intTypePromotion=3

Khảo sát hoạt tính kháng khuẩn của dịch chiết cỏ mực (Eclipta alba) đối với vi khuẩn được phân lập từ ruột tôm sú (Penaeus monodon)

Chia sẻ: Ni Ni | Ngày: | Loại File: DOC | Số trang:7

0
41
lượt xem
2
download

Khảo sát hoạt tính kháng khuẩn của dịch chiết cỏ mực (Eclipta alba) đối với vi khuẩn được phân lập từ ruột tôm sú (Penaeus monodon)

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Dịch chiết methanol cây cỏ mực được thử nghiệm hoạt tính kháng khuẩn bằng phương pháp khuếch tán trên thạch ở 12 chủng vi khuẩn được phân lập từ 30 mẫu ruột tôm sú được thu thập từ 6 ao nuôi tôm tại ấp Tân Thành, xã Lợi An, huyện Trần Văn Thời, tỉnh Cà Mau.

Chủ đề:
Lưu

Nội dung Text: Khảo sát hoạt tính kháng khuẩn của dịch chiết cỏ mực (Eclipta alba) đối với vi khuẩn được phân lập từ ruột tôm sú (Penaeus monodon)

  1. TAP CHI SINH HOC 2015, 37(1se): 261­266  DOI:     10.15625/0866­7160/v37n1se. KHẢO SÁT HOẠT TÍNH KHÁNG KHUẨN CỦA DỊCH CHIẾT  CỎ MỰC (Eclipta alba) ĐỐI VỚI VI KHUẨN ĐƯỢC PHÂN LẬP  TỪ RUỘT TÔM SÚ (Penaeus monodon) Đái Thị Xuân Trang*, Võ Thị Tú Anh Trường Đại học Cần Thơ, *dtxtrang@ctu.edu.vn TÓM TẮT:  Dịch chiết methanol cây cỏ  mực được thử  nghiệm hoạt tính kháng khuẩn bằng   phương pháp khuếch tán trên thạch ở 12 chủng vi khuẩn được phân lập từ  30 mẫu ruột tôm sú   được thu thâp t ̣ ừ 6 ao nuôi tôm tại  ấp Tân Thành, xã Lợi An, huyện Trần Văn Thời, tỉnh Cà  Mau. Khuẩn lạc của các chủng vi khuẩn khi nuôi trên môi trường TCBS sau 24 giờ đều có màu   vàng hoặc xanh, tế bào Gr (­). Thí nghiệm khảo sát hoạt tính kháng khuẩn của dịch chiết được  thực hiện  ở các nồng độ  dịch chiết là: 8, 16, 32 , 64 và 128 µg/mL. Dịch chiết cây cỏ  mực thể  hiện tính kháng đối với 10/12 chủng vi khuẩn đã phân lập, đạt hiệu quả   ức chế  cao nhất với   chủng G5 ở nồng độ 8 µg/mL, đường kính vòng kháng khuẩn đạt 30,3 mm. Ba chủng vi khuẩn   có kết quả  khảo sát hoạt tính kháng khuẩn cao nhất (G5), trung bình (G2) và thấp nhất (Y1)   được chọn để  kiểm tra các đặc điểm sinh hóa với bộ  Kit API 20E và định danh bằng phương   pháp Maldi toff mass và giải trình tự  gen 16S rDNA. Từ các đặc điểm sinh lý, sinh hóa và giải   trình tự  16S rDNA cho thấy, chủng Y1 đồng hình với   Enterobacter cloacae  (97%),  chủng G2  đồng hình với  Vibrio brasiliensis  (98%)  và chủng G5 đồng hình với  Vibrio parahaemolyticus   (99%). Từ khóa: Eclipta alba, Penaeus monodon, định danh, hoạt tính kháng khuẩn, phân lập. MỞ ĐẦU tinh ́   vi   khuân̉   đường   ruôṭ   tôm   sú   ́   khang ̉ (Penaeus monodon) cua cao chiêt cây co m ́ ̉ ực  Việc sử  dụng các loại hoá chất và kháng  ̀ ơ  sở  khoa hoc cho nh (Eclipta alba)  lam c ̣ ưng ̃   ̀ ̣ ̣ sinh phong tri bênh cho tôm không đung quy ́   ứng dung th ̣ ảo dược trong nuôi trông thuy san ̀ ̉ ̉   cách và liều lượng đang gây  ảnh hưởng lớn  noi chung va nghê nuôi tôm noi riêng.  ́ ̀ ̀ ́ tới môi trường, tao điêu kiên phat sinh nh ̣ ̀ ̣ ́ ưng ̃   VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU ̀ ̉ dong vi khuân khang thuôc, không lo ́ ́ ại trừ khả  Ba   mươi   mẫu   tôm   sú   lơń   có  dâu ̣   ́   hiêu năng các chủng vi khuẩn kháng thuốc có thể  ̣ nhiêm bênh đ ̃ ường ruôt đ ̣ ược thu thâp t ̣ ừ 6 ao  gây bệnh  ở  người  [9].  Hiên nay, đa co nhiêu ̣ ̃ ́ ̀  nuôi tôm tại  ấp Tân Thành, xã Lợi An, huyện  nghiên   cưú   về   các   chiết   xuất   từ   thảo   dược   Trần Văn Thời, tỉnh Cà Mau.  được nghiên cứu sử  dụng điều trị  bệnh trên  động vật thủy sản [12], hoat tinh khang khuân ̣ ́ ́ ̉   Hai mươi kilogram cây cỏ  mực được thu  ̉ cua cac loai thao d ́ ̀ ̉ ược thương đ ̀ ược sử  dung ̣   cả  rễ, thân và lá tại xã Thới Hưng, huyện Cờ  trong dân gian như  lá tràm [5], cây cỏ  mực và   Đỏ, thành phố Cần Thơ.  cây diệp hạ  châu thân xanh [4], vỏ  và lá trái  Phân lập vi khuẩn từ ruột tôm sú tắc [6]. Tôm được khử trùng bề mặt với cồn 75%   Cây   cỏ   mực   là  cây   thuôć   được   sử   dung ̣   trước khi giải phẫu lấy phần ruột. Ruột tôm   nhiêu trong dân gian đê ch ̀ ̉ ưa bênh cho tôm ca, ̃ ̣ ́  được nghiền với dung dịch NaCl 0,9%,  sau đó  tuy nhiên, chỉ  dừng  ở  mức kinh nghiệm, làm  dịch   nghiền   được   trải   đều   lên   đĩa   thạch  theo ý thích, chưa có phương pháp khoa học   TCBS,  ủ  mẫu  ở  nhiệt độ  32oC trong 24 giơ.̀  cụ  thể  cung nh ̃ ư  chưa tìm ra liều lượng thích  Các khuẩn lạc tiêu biểu được  lựa chọn cho   hợp. Vì vây, vi ̣ ệc nghiên cứu khao sat ̉ ́ hoaṭ   các nghiên cứu tiếp theo. 5
  2. Khaỏ   sat́   hoaṭ   tinh ́   khang ́   khuân ̉   cuả   cao  Định danh vi khuẩn chiêt cây co m ́ ̉ ực Ba chủng vi khuẩn có kết quả   ức chế bởi  Quy   trình   chiết   cao   thô   methanol   cây   cỏ  cao cây cỏ  mực cao nhất, trung bình và thấp  mực  được   thực   hiện  theo  phương   pháp  của   nhất được chọn định danh bằng phương pháp  Nguyễn Kim Phi Phụng (2007) [10]. Cỏ  mực   Maldi tof mass [11] và kỹ  thuật giải trình tự  sau khi thu hái được loại bỏ  phần sâu bệnh,  16S   rDNA   với   cặp   mồi:   27F   (5 ­ rửa sạch, phơi hoặc sấy khô  ở  40°C, nghiền  AGAGTTTGATCCTGGCTCAG­3 ) và 1492R  nhuyễn thành bột.  Bột  cây được chiết bằng  (5'GGTTACCTTGTTACGACTT3') [13]. Đoạn  phương pháp ngâm dầm với methanol 99,5%  gen   16S   rDNA   được   giải   trình   tự   bằng  trong   24   giờ   ở   nhiệt   độ   phòng.   Dịch   chiết  phương pháp dideoxy, sử dụng bộ  kit BigDye  methanol được cô quay để  loại bỏ  dung môi  Terminator   v3.1   Cycle   Sequencing   (Applied  dưới   áp   suất   200­300   mmHg   thu   được   cao  biosystems,   Hoa   Kỳ).   Kết   quả   giải   trình   tự  tổng. Cao tổng sau thu được trữ   ở  4°C. Nông ̀   được   so   sánh   với   các   trình   tự   trên   Genbank  đô ̣ ưc chê tôi thiêu cua cao methanol đôi v ́ ́ ́ ̉ ̉ ́ ới vi  bằng chương trình BLAST [3]. khuân̉   được   xác   định   băng ̀   phương   pháp  khuêch tan trên th ́ ́ ạch [7, 8] với các nồng độ  KẾT QUẢ VÀ THẢO LUẬN dịch chiết  8,  16,  32,  64 và  128 µg/mL.  Dịch   Phân lập vi khuẩn chiết được trích và pha loãng với methanol nên  sử   dụng   methanol   làm   đối   chứng   âm.   Thí  Mười hai chủng vi khuẩn phân lập được  nghiệm   lặp   lại   3   lần   ở   mỗi   nồng   độ   dịch  từ  30 mẫu ruột tôm sú bệnh trên môi trường   chiết.  TCBS có 53% có khuẩn lạc vàng (có khả năng  lên men đường sucrose) và 47% có khuẩn lạc  Kết quả kháng khuẩn của dịch chiết được  xanh   (không   có   khả   năng   lên   men   đường  xử   lý   thống   kê   bằng   phương   pháp   ANOVA  sucrose) (hình 1).  với phần mềm Minitab 16.1. Hình thái và các đặc điểm sinh hóa của các  chủng vi khuẩn  Hình dạng, kích thước và tính ròng của vi  khuẩn   được   xác   định   bằng   phương   pháp  nhuộm   gram  [1].   Ba   chủng   vi   khuẩn   được  chọn khảo sát đặc điểm sinh hóa với bộ  Kit  API­20E   (Biomerieux,   Pháp)  [3].  Kết   quả  được   kiểm   tra   trên   trang   web  https://apiweb.biomerieux.com/.  a b 6
  3. Hình 1. Vi khuẩn đường ruột tôm trên môi trường TCBS a: Chủng Y2; b: Chủng G2 Hoaṭ   tinh ́   khang ́   khuân ̉   cua ̉   cao   chiêt́   cây   sinh   bằng   kit   API­20E   được   trình   bày   ở  co m ̉ ực bảng 2. Dựa vào các đặc điểm sinh lý sinh hóa  Kết quả  khảo sát khả  năng kháng khuẩn  của   của dịch chiết cây cỏ  mực với các nồng độ  các   chủng   vi   khuẩn   cho   thấy,   chủng   Y1   có  khác   nhau   lên   các   chủng   vi   khuẩn   phân   lập  khả năng là Enterobacter cloaceae, G5 có khả   được cho thấy, dịch chiết có khả  năng kháng  năng   là  Vibrio   cholerae,   V.   mimicus,   10/12 chủng vi khuẩn đã phân lập   (bảng 1).  V. parahaemolyticus  hoặc  V. vulnificus,  G2 có  Đối   với   một   số   chủng   vi   khuẩn,   hoạt   tính  khả  năng là  V. fluvialis  (bảng 2). Do nhóm vi  kháng khuẩn tăng khi tăng nồng độ dịch chiết.   khuẩn Vibrio spp. có tính đa hình cao, hệ thống  Đối với một số chủng, dịch chiết có khả năng  định danh khá phức tạp nên việc sử dụng đặc  ức chế ở nồng độ rất thấp (8 µg/ml) (bảng 1).  điểm sinh hóa khó có thể  định danh chính xác  Theo   nghiên   cứu   đánh   giá   đặc   tính   thuần  đến mức loài [2]. chủng và hoạt tính kháng khuẩn của cây cỏ  mực và cây diệp hạ  châu thân xanh  ở  Đồng  bằng   sông   Cửu   Long,   11   loài   cỏ   mực   khác  nhau đều tác động rất mạnh trên Edwardsiella  tarda  (MIC=256­512   µg/ml),   kế   đến  Edwardsiella   ictaluri  (MIC=512   µg/ml),  Staphylococcus   aureus  và  Aeromonas  hydrophila  (MIC=1024­2048   µg/ml)  [4].  Như  vậy, cây cỏ mực có hoạt tính kháng khuẩn với  nhiều   loài   vi   khuẩn   và   thể   hiện   hoạt   tính  kháng khuẩn cao đối với các chủng vi khuẩn  đã phân lập được (MIC= 8­64 µg/ml). Hình thái và các đặc điểm sinh hóa của các  chủng vi khuẩn  Tất cả 12 chủng vi khuẩn được nhận diện  là G (­). Trong đó, 11 chủng vi khuẩn có tế bào   dạng hình que ngắn và 1 chủng có dạng hình  cầu.  Kết quả định danh dựa trên đặc điểm hóa Bảng 1. Kích thước vòng vô khuẩn ở các nồng độ khác nhau của dịch chiết cây cỏ mực Chủng  Đường kính vòng vô khuẩn (mm) MIC STT vi  ở các nồng độ dịch chiết khác nhau (µg/mL) (µg/mL) khuẩn 8 16 32 64 128 1 G1 0e 0e 8,3e 14,3e 24,7e 32 2 G2 21b,c 28b 30,7c 36,3c 40,3b,c  8 3 G3 14.3d 18,7 c 33,7 b,c 41b 59,7a  8 4 G4 23,7b 37,3a 45a 49,7a 57,3a  8 5 G5 30,3a 35,3 a 37 b 40b 41,3b  8 7
  4. 6 Y1 0e 0e 0f 0f 0g ­ 7 Y2 0e 11,3d 24,3d 30,7d 35d 16 8 Y3 19b,c,d 25,7b 30c 33c,d 37,3c,d  8 9 Y4 0e 0e 0f 0f 0g ­ 10 Y5 0e 0e 3,3f 12,7e 16,3f 32 11 Y6 23.7b 25,3b 29,3c 35,7c 41,3b  8 12 Y7 17,7c,d 28b 32c 36,3c 40,7b,c  8 Các giá trị trong từng cột có cùng chữ cái thì không khác biệt có ý nghĩa ở P
  5. VP test + ­ + Gelatin liquefaction ­ + + Glucose + + + Mannitol + + + Inositol + ­ ­ Sorbitol + ­ ­ Rhamnose ­ ­ ­ Sucrose + ­ ­ Melibiose + ­ ­ Amygdalin + + ­ Arabinose + + + Identification Enterobacter   Vibrio fluvialis Vibrio cholerae/ cloacae V. mimicus/ V. parahaemolyticus/ V. vulnificus (+): có phản ứng; (­): không phản ứng. Các   kết   quả   trình   bày   trên   cho   thấy,   được  12 chủng vi khuẩn có trong đường   dịch chiết cỏ mực có khả năng ức chế sự phát   ruột   tôm   trên   môi   trường   TCBS.   Dịch   chiết   triển của V. parahaemolycus và V. brasiliensis   cây cỏ  mực có khả  năng  ức chế  sự  phát triển  và   không   có   khả   năng   ức   chế   đối   với   của 10/12 chủng vi khuẩn đã phân lập. E.   cloacae.  Khả   năng   ức   chế   vi   khuẩn   của   Kết   hợp   kết   quả   của   3   phương   pháp:  dịch chiết cỏ mực tạo tiền đề  cho các nghiên  kiểm   tra   đặc   điểm   sinh  hóa   với   bộ   kít   API  cứu   điều   trị   bệnh   học   thủy   sản,   đồng   thời  20E, Maldi toff mass và giải trình tự  gen 16S  cung cấp cơ  sở  khoa học cho việc  ứng dụng   rDNA cho thấy 3 chủng vi khuẩn Y1, G2 và  chiết xuất từ loài cây này trong bào chế dược  G5   lần   lượt   có   thể   là   các   chủng   vi   khuẩn:   phẩm, điều trị  các trường hợp ngộ  độc thực   Enterobacter   cloacae,   Vibrio   brasiliensis  và  phẩm   do   ăn   phải   hải   sản   nhiễm   khuẩn  V.   Vibrio parahaemolyticus. parahaemolycus  và  V. brasiliensis. Lời cám  ơn:  Đề  tài được hoàn thành với sự  hỗ  trợ  của Bộ  môn Sinh học và Bộ  môn Hóa  KẾT LUẬN Học,   Khoa   Khoa   học   tự   nhiên,   Trường   Đại  Từ 30 mẫu tôm sú thu được đã phân lập học   Cần   Thơ.   Cảm   ơn   GS   Kaeko   Kamei   (Viện Kỹ  thuật Công nghệ Kyoto, Nhật Bản)  đã hỗ  trợ  thiết bị  và hóa chất giúp chúng tôi  hoàn thành các thí nghiệm định danh vi khuẩn. TÀI LIỆU THAM KHẢO 1. Barrow   G.   I.,   Feltham   R.   K.   A.,   1993.  Covan   and   Steel's   manual   for   the  identification of medical bacteria, 3nd edn.  Cambridge University Press, Cambridge. 2. Chatterjee   S.,   Haldar   S.,   2012.  Vibrio  related   diseases   in   aquaculture   and  development   of   rapid   and   accurate  9
  6. identification methods. J. Marine Sci. Res.  environments.   Diseases   of   Aquatic  Dev. S1. Organisms, 66: 179­204. 3. Demucan   D.,   Candan   A.,   2006.  8. Đỗ  Thị  Thúy Nga, 2011. Qui trình thao tác  Identification of Vibrio anguillarum by PCR  chuẩn   về   thử   nghiệm   tính   nhạy   cảm  (rpoN   Gene)   associated   with   Vibriosis   in  kháng sinh ­ Tiêu chuẩn đọc kết quả kháng  Marine Fish in Turkey. Turkish Journal of  sinh đồ và MIC. GARP­Việt Nam. Veterinary   and  Animal   Sciences.   30:   305­ 9. Đặng   Thị   Hoàng   Oanh,   Đoàn   Nhật  310. Phương,   Nguyễn   Minh   Hậu,   Nguyễn  4. Huỳnh Kim Diệu, Lê Thị  Loan Em, 2011.  Thanh Phương, 2004. Thiết lập bộ sưu tập  ́ ̣ ́ ̉ Đanh gia đăc tinh thuân chung va hoat tinh ́ ̀ ̀ ̣ ́   vi   khuẩn   kháng   thuốc   kháng   sinh  khanǵ   khuân̉   cuả   cây   cỏ   mực   (Eclipta  Chloramphenicol  tại khoa Thủy  sản,   Đại  prostrate)   và  cây   diêp̣   hạ   châu   thân   xanh  học   Cần Thơ.   Tạp  chí   Nghiên cứu  khoa  (Phyllanthus   niruru)   ở   Đông ̀   băng ̀   Sông  học 2: 76­81. Cửu Long. Tap chi khoa hoc Tr ̣ ́ ̣ ương  ̀ Đaị   10. Nguyễn   Kim   Phi   Phụng,   2007.   Phương   ̣ hoc Cân Th ̀ ơ. 19a: 149­155. pháp  cô   lập  hợp  chất   hữu   cơ.   Nhà   xuất  5. Huỳnh Kim Diệu, 2011. Đánh gia đăc tinh ́ ̣ ́   bản Đại học Quốc Gia thành phố  Hồ  Chí  ̉ ̀ ̣ ́ thuân chung va hoat tinh khang khuân cua lá ̀ ́ ̉ ̉   Minh. tràm   (Melaleuca   leucadendra).   Tap̣   chí  11. Jackson,   Lay   O.,   2001.   Maldi   Tof   Mass  ̣ khoa  hoc Tr ương ̀   Đaị  hoc Cân Th ̣ ̀ ơ.  19a:  spectrometry   of   bacteria.   Division   of  143­148. chemistry,   national   centerfor   toxicological  6. Trịnh Hoàng Hiếu, Nguyễn Thị Thảo Trân,  research, foodand drug administration, 3900  Lê Ngọc Thạch, 2009. Khao sat tinh dâu vo ̉ ́ ̀ ̉  NCTR road, Jefferson, Arkansas. trai va la tăc, ́ ̀ ́ ́  Fortunella japonica, Thumb.  12. Nguyễn   Thế   Vương,   2009.   Xác   định   tác  Tap̣   chí  Phat́   triên ̉   Khoa   học   và   Công  nhân gây bệnh và nghiên cứu thử  nghiệm  nghệp, 12: 42­48.  một   số   loại   thảo   dược   trong   phòng   trị  7. Huys   G.,   Cnockaert   M.,   Bartie   K.,   Oanh  bệnh   vi   khuẩn   trên   tôm   thẻ   chân   trắng  D.T.H., Phuong N. T., Somsiri T., Chinabut  (Penaeus   vannamei).   Trường   Đại   học  S.,   Yusoff   F.,   Shariff   M.,   Giacomini   M.,  Nông lâm Huế. Bertone S., Swings J., Teale A., 2005. Intra­  and   interlaboratory   performance   of  13. Weisburg W. G., Barns S. M., Pelletier D.  antibiotic   disk   diffusion   susceptibility  A., Lane D. J., 1991. 16S ribosomal DNA  testing   of   bacterial   control   strains   of  amplification   for   phylogenetic   study.   J.  relevance   for   monitoring   aquaculture  Bacteriol., 173: 697­703. 10
  7. ANTIBACTERIAL ACTIVITY OF THE METHANOLIC EXTRACTS  OF Eclipta alba AGAINST BACTERIA IN INTESTINAL TRACT  OF BLACK TIGER SHRIMP (Penaeus monodon) Dai Thi Xuan Trang, Vo Thi Tu Anh Can Tho University SUMMARY Antibacterial activity of the methanolic extracts of  Eclipta alba  were carried out by the disc diffusion  method on 12 strains of bacteria isolated from 30 samples of tiger shrimp (intestines) collected from shrimp  farms in Tan Thanh hamlet, An Loi commune, Tran Van Thoi district, Ca Mau province. All strains isolated  were grown for 24h on TCBS agar plates at 30°C  in yellow colony or green colony. Antibacterial activity  assay of the extract was carried out in the concentration of 8 µg/mL, 16 µg/mL, 32 µg/mL, 64 µg/mL and 128  µg/mL.   The   extract   of  Eclipta   alba  were   tested   against   10   bacterial   strains   were   isolated.   The   highest  antibacterial potentiality was exhibited by the methanolic extract of E. alba with G5 strain, means of zones of  bacterial growth inhibition are 30,3mm. Three of twelve isolates (Y1, G2, G5) were chosen to examine the  biochemical   characteristics   with   the   API   20E   Kit   and   identified   by   two   method:   Maldi   toff   mass   and   sequencing   16S   rDNA  using   primers   pair   27F   (5 ­AGAGTTTGATCCTGGCTCAG­3 )   and   1492R   (5'­ GGTTACCTTGTTACGACTT­3').   The   results   showed   that   Y1   isolate   was   similarity   of   97%   with  E.  Cloacae; G2 isolate was similarity of 98% with V. brasiliensis and G5 isolate was similartty of 99% with V.  Parahaemolyticus. Keywords: Eclipta alba, Penaeus monodon, antibacterial activity, methanolic extracts. Ngày nhận bài: 22­10­2014 11

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản