intTypePromotion=1
ADSENSE

Khảo sát sự biến đổi gen NAT2 và GSTP1 mã hóa enzym chuyển hóa xenobiotic nam giới vô sinh

Chia sẻ: Ni Ni | Ngày: | Loại File: PDF | Số trang:7

36
lượt xem
0
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Mục tiêu nghiên cứu của bài viết là mô tả tỷ lệ xuất hiện một số đột biến gen NAT2 và GSTP1 ở nam giới vô sinh nguyên phát. Bước đầu xác định mối liên quan giữa một số đột biến gen NAT2 và GSTP1 với vô sinh nam.

Chủ đề:
Lưu

Nội dung Text: Khảo sát sự biến đổi gen NAT2 và GSTP1 mã hóa enzym chuyển hóa xenobiotic nam giới vô sinh

TẠP CHÍ Y - DƢỢC HỌC QUÂN SỰ SỐ CHUYÊN ĐỀ-2017<br /> <br /> KHẢO SÁT SỰ BIẾN ĐỔI GEN NAT2 VÀ GSTP1 MÃ HÓA<br /> ENZYM CHUYỂN HÓA XENOBIOTIC NAM GIỚI VÔ SINH<br /> Vũ Thị Huyền*; Nguyễn Thị Trang*; Uông Ngọc Nguyên*; Trần Đức Ph n*<br /> TÓM TẮT<br /> Mục tiêu: khảo sát đột biến GSTP1 (313G>A (I105V), NAT2 (481C>T (L161L) liên quan gây<br /> vô sinh (VS) nam. Đối tượng và phương pháp:ADN của 200 đối tượng nghiên cứu (100 nam<br /> giới VS và 100 người bình thường) được nhân lên và xác định đột biến gen bằng kỹ thuật<br /> ARMS - PCR. Kết quả: các kiểu gen CT và TT của gen NAT2 (481C>T), (OR 3,12; 95%CI:<br /> 1,72 - 5,68, p < 0,001) và GA + AAcủa gen GSTP1(G313A) (OR 5,25; 95%CI: 2,71 - 10,19, p <<br /> 0,001) có nguy cơ cao gây VS nam. Kết luận: nghiên cứu thí điểm này cho thấy các đa hình<br /> GSTP1 (G313A) vàNAT2 (481C>T) là dấu hiệu di truyền mới liên quan với stress oxy hóa và<br /> tình trạng VS nguyên phát.<br /> * Từ khóa: GSTP1; NAT2; Xenobiotic; Vô sinh nam; Đột biến.<br /> <br /> Identification of Genetics Polymorphism of Xenobiotic Metabolic<br /> Enzymes NAT2 and GSTP1 in Infertile men by ARMS-PCR Method<br /> Summary<br /> Objectives: To investigate whether two common single-nucleotide polymorphisms (SNP) of<br /> the NAT2 gene (481C>T (L161L) and GSTP1 (313G>A (I105V)) were associated with<br /> susceptibility to male infertility. Subjects and methods: A total 200 DNA samples (100 infertile<br /> patients and 100 fertile men) were genotyped for the polymorphisms by ARMS - PCR. Results:<br /> There was a significant association between the NAT2 variant genotypes (CT + TT (481C>T),<br /> (OR 3.12; 95%CI: 1.72 - 5.68, p< 0.001) and or NAT2 variant genotypes GSTP1 (G313A), (OR<br /> 2.95; 95%CI: 1.51 - 5.79, p < 0.001) with idiopathic infertility risk. Conclusions: This pilot study<br /> found that the polymorphisms GSTP1 (481C>T) and NAT2 (590G>A) were some novel genetic<br /> markers for susceptibility to idiopathic male infertility, but the risk is potentiated by exposure to<br /> various environmental oxidants.<br /> * Keyworks: GSTP1; NAT2; Xenobiotic; Infertile men; Mutation.<br /> <br /> ĐẶT VẤN ĐỀ<br /> Vô sinh nói chung và VS nam giới<br /> nói riêng là một vấn đề sức khỏe sinh<br /> sản, gây ảnh hưởng lớn tới chất lượng<br /> cuộc sống của nhiều cặp vợ chồng trên<br /> <br /> toàn thế giới. Một trong những nguyên<br /> nhân gây VS mà hiện nay đang được<br /> đề cập nhiều đó là sự mất cân bằng<br /> trong chuyển hóa các chất của cơ thể,<br /> trong đó có chuyển hóa xenobiotic.<br /> <br /> * Đại học Y Hà Nội<br /> Người phản hồi (Corresponding): Vũ Thị Huyền (drhuyenvu@gmail.com)<br /> Ngày nhận bài: 27/07/2017; Ngày phản biện đánh giá bài báo: 29/08/2017<br /> Ngày bài báo được đăng: 05/09/2017<br /> <br /> 292<br /> <br /> TẠP CHÍ Y - DƢỢC HỌC QUÂN SỰ SỐ CHUYÊN ĐỀ HÌNH THÁI HỌC-2017<br /> Xenobiotic là chất hóa học lạ đối với<br /> cơ thể, bao gồm các chất được đưa vào<br /> cơ thể hàng ngày như thuốc, rượu, thuốc<br /> lá, mỹ phẩm, chất bảo quản, thuốc bảo vệ<br /> thực vật...Khi quá trình chuyển hóa<br /> xenobiotic ở trạng thái cân bằng sẽ giúp<br /> cơ thể đào thải, khử độc và tránh được<br /> tác động không tốt của xenobiotic đối với<br /> cơ thể [1 . Khi quá trình chuyển hóa<br /> xenobiotic bị rối loạn, xuất hiện tình trạng<br /> tích tụ các xenobiotic và sản phẩm<br /> chuyển hóa của chúng trong cơ thể, bao<br /> gồm các gốc tự do không có lợi. Đó là<br /> nguyên nhân gây ra nhiều bệnh, trong đó<br /> có VS [2].<br /> Trong quá trình chuyển hóa xenobiotic,<br /> NAT2 và GSTP1 là các gen có vai trò<br /> quan trọng trong việc mã hóa enzym liên<br /> quan đến biến đổi xenobitic ở giai đoạn II,<br /> biến đổi thành chất dễ thải trừ ra môi<br /> trường. Gen GSTP1 nằm trên NST<br /> 11q13.3 và có một số alen phổ biến như<br /> GSTP1*A, GSTP1*B, GSTP1*C, GSTP1*D.<br /> Thay thế G thành A tại vị trí 313 của exon<br /> 5 dẫn đến làm thay thế axít amin isoleucin<br /> thành valin tại vị trí 105. Đột biến điểm<br /> trên exon 5 này ảnh hưởng mạnh mẽ đến<br /> hiệu quả của enzym GSTP1[3 . Gen<br /> Arylamine N-acetyltransferase 2 (NAT2)<br /> nằm trên NST số 8 (8p22), là gen mã hóa<br /> enzym NAT2 của giai đoạn II chuyển hóa<br /> xenobiotics có vai trò giải độc một số hóa<br /> chất như arylamine, hydrazines, các amin<br /> thơm và dạng dị vòng để tạo thành các<br /> chất trung gian thông qua phản ứng của<br /> N-acetyl hóa và O-acetyl hóa. Khi bị đột<br /> biến sẽ dẫn đến rối loạn chức năng<br /> enzym giải độc, dẫn đến ung thư hoặc VS<br /> ở nam giới [4 .<br /> <br /> Vì vậy, việc nghiên cứu ảnh hưởng<br /> của đột biến gen NAT2 và gen GSTP1 đối<br /> với VS ở nam giới được tiến hành ở<br /> nhiều quốc gia. Tuy nhiên, tại Việt Nam<br /> chưa có nghiên cứu nào đánh giá sự ảnh<br /> hưởng của những gen này. Mục tiêu<br /> nghiên cứu:Mô tả tỷ lệ xuất hiện một số<br /> đột biến gen NAT2 và GSTP1 ở nam giới<br /> VS nguyên phát. Bước đầu xác định mối<br /> liên quan giữa một số đột biến gen NAT2<br /> và GSTP1 với VS nam.<br /> ĐỐI TƢỢNG VÀ PHƢƠNG PHÁP<br /> NGHIÊN CỨU<br /> 1. Đối tƣợng nghiên cứu.<br /> Bệnh nhân nam VS không rõ nguyên<br /> nhân trong độ tuổi sinh sản (20 - 50) đã<br /> làm xét nghiệm tinh dịch đồ tại Trung tâm<br /> Tư vấn - Di truyền, Đại học Y Hà Nội từ<br /> 2015-2017.<br /> * Tiêu chuẩn lựa chọn:<br /> - Nhóm bệnh: 100 nam giới VS không<br /> có tinh trùng hoặc ít tinh trùng (< 15 triệu,<br /> WHO 2010).<br /> - Nhóm chứng: 100 nam giới khỏe<br /> mạnh, có ít nhất 1 con.<br /> * Tiêu chuẩn loại trừ: nam giới VS đã<br /> được chẩn đoán xác định nguyên nhân:<br /> viêm cơ quan sinh dục, giãn tĩnh mạch<br /> tinh, tắc nghẽn đường sinh dục, mất đoạn<br /> nhỏ trên nhiễm sắc thể Y, nhiễm sắc đồ<br /> bất thường, nội tiết tố bất thường, bị các<br /> bệnh ung thư, cấp tính, tâm thần…<br /> 2. Phƣơng pháp nghiên cứu.<br /> Tách chiết mẫu ADN từ máu ngoại vi<br /> (chống đông EDTA) bằng kit tách ADN<br /> Express (Lytech, Nga). Sử dụng kỹ thuật<br /> ARMS-PCR để xác định đa hình gen<br /> GSTP1 (313G>A (I105V), NAT2 (481C>T<br /> (L161L) với trình tự mồi:<br /> 293<br /> <br /> TẠP CHÍ Y - DƢỢC HỌC QUÂN SỰ SỐ CHUYÊN ĐỀ-2017<br /> Bảng 1: Trình tự mồi để khuếch đại 2 gen.<br /> Gen<br /> GSTP1<br /> <br /> Tr nh tự mồi<br /> <br /> Polymorphism<br /> <br /> F: 5'- TGGGAGGGATGAGAGTAGGA -3'<br /> <br /> (313G>A (I105V)<br /> <br /> NAT2<br /> <br /> (exon 5)<br /> <br /> R: 5'- CAGGGTCTCAAAAGGCTTCAGT-3'<br /> <br /> 481 С/Т<br /> <br /> F: 5'-GCTGGGTCTGGAAGCTCCTC-3'<br /> <br /> L161L<br /> <br /> R: 5'-TTGGGTGATACATACACAAG-3'<br /> <br /> (exon 2)<br /> <br /> Kỹ thuật ARMS - PCR thực hiện với<br /> thể tích 50 μl phản ứng có chứa 5µl (50100 ng) ADN di truyền, trong mỗi ống<br /> (allen bình thườnghoặc allen đột biến)<br /> 17,5 µl đệm PCR, 2,5 µl primer mix (mồi<br /> bình thường hoặc mồi đột biến), 0,2 Taq<br /> ADN polymerase và 25 µl dầu khoáng<br /> (Lytech, Nga) với chu trình luân nhiệt:<br /> 930C/1 phút; 35 chu kì (93oC/10s,<br /> 64oC/10s, 72oC/20s), 72oC/10 phút. Sản<br /> phẩm PCR sau đó được điện di trên<br /> <br /> thạch agarose 3% để xác định kiểu gen<br /> của đối tượng nghiên cứu.<br /> * Xử lý số liệu:số liệu được thu thập và<br /> xử lý trên phần mềm SPSS 16.0.<br /> * Đạo đức nghiên cứu: BN hoàn toàn<br /> tự nguyện tham gia vào nghiên cứu và có<br /> quyền rút khỏi nghiên cứu khi không đồng<br /> ý tiếp tục tham gia vào nghiên cứu. Bệnh<br /> nhân sẽ được thông báo về kết quả xét<br /> nghiệm gen. Các thông tin cá nhân được<br /> đảm bảo bí mật.<br /> <br /> KÊT QUẢ NGHIÊN CỨU<br /> 1. Ph n bố tuổi của nhóm nghiên cứu.<br /> Bảng 2: Phân bố nhóm tuổi của nhóm bệnh và nhóm chứng.<br /> Nhóm chứng<br /> <br /> Tuổi<br /> <br /> Nhóm bệnh<br /> <br /> p<br /> <br /> %<br /> <br /> n<br /> <br /> %<br /> <br /> 20 - 29<br /> <br /> 40<br /> <br /> 40,0<br /> <br /> 27<br /> <br /> 27,0<br /> <br /> 30 - 39<br /> <br /> 42<br /> <br /> 42,0<br /> <br /> 53<br /> <br /> 53,0<br /> <br /> 40 - 49<br /> <br /> 15<br /> <br /> 15,0<br /> <br /> 20<br /> <br /> 20,0<br /> <br /> 50 - 59<br /> <br /> 3<br /> <br /> 3,0<br /> <br /> 0<br /> <br /> 0<br /> <br /> X ± SD<br /> <br /> 31,88 ± 6,33<br /> <br /> 33,95 ± 7,19<br /> <br /> p > 0,05<br /> <br /> > 0,05<br /> <br /> Ở cả hai nhóm bệnh và nhóm chứng, nam giới trong độ tuổi 30 - 39 chiếm tỷ lệ cao<br /> nhất. Độ tuổi chiếm tỷ lệ thấp nhất 50 - 59 tuổi. Tỷ lệ phân bố nhóm tuổi ở cả 2 nhóm<br /> bệnh và chứng không có sự khác biệt.<br /> 294<br /> <br /> TẠP CHÍ Y - DƢỢC HỌC QUÂN SỰ SỐ CHUYÊN ĐỀ HÌNH THÁI HỌC-2017<br /> 2. Đặc điểm nội tiết tố ở nhóm nam giới VS.<br /> Bảng 3: Đặc điểm nội tiết của nhóm bệnh và nhóm chứng.<br /> Nhóm<br /> <br /> X ± SD (IU/L)<br /> <br /> n<br /> <br /> FSH<br /> <br /> LH<br /> <br /> Testosteron<br /> <br /> Nhóm bệnh<br /> <br /> 100<br /> <br /> 17,34 ± 3,27<br /> <br /> 16,33 ± 2,53<br /> <br /> 13,02 ± 1,62<br /> <br /> Nhóm chứng<br /> <br /> 100<br /> <br /> 11,62 ± 12,60<br /> <br /> 6,56 ± 4,19<br /> <br /> 15,86 ± 5,50<br /> <br /> 5 - 20<br /> <br /> 5 - 20<br /> <br /> 10 - 35<br /> <br /> Giới hạn bình thường<br /> <br /> Giá trị trung bình FSH, LH và testosterone của BN nhóm bệnh và nhóm chứng trong<br /> giới hạn bình thường.<br /> 3. Kết quả ph n tích đ t biến gen NAT2 C481T ở nhóm bệnh và nhóm chứng.<br /> Bảng 4: Kết quả phân tích gen đột biến gen NAT2 C481T.<br /> NAT2<br /> 481C>T<br /> <br /> Nhóm bệnh<br /> (n = 100)<br /> <br /> Nhóm chứng<br /> (n = 100)<br /> <br /> CC<br /> <br /> 49 (49%)<br /> <br /> 75 (75%)<br /> <br /> Chi-squared<br /> 14,35 p < 0,001<br /> <br /> OR<br /> <br /> 95%CI<br /> <br /> 0,32<br /> <br /> 0,18 - 0,58<br /> <br /> 3,12<br /> <br /> 1,72 - 5,68<br /> 0,02 - 50,89<br /> <br /> CT<br /> <br /> 51 (51%)<br /> <br /> 25 (25%)<br /> <br /> TT<br /> <br /> 0 (0%)<br /> <br /> 0 (0%)<br /> <br /> 1,0<br /> <br /> CT+TT<br /> <br /> 51 (51%)<br /> <br /> 25 (25%)<br /> <br /> 3,12<br /> <br /> 1.72<br /> <br /> - 5.68<br /> <br /> Tỷ lệ mang người mang kiểu gen CT ở nhóm bệnh là 51%, nhóm chứng là 25%.<br /> Không gặp trường hợp nào mang gen TT ở cả hai nhóm. Trường hợp CT+TT gặp ở<br /> nhóm bệnh và nhóm chứng lần lượt là 51% và 25% và có nguy cơ cao gây VS nam<br /> (OR = 3,12; CI = 1,72 - 5,68).<br /> 4. Kết quả ph n tích đ t biến gen GSTP1G313A ở nhóm bệnh và nhóm chứng.<br /> Bảng 5: Kết quả phân tích gen đột biến gen GSTP1 G313A.<br /> GSTP1<br /> G313A<br /> <br /> Nhóm bệnh<br /> (n = 100)<br /> <br /> Nhóm chứng<br /> (n = 100)<br /> <br /> GG<br /> <br /> 50 (50%)<br /> <br /> 84 (84%)<br /> <br /> GA<br /> <br /> 36 (36%)<br /> <br /> 16(16%)<br /> <br /> AA<br /> <br /> 14 (14%)<br /> <br /> 0 (0%)<br /> <br /> GA+AA<br /> <br /> 50 (50%)<br /> <br /> 16 (16%)<br /> <br /> Chi-squared<br /> <br /> 30,32<br /> p < 0,001<br /> 26,14<br /> p < 0,001<br /> <br /> OR<br /> <br /> 95%CI<br /> <br /> 0,19<br /> <br /> 0,10 -0,7<br /> <br /> 2,95<br /> <br /> 1,1 - 5,79<br /> <br /> 33,69<br /> <br /> 1,8 -573,6<br /> <br /> 5,25<br /> <br /> 2,1 -10,9<br /> <br /> Tỷ lệ người mang kiểu gen GA ở nhóm bệnh là 36%, nhóm chứng 16%. 14% ở<br /> nhóm bệnh mang kiểu gen AA, không gặp trường hợp nào mang kiểu gen AA ở nhóm<br /> chứng. Kiểu gen GA+AA gặp ở nhóm bệnh và nhóm chứng lần lượt là 50% và 16% có<br /> nguy cơ cao gây VS nam với (OR = 5,25; CI = 2,71 - 10,19; p < 0,001).<br /> 295<br /> <br /> TẠP CHÍ Y - DƢỢC HỌC QUÂN SỰ SỐ CHUYÊN ĐỀ-2017<br /> BÀN LUẬN<br /> Nghiên cứu cho thấy: ở nhóm chứng<br /> nam giới VS, tuổi thấp nhất 22, tuổi cao<br /> nhất 50, độ tuổi trung bình 31,88 ± 6,33.<br /> Trong đó, nhóm tuổi 30 - 39 chiếm tỷ lệ<br /> cao nhất (42%). Ở nhóm bệnh, người có<br /> độ tuổi thấp nhất 22, cao nhất 49, độ tuổi<br /> trung bình 33,95 ± 7,19. Độ tuổi trung<br /> bình của 2 nhóm không khác biệt về ý<br /> nghĩa thống kê (p > 0,05). Như vậy, độ<br /> tuổi trung bình ở nhóm nghiên cứu của<br /> chúng tôi cao hơn một chút so với nghiên<br /> cứu của tác giả Yufeng Quin (2013) tại<br /> Trung Quốc (28,41 ± 4,61)[5] và thấp hơn<br /> so với các nghiên cứu ở các nước ở<br /> phương Tây (Sonia Brahem (2011):<br /> 37,65) [6]. Điều này có thể do độ tuổi kết<br /> hôn ở Việt Nam thấp hơn so với các<br /> nước phương Tây, việc quan tâm đến<br /> sức khỏe người dân đãtốt hơn trước. Vì<br /> vậy, họ đi khám sớm hơn. Ở phương<br /> Tây, nam giới lập gia đình muộn hơn so<br /> với Việt Nam, do đó nam giới đi khám và<br /> điều trị VS cũng muộn hơn.<br /> Trong 100 BN trong nhóm bệnh và<br /> nhóm chứng được làm xét nghiệm nội tiết<br /> tố. Kết quả cho thấy: nồng độ FSH huyết<br /> thanh (17,34 ± 3,27 IU/L) và (11,62 ±<br /> 12,60 IU/L), LH huyết thanh (16,33 ± 2,53<br /> IU/L) và (6,56 ± 4,19 IU/L),testosterone<br /> huyếtthanh (17,02 ± 5,23 IU/L) và (15,86<br /> ± 5,50 IU/L) trong giới hạn bình thường.<br /> Nghiên cứu của chúng tôi tương đối phù<br /> hợp với các tác giả Ngô Xuân Bái (2010)<br /> [7 , Shalender Bhashin (2007) [8 . Điều<br /> này có thể nghĩ tới giả thiết những trường<br /> hợp vô tinh, không có tinh trùng ở nam<br /> giới VS có thể là hậu quả của rối loạn về<br /> 296<br /> <br /> di truyền, trong đó có bất thường về gen.<br /> Do đó, ảnh hưởng tới chức năng sản<br /> xuất tinh trùng ở ống sinh tinh, trong khi<br /> đó hoạt động sản xuất hormon FSH và<br /> LH ở tuyến yên, testosteron ở tế bào<br /> Leyding vẫn bình thường. Giả thiết này<br /> phù hợp với mục đích nghiên cứu của<br /> chúng tôi. Mặt khác, đối tượng nghiên<br /> cứu trong nhóm bệnh của chúng tôi là<br /> những nam giới VS nguyên phát, đã<br /> được loại trừ nguyên nhân: viêm cơ quan<br /> sinh dục, giãn tĩnh mạch tinh, tắc nghẽn<br /> đường sinh dục, mất đoạn nhỏ trên NST<br /> Y, nhiễm sắc đồ bất thường, nội tiết tố bất<br /> thường... Như vậy, kết quả trên thể hiện<br /> các BN trong nhóm bệnh phù hợp với tiêu<br /> chuẩn lựa chọn đối tượng nghiên cứu của<br /> chúng tôi.<br /> Đánh giá đột biến gen NAT2 (C481T)<br /> ở nhóm bệnh với kiểu gen dị hợp tử CT<br /> (51%) cao hơn ở nhóm chứng (25%) cho<br /> thấy nguy cơ VS tăng đáng kể ở những<br /> người mang kiểu gen này OR = 3,12; CI =<br /> 1,72 - 5,68, sự khác biệt có ý nghĩa thống<br /> kê với p < 0,001. Không gặp trường hợp<br /> nào mang kiểu gen đồng hợp tử (TT) ở<br /> cả hai nhóm. Nghiên cứu của Yarosh và<br /> CS (2014) [9] trên 203 BN VS nam và 227<br /> nam giới bình thường cho kết quả: Ở<br /> nhóm bệnh có 46,8% trường hợp dị hợp<br /> tử, 34,5% bình thường, 18,7% đồng hợp<br /> tử đột biến. Ở nhóm chứng: 51,5%<br /> trường hợp dị hợp tử, 34,8% bình thường<br /> và 14,1% đồng hợp tử đột biến. Kết quả<br /> phân tích cho thấy tỷ lệ phân bố genotype<br /> và alen giữa hai nhóm bệnh và nhóm<br /> chứng không khác biệt mang ý nghĩa<br /> thống kê (p > 0,05). Tuy nhiên, theo<br /> <br />
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD


intNumView=36

 

Đồng bộ tài khoản
2=>2