút. Sản phẩm PCR được điện di kiểm tra trên thạch agarose 1%, nhuộm ethidium 3.1. Kết quả về tình hình chó mắc bệnh Care tại bromide và quan sát trên máy soi gel dưới ánh sáng một số Quận trên địa bàn Hà Nội tia cực tím (Wealtech, Mỹ). Sản phẩm PCR được 3.1.1. Tình hình chó mắc bệnh Care tại một số tinh sạch bằng bộ kit GeneJET Gel PCR Purification Quận ở Hà Nội của hãng Thermo theo hướng dẫn của nhà sản xuất. Sản phẩm được tinh sạch được dùng để giải trình tự Chúng tôi đã khảo sát một số phòng khám trên trực tiếp hoặc dòng hóa trước khi giải trình tự. địa bàn 3 quận Hà Đông, Cầu Giấy và Nam Từ Liêm - Hà Nội và ghi nhận trong tổng số 845 chó 2.2.6. Phương pháp giải trình tự và các trình tự đến khám và điều trị có các triệu chứng nghi mắc sử dụng để so sánh bệnh care. Những trường hợp này được lấy mẫu Phương pháp giải trình tự (sequencing) dựa vào xét nghiệm bằng One - step Canine Distemper hoạt động của enzyme DNA-polymerase trong quá Virus Ag test để xác định bệnh care trên chó. Kết trình tổng hợp DNA, emzym DNA-polymerase xúc quả cho thấy có 161 trường hợp chó mắc bệnh tác gắn các nucleotide vào mạch đơn DNA đang chiếm 19,05%. Kết quả được thể hiện ở bảng 3.1. Bảng 3.1. Tỷ lệ chó mắc bệnh Care tại 3 Quận ở Hà Nội Địa điểm Số chó điều tra Số chó mắc bệnh Tỷ lệ mắc Số chó chết Tỷ lệ chết (Quận) (con) (con) (%) (con) (%) Hà Đông 312 63 20,19 48 76,19 Cầu Giấy 298 48 14,30 30 62,50 Nam Từ Liêm 235 50 21,28 42 84,00 Tính chung 845 161 19,05 120 74,53 Kết quả của bảng 3.1 cho thấy, trong tổng số 845 dịch mũi và có thể có triệu chứng thần kinh…. Tỷ lệ chó điều tra tại các phòng khám ở 3 Quận trên địa chó chết khi mắc bệnh chiếm tỷ lệ 74,53% do chó ỉa bàn Hà Nội có 161 chó được phát hiện mắc bệnh chảy, mất nước, mất máu, đặc biệt tổn thương ở hệ Care chiếm 19,05% với các triệu chứng điển hình: hô hấp gây ảnh hưởng tới quá trình trao đổi khí. Kết sốt, bỏ ăn hoặc ăn ít, nôn mửa, ỉa chảy, phân có lẫn quả cũng cho thấy, khi chó bị mắc bệnh Care thì việc máu, trên vùng da mỏng có nốt sài, chảy dịch mắt điều trị là rất khó do virus tác động, gây tổn thương 83
  4. KHOA HỌC KỸ THUẬT THÚ Y TẬP XXVIII SỐ 9 - 2021 nặng hệ tiêu hóa và hệ hô hấp, đồng thời làm giảm RNA tổng số sau khi tách chiết được bảo quản sức đề kháng của chó nên tỷ lệ chết còn khá cao. ở - 80°C cho tới khi được dùng làm khuôn cho 3.2. Kết quả về số mẫu xét nghiệm và thu nhận phản ứng chuyển đồi cDNA. Trước khi thực hiện gen H của chó mắc bệnh Care các thí nghiệm tiếp theo RNA tổng số được kiểm tra chất lượng bằng cách đo nồng độ axit nucleic 161 mẫu bệnh phẩm là hỗn hợp gỉ mắt, gỉ mũi của bằng máy Nanodrop (Nhật Bản) với bước sóng chó mắc bệnh được thôi ra nước sạch rồi tiến hành tách 260nm. Hai mẫu trong nghiên cứu này là 2 mẫu có chiết RNA tổng số. Sản phẩm thu được đem chuyển chất lượng RNA tốt (nồng độ khá cao, ít tạp chất). đổi từ RNA tổng số của virus sang sợi cDNA bằng mồi xác suất (hexamer) sử dụng bộ kit và enzyme 3.3. Kết quả phản ứng PCR và giải trình tự Maxima Reverse Transcriptase của hãng Fermentas. nucleotide, amino acid của gen H Bảng 3.2. Cặp mồi sử dụng PCR STT Tên mồi Trình tự mồi (5’ 3’) 1 C6863H-F GTCGATCCGRCATTTAAACCTG 2 C9071H-R ATTTGGGCTATCTAGATGGACC C6863H-F, C9071H-R có kích thước (Singapore) sản phẩm PCR được tinh sạch khoảng 2.2kb. Toàn bộ gen H nằm trọn bằng cách thôi gel dùng bộ kit GeneJET trong đoạn DNA này. Trước khi được gửi PCR Gel purification của hãng Thermo theo đi đọc trình tự tại công ty The FirstBase hướng dẫn của nhà sản xuất. M 1 2 2.2kb 2.2kb 2.0kb 564bp Hình 3.1. Kết quả điện di sản phẩm PCR nhân gen H của 2 chủng CDV nghiên cứu M: chỉ thị phân tử DNA của thực khuẩn thể Lambda được cắt bằng HindII; 1: là phân đoạn của hệ gen CDVHN7; 2: là phân đoạn của hệ gen CDVHN6 Với cặp mồi: C6863H-F, C9071H-R đã thu 1824bp. Trình tự nucleotide và amino acid (suy nhận được phân đoạn DNA có kích thước 2021 diễn) của gen H thu được từ 2 chủng được trình nucleotide, chứa hoàn toàn gen H có kích thước bày bên dưới đây: 84
  5. KHOA HỌC KỸ THUẬT THÚ Y TẬP XXVIII SỐ 9 - 2021 Hình 3.2. Trình tự nucleotide và amico acid (suy diễn) của gen H chủng CDVHN7 Chú thích: Dòng trên là trình tự nucleotide, dòng dưới là trình tự amino acid (suy diễn) Hình 3.3. Trình tự nucleotide và amino acid (suy diễn) của gen H chủng CDVHN6 Chú thích: Dòng trên là trình tự nucleotide, dòng dưới là trình tự amino acid (suy diễn) 85
  6. KHOA HỌC KỸ THUẬT THÚ Y TẬP XXVIII SỐ 9 - 2021 3.4. Kết quả phân tích gen H và so sánh với các America - 2 (America-2/00-2601- US-2004), chủng của thế giới Arctic (Arctic/CDV2784-IT-2013) và Africa. Các chuỗi nucleotide thu nhận được từ 02 virus Nghiên cứu cho thấy chủng CDVHN7 và phân lập được ở Hà Nội năm 2019 sử dụng chương CDVHN6 có tỷ lệ đồng nhất cao nhất khi so trình Blast để so sánh với Ngân hàng gen cho sánh với chủng CDV-dog-HCM-33-140816 (số thấy có hệ số tương đồng cao, từ 97,30% đối với GenBank: LC159587) thu được tại TP. Hồ Chí nucleotide và 97,20% đối với amino acid hơn khi so Minh năm 2014 (99,40%) (https://www.ncbi.nlm. sánh với các chủng CDV thuộc genotype Asia - 1. nih.gov/nuccore/LC159587.1/). Trình tự nucleotide và amio acid vùng gen H Khi so sánh với các chủng CDV thuộc các của các chủng nghiên cứu được so sánh với các genotype khác, tỷ lệ đồng nhất về nucleotide và tỷ lệ chủng CDV của thế giới trên ngân hàng gen, tương đồng về amino acid thấp hơn đáng kể (90,00% bao gồm đại diện của 8 genotype phổ biến: Asia về nucleotide và 88,60% về amino acid so với chủng - 1 (Asia-1/CDV-dogHCM-33-140816), Asia - 2 Onderstepoort (số GenBank: AF378705) (https:// (Asia-2/50Con-JP-2013), Asia - 4 (Asia-4/CDV8- www.ncbi.nlm.nih.gov/nuccore/AF378705.1/) TH-2014), Europe (Europe/5804-US-2003), thuộc genotype America-1 mà chủng Onderstepoort America - 1 (America-1/Onderstepoort-US-2002), lại là chủng dùng trong sản xuất vaccine ngày nay. Bảng 3.3. Tỷ lệ đống nhất về nucleotide và amino acid giữa các chủng CDV nghiên cứu và các chủng của thế giới 1. CDVHN6; 2. CDVHN7; 3.CDVHN5-(VN-2018); 4.CDV-dog-HCM-33-140816(VN-2014)-LC159587; 5.Canine-NTU-2005-1-TW-2005(MK431532); 6. Onderstepoort (AF378705);7. SnyderHill-US(JN896987); 8. 01-2689-US-2001(AY649446) ; 9. A75-17-US(AF164967); 10. 25130-IT-2015(KX943324) ; 11. CDV2784-2013- IT-2013(KF914669); 12. 50Con-JP(AB476402) ; 13. 55L-JP(AB475099); 14. CDV1-TH-2014(MH496772); 15. CDV8-TH-2014(MH496777); 16. 5804DE(AY386315); 17. Uy251-UY-2012(KM280689); 18. WT01SA-ZA- 2016(KY971528). 86
  7. KHOA HỌC KỸ THUẬT THÚ Y TẬP XXVIII SỐ 9 - 2021 Toàn bộ gen H của 2 chủng virus nghiên là TGA trong khi đó ở 2 chủng vaccine lại là TAA cứu gồm 1824 nucleotide. Độ dài này giống với khiến chủng virus vaccine Onderstepoort khác hẳn đa số độ dài gen H của các chủng CDV ở nhiều với các chủng virus khác ở vị trí kết thúc 1815 genotype trong đó có cả chủng vaccine SnyderHill (của gen H). Chủng virus nghiên cứu CDVHN6 (JN896987) (thuộc genotype America - 1) nhưng cũng có sự sai khác (T1815C) so với các chủng lại dài hơn độ dài của gen H của chủng virus vaccine khác ở vị trí này (Hình 3.4). Sự sai khác này dẫn là Onderstepoort (AF378705) 9 nucleotide tương đến sai khác về amino acid (L605S). Đây là sự ứng với 3 amino acid. Chín nucleotide này nằm ở khác biệt rõ rệt nhất trong gen H của các chủng cuối gen H. Bộ 3 kết thúc của chủng nghiên cứu virus thực địa so với chủng virus vaccine. Hình 3.4. Sai khác nucleotide ở cuối gen H dẫn đến sự khác biệt của chủng virus vaccine so với chủng virus nghiên cứu Kết quả so sánh trình tự nucleotide của gen H so chủng CDV thu thập tại Việt Nam và thế giới dựa với các chủng CDV thuộc các genotype khác nhận trên trình tự toàn bộ gen H (Hình 3.6). thấy: các chủng virus CDV thuộc genotype Asia - Trình tự gen H của 2 chủng virus CDNHN6 1 có sự khác biệt hoàn toàn với các genotype khác và CDVHN7 được đưa vào 2 phần mềm tin - sinh ở các vị trí 30 vị trí trên gen H dẫn đến 4 vị trí sai chuyên dụng là GENEDOC 2.7 và MEGA 7 để khác amino acid (A179G, T267N, V359A) trong xác định tỷ lệ tương đồng nucleotide/amino acid đó tại vị trí 1590 (tương ứng với vị trí amino acid và xây dựng phả hệ nguồn gốc. 530) có sự khác biệt hoàn toàn giữa các genotype. Kết quả phân tích phả hệ nguồn gốc của 3.5. Kết quả phân tích phả hệ nguồn gốc của các chủng CDV dựa trên dữ liệu trình tự các chủng CDV Việt Nam nucleotide của gen H chủng CDVHN6 gần gũi Hai chủng CDV trong nghiên cứu này được nhất với chủng CDVHN5 thu được tại Hà Nội, phân tích xác định phả hệ nguồn gốc cùng 49 Việt Nam năm 2018 (đã được giải mã toàn bộ 87
  8. KHOA HỌC KỸ THUẬT THÚ Y TẬP XXVIII SỐ 9 - 2021 hệ gen). Sự gần gũi có thể là do vị trí và thời HCM/33/140816 thu được tại thành phố Hồ điểm thu 2 mẫu này tương đối giống nhau Chí Minh năm 2014. Cả hai chủng nghiên cứu (cùng ở Hà Nội và cùng năm 2018). Chủng đều thuộc genotype Asia - 1. Kết quả được thể CDVHN7 lại gần gũi với chủng CDV/dog/ hiện ở hình 3.5. Hình 3.5. Cây phả hệ thể hiện mối quan hệ nguồn gốc giữa các chủng CDV nghiên cứu (đánh dấu hình ) và các chủng của thế giới Cây phả hệ cho thấy chủng CDVHN6 và Nội, CDV/dog/HCM/33/140816 của Việt Nam phân CDVHN7 thu nhận tại Hà Nội năm 2019 thuộc lập năm 2014 tại TP.Hồ Chí Minh; trong đó chủng genotye Asia - 1 cùng với các chủng của châu Á CDVHN6 có quan hệ gần gũi nhất với CDVHN5 của bao gồm Trung Quốc, Thái Lan, Đài Loan và chủng Việt Nam, chủng CDVHN7 gần gũi nhất với chủng CDVHN5 của Việt Nam phân lập năm 2018 tại Hà CDV/dog/HCM/33/140816 cũng của Việt Nam (số 88
  9. KHOA HỌC KỸ THUẬT THÚ Y TẬP XXVIII SỐ 9 - 2021 GenBank: LC159587). Kết quả nghiên cứu này hoàn Xuyến, Nguyễn Thị Bích Nga, Lê Thanh Hòa toàn thống nhất với kết quả nghiên cứu năm 2018 (2018), “Đặc điểm phân tử và phả hệ nguồn gốc khi xác định genotype của các chủng virus CDV thu virus gây bệnh Care (Cannine Distemper Virus) nhận tại Hà Nội dựa trên dữ liệu gen H (Đoàn Thị phân lập năm 2017 tại Hà Nội”. Hội nghị khoa Thanh Hương và cs., 2018). học Công nghệ sinh học toàn quốc 2018, Nxb Khoa học Tự nhiên & Công nghệ: 1705 - 1711. Một số nghiên cứu tại Việt Nam cho thấy: các chủng CDV từ năm 2013 - 2018 chưa có sự biến đổi 3. Nguyễn Thị Lan (2012), “Nghiên cứu giải trình lớn, đều thuộc genotype Asia - 1. Điều này rất thuận tự đoạn gen Haemnagglutinin của virus gây bệnh care cho chó trên địa bàn Hà Nội và vùng phụ cận lợi cho công tác phòng bệnh bằng vaccine tại Việt Hà Nội”, Tạp chí Khoa học kỹ thuật Chăn nuôi Nam. Tuy nhiên, đáng chú ý là nhiều loại vaccine 7(160): 49 - 56. đang sử dụng hiện nay được nhập khẩu từ Mỹ và các nước châu Âu, có sự khác biệt khá lớn về trật tự hệ 4. Trần Văn Nên, Nguyễn Thị Lan, Nguyễn Văn gen, cũng như không gần gũi về phả hệ nguồn gốc Thanh, Lương Quốc Hưng (2017), “Nghiên với các chủng thuộc genotype Asia - 1. Do đó, chúng cứu một số đặc điểm sinh học phân tử của virus ta nên thận trọng khi sử dụng các chủng vaccine Care phân lập được tại một số tỉnh phía Bắc Việt nhập khẩu tiêm phòng cho chó tại Việt Nam. Nam”, Tạp chí Khoa học Nông nghiệp Việt Nam, 15(1): 44 - 57. IV. KẾT LUẬN VÀ ĐỀ NGHỊ 5. Phan Thị Hồng Phúc, Nguyễn Thị Ngân, La Văn - Tại 3 Quận (Hà Đông, Nam Từ Liêm, Cầu Công, Đặng Thị Mai Lan, Nguyễn Thị Bích Đào, Giấy - Hà Nội có tỷ lệ chó mắc bệnh care là Nguyễn Đình Thắng (2019), “Nghiên cứu một số 19,05% với 74,53% số con chết do bệnh. đặc điểm dịch tễ ở chó mắc bệnh Care tại Bệnh xá Thú y, trường Đại học Nông Lâm Thái Nguyên”, - Đã xác định và lựa chọn 2 mẫu CDVHN6, Tạp chí Khoa học Kỹ thuật Thú y, 16(4): 43 - 50. CDVHN7 để tách chiết RNA. Sản phẩm PCR thu được tiếp tục được tinh sạch và thu nhận 2 phân 6. Đỗ Thị Roan, Đỗ Đức Thành, Đặng Thị Mai Lan, đoạn DNA có kích thước 2021 nucleotide, chứa Phạm Hồng Ngọc, Nguyễn Hữu Đức, Nguyễn Thị Khuê, Nguyễn Thị Thu Hiền, Lê Thị Kim hoàn toàn gen H có kích thước 1824bp. Xuyến, Lê Thanh Hòa,Đoàn Thị Thanh Hương - Đã xác định được 2 chủng virus phân lập (2020), “Giải mã hệ gen canine distemper virus được có hệ số tương đồng cao so với các chủng đã gây bệnh trên chó năm 2018”, Tạp chí Công nghệ được công bố trên Ngân hàng gen với tỷ lệ đồng sinh học 18(3): 465-475. nhất 97,30% về nucleotide và tỷ lệ tương đồng 7. Gámiz C., Martella V., Ulloa R., Fajardo 97,20% về amino acid. R., Hernandér I. Q., Martínez S. (2011), - Đã phân tích phả hệ nguồn gốc 2 chủng CDVHN6 “Indentification of a new genotype of canine và CDVHN7 thu nhận tại Hà Nội năm 2019 cho thấy distemper virus circulating in America”, Vet. Res. sự gần gũi với chủng CDV/dog/HCM/33/140816 của Commun. 35: 381 - 390. Việt Nam (số GenBank: LC159587) thuộc genotye 8. Ke G.M., Ho C.H., Chiang M.J., Shanno Asia-1 cùng với các chủng của châu Á bao gồm Trung D., Chung C.S., Lin M.Y., Shi Y.Y., Yang Quốc, Thái Lan, Đài Loan. M.H., Tyan Y.C., Liao P.C., Chu P.Y. (2015), “Phylodynamic analysis of the canine distemper TÀI LIỆU THAM KHẢO virus hemagglutinin gene”, BMC Vet Res 11: 164. 1. Nguyễn Văn Dũng, Vũ Kim Chiến, Phan Xuân 9. Kumar S, Stecher G, Tamura K (2016) Thảo (2018), “Phân lập và xác định đặc tính di MEGA7:Molecular Evolutionary Genetics truyền của virus gây bệnh Care trên chó nuôi tại Analysis version 7.0. Mol Biol Evol 30: 2725–2729. thành phố Hồ Chí Minh”, Tạp chí Khoa học Kỹ thuật Thú y, 15(4): 19 - 26. Ngày nhận 10-6-2021 2. Đoàn Thị Thanh Hương, Nguyễn Thị Khuê, Ngày phản biện 14-5-2021 Đỗ Thị Roan, Nguyễn Ngọc Trâm, Lê Thị Kim Ngày đăng 15-8-2021 89
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2