intTypePromotion=3

Khảo sát sự biểu hiện của gen mã hóa GmHK07 trong đáp ứng hormone aba và stress hạn ở hai giống đậu tương chịu hạn khác biệt-DT51 và MTD720

Chia sẻ: Ni Ni | Ngày: | Loại File: DOC | Số trang:6

0
20
lượt xem
0
download

Khảo sát sự biểu hiện của gen mã hóa GmHK07 trong đáp ứng hormone aba và stress hạn ở hai giống đậu tương chịu hạn khác biệt-DT51 và MTD720

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Trong nghiên cứu này, sự điều hòa biểu hiện của gen GmHK07 được xem xét ở hai giống đậu tương chịu hạn tốt DT51 và giống chịu hạn kém MTD720 dưới điều kiện xử lý ABA và điều kiện hạn. Kết quả qRT-PCR của các mẫu thu từ cây đậu tương 12 ngày tuổi được xử lý trong dung dịch ABA nồng độ 100 µM cho thấy GmHK07 có sự giảm biểu hiện đáng kể cả ở mô chồi và rễ của giống MTD720 được xử lý ABA.

Chủ đề:
Lưu

Nội dung Text: Khảo sát sự biểu hiện của gen mã hóa GmHK07 trong đáp ứng hormone aba và stress hạn ở hai giống đậu tương chịu hạn khác biệt-DT51 và MTD720

  1. TAP CHI SINH HOC 2015, 37(1se): 123­128 Khảo sát sự biểu hi DOI:     10.15625/0866­7160/v37n1se. ện của gen mã hóa GmHK07 KHẢO SÁT SỰ BIỂU HIỆN CỦA GEN MàHÓA GmHK07  TRONG ĐÁP ỨNG HORMONE ABA VÀ STRESS HẠN  Ở HAI GIỐNG ĐẬU TƯƠNG CHỊU HẠN KHÁC BIỆT­DT51 VÀ MTD720  Nguyễn Bình Anh Thư, Đoàn Ngọc Hiếu, Nguyễn Phương Thảo* Trường Đại học Quốc tế, ĐHQG HCM, *npthao@hcmiu.edu.vn TÓM TẮT: Abscisic acid (ABA) la m ̀ ột phytohormone quan trọng tham gia đáp ứng chống chịu   stress phi sinh học  ở thực vật. Nghiên cưu s ́ ự biêu hiên đap  ̉ ̣ ́ ứng gen vơi ABA có th ́ ể  giúp xác   định các gen tiêm năng có  ̀ ứng dụng quan trọng trong công nghệ  gen nhằm cải tạo tính chống   chịu vơi stress phi sinh hoc  ́ ̣ ở cây trồng. Trong nghiên cứu này, sự  điều hòa biểu hiện của gen   GmHK07  được xem xét   ở  hai giống đậu tương chịu hạn tốt DT51 và giống chịu hạn kém   MTD720 dưới điều kiện xử  lý ABA và điều kiện hạn. Kết quả  qRT­PCR của các mẫu thu từ  cây   đậu  tương  12  ngày  tuổi   được  xử  lý  trong  dung  dịch  ABA  nồng   độ   100  µM  cho  thấy  GmHK07  có sự  giảm biểu hiện đáng kể  cả   ở  mô chôi và r ̀ ễ  của giống MTD720 được xử  lý   ABA. Hơn nữa, GmHK07 còn có sự  tích lũy cao đáng kể, 158 và 85 lần, trong chôi c ̀ ủa giống   chịu hạn kém MTD720  ở  điều kiện thường và xử  lý ABA 10 giờ  so với giống chịu hạn tốt   DT51. Kết quả tương tự được quan sát ở rễ, GmHK07 tích lũy đáng kể tới 195 và 67 lần tương  ứng  ở  giống MTD720 được xử  lý ABA 0 và 10 giờ  so với giống DT51. Dưới điều kiện hạn,   GmHK07  cũng cho thấy sự  tích lũy cao đáng kể  trong cả  hai mô của MTD720 so với các mô  tương  ứng của DT51. Như vậy,  ở đậu tương, GmHK07 là nhân tố điều hòa âm tính tiềm năng   không chỉ  trong đáp  ứng hạn mà còn trong đáp  ứng với hormone ABA và có thể   ứng dụng để  tăng tính chống chịu stress phi sinh học ở cây trồng nhờ công nghệ gen. Từ khóa: Abscisic acid, đậu tương, GmHK07, qRT­PCR, stress phi sinh học, stress hạn. MỞ ĐẦU Để  chống chịu hạn, một trong những đáp  ứng sinh lý của thực vật là sự  đóng mở  khí   Hạn hán là một trong số  những stress phi   khổng. Hoạt động này của tế  bào khi không ́ ̉   ̣ chính   tác  động  đến  cây   trồng,   hơn   sinh   hoc  giúp   điều   hòa   sư   trao   đổi   khí   và   mất   nước  nữa, sự biến đổi khí hậu và sự suy giảm chất  giữa thực vật và môi trường thông qua mạng  lượng   nước   ngọt   đang   làm   gia   tăng   mối   lo  lưới dẫn truyền tín hiệu. Cơ  chế  này không  ngại đáng kể  cho sản xuất nông nghiệp toàn  chỉ  được biết đến như  đáp  ứng của thực vật   cầu []. Đậu tương (Glycine max) được biết là  với   hạn   thông   qua   sự     gia   tăng   tich ́   luỹ   một   trong   những   cây   trồng   có   giá   trị   dinh   hormone ABA mà còn đáp  ứng với các stress  dưỡng cao và sản xuất đậu tương mang lại lợi  ̣ phi sinh hoc khác nh ư ánh sáng, mặn cũng như  ích kinh tế  đáng kể   ở  nhiều quốc gia trên thế  các   stress   sinh   học  ].   Trong   mạng   lưới   dẫn  giới   do nhu  cầu  tiêu dùng  các  sản phẩm   từ  truyền tín hiệu stress, mặc dù sự  phosphoryl   đậu tương đang ngày một gia tăng. Tuy nhiên,   hóa được điều khiển bởi hệ  thống hai thành  đậu tương cũng là một trong những cây trồng   phần (TCS) là cơ chế chính trong sự đóng khí  bị  tác động đáng kể  bởi hạn han, thiêt hai lên ́ ̣ ̣   không̉   cảm   ứng   bởi   ABA.   Tuy   nhiên,   vẫn  đến 40% năng suất []. Do đó, nghiên cứu và  không có nhiều bằng chứng về chức năng của  phát triển các giống đậu tương chịu hạn thông  hệ  thống này trong các  tế  bào khi không [ ́ ̉ ].  qua   kỹ   thuật   di   truyền   là   một   trong   những   Các thành phần thuộc hệ  thống này đã được   chiến  lược quan trọng  trong  phát  triển  nông  xác   định   ở   một   số   loài   thực   vật   như  nghiệp và bảo đảm an ninh lương thực. Arabidopsis, lúa và đậu tương bao gồm protein  tiếp   nhận   tín   hiệu   (HK­histidine   kinase),  123
  2. Nguyen Binh Anh Thu et al. protein   chuyển   đổi   gốc   phospho   (HP­ con được xử lý hạn bằng cách ngưng t ̀ ưới  phosphotransfer  protein)   và  nhân  tố   điều  hòa  nước trong thời gian 15 ngày như  nghiên cứu  đáp ứng (RR­response regulator) []. Các nghiên  trước đây ­,]. cứu trước đây của chúng tôi đã xác định vai trò  điều hòa tiềm năng của một số thành viên họ  Tách chiết RNA và tổng hợp cDNA  TCS   dưới   điều   kiện   stress   hạn  trong  những  Các mẫu rễ và chôi  ̀ của hai giống từ 3 cây  giống đậu tương khác nhau []. Do đó, để  xác  được xử  lý stress và 3 cây đối chứng (3 mẫu   định vai  trò  của gen này trong  điều  hòa  đáp  sinh học)  được thu nhận tách biệt và nghiền  ứng ABA và đáp ứng hạn nhằm ứng dụng cho  trong nitơ lỏng. RNA tổng số được tách chiết  tăng cường tính chống chịu stress phi sinh hoc̣   và thu nhận bằng bộ  kit GenJET Plant RNA   ở đậu tương, chúng tôi sử dụng kỹ thuật PCR  Purification Mini Kit (Thermo Scientific), đồng  ̣ đinh l ượng để xac đ ́ ịnh mưc đô bi ́ ̣ ểu hiện của   thời   được   tinh   sạch   loại   bỏ   DNA   bằng  GmHK07 ở giống chịu hạn tốt DT51 và giống  DNaseI   (RapidOut   DNA   removal,   thermo  chịu hạn kém MTD720 được xử lý ABA và xử  scientific). Các mẫu RNA được kiểm tra nồng   lý hạn sinh lý. Sự  giảm biểu hiện đáng kể  và  độ  bằng máy đo quang phổ  UV­Vis (Biotek,   sự  tích lũy biểu hiện thấp của GmHK07 ở  rễ  Hoa Kỳ) và được tổng hợp cDNA một mạch   ̀ ủa giống đậu tương chịu hạn kém khi  và chôi c từ   1   µg   RNA   với   bộ   kit   tổng   hợp   cDNA  xử lý ABA và dưới điều kiện hạn là cơ sở cho  (thermo scientific). việc   xác   định   vai   trò   điều   hòa   của   gen   này  Phân tích PCR định lượng  trong   việc   ứng   dụng   tạo   giống   đậu   tương  Trình tự  mồi đặc hiêụ  cho GmHK07 được  chống chịu stress hạn cũng như chống chịu cać   sử dụng theo nghiên cứu của  ]. Nồng độ mồi  ́ ́ ́ ợi phi sinh hoc b yêu tô bât l ̣ ằng công nghệ gen. là  0,4 µM  trong thể  tích phản  ứng là   12,5  µl.  VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU Gen  Fbox  được sử  dụng làm gen tham khảo  để định lượng tương đối biểu hiện gen đích ].  Vật   liệu   là   hai   giống   đậu   tương   DT51  ̣ Chu ky nhiêt cua ̀ ̉  phản  ứng PCR định lượng là  (được   cung   câṕ   từ  trung   tâm   nghiên   cứu   và  10 phút  ở  95°C, 40 chu kỳ của 95°C (15 giây)   phát triển đậu đỗ) và MTD720 (được cung câṕ   và   60°C  (1  phút)   (Realplex  Eppendorf,   Đức).  từ Trung tâm Nghiên cứu đậu tương, trường  Để kiểm tra số lượng sản phẩm được khuếch  Đại   học   Cần   Thơ)   đã   được   phân   tích   đặc  đại,   thực   hiện   phân   tích   đường   cong   nóng  điểm sinh lý tăng trưởng trong nghiên cứu của   chảy bằng cách giữ  15 giây  ở  95°C trước khi  [].  gia tăng từ  60°C lên 95°C. Phương pháp delta  Ct được sử dụng để so sánh tương đối mức độ  Xử lý hormone ABA biểu hiện gen các mô, và giữa các điều kiện  ̣ ương được trông trong đi Đâu t ̀ ều kiện ánh  xử  lý. Trinh t ̀ ự  va hiêu qua khuêch đai phan ̀ ̣ ̉ ́ ̣ ̉   sáng tự nhiên, nhiệt độ từ 28­30 C, quang kỳ 12  o ứng   Real­time   (E)   cuả   hai   căp ̣   môì  Fbox  và  giơ tôi/sang. Sau giai đo ̀ ́ ́ ạn 12 ngày tuổi, cây con  GmHK07  được   phân   tich ́   băng̀   phân ̀   mêm ̀   được thu nhận, rửa sạch đất và nuôi trong dung  LinRegPCR 2012.0 (bang 1). ̉ dịch ABA nồng độ  100 µM trong 0 giờ và 10  giơ (28 ̀ oC, độ ẩm 60%, ánh sáng 200 µMm­2s­1). Xử lý hạn ̣ ương được trông trong đi Đâu t ̀ ều kiện ánh  sáng tự  nhiên, nhiệt độ  từ  28­30oC, quang kỳ  12 giơ tôi/sang. Sau giai đo ̀ ́ ́ ạn 12 ngày tuổi, cây Bảng 1. Trình tự mồi đặc trưng va hiêu qua khuêch đai cua các gen đ ̀ ̣ ̉ ́ ̣ ̉ ược sử dụng trong phân tích   qRT­PCR 124
  3. Khảo sát sự biểu hiện của gen mã hóa GmHK07 ST E Gen Mồi xuôi (5' 3') Mồi ngược (5' 3') T 1 Fbox AGATAGGGAAATTGTGCAGGT CTAATGGCAATTGCAGCTCTC 1,9 2 GmHK07 TCTCATGCCTCATCACCAT GACCGTATTTGTTTCCCCA 1,9 KẾT QUẢ VÀ THẢO LUẬN GmHK07  dưới điều kiện xử  lý ABA và mức  độ  chống chịu hạn kém của giống đậu tương  Đánh giá sự  biểu hiện gen GmHK07 trong  MTD720 được khảo sát. Dưới điều kiện hạn,  mô   rễ   và   chôì   của   hai   giống   đậu   tương  ở mô rễ và chôi c ̀ ủa hai giống không cho thấy  DT51 và MTD720 dưới  điều kiện hạn và  sự  thay đổi biểu hiện đáng kể  (hình 2).  Dư ̃ xử lý ABA ̣ ̉ liêu cua Le et al. (2011) [3] cung cho thây s ̃ ́ ự  Trong nghiên cứu trước đây của chúng tôi,  ̉ biêu hiên cua  ̣ ̉ gen GmHK07  ở  mô rê cua giông ̃ ̉ ́   dựa trên sự  đánh giá sinh lý rễ  và chôi, ch ̀ ỉ số  ̣ ương Williams 82 được xử ly mât n đâu t ́ ́ ươc  ́ ở  chịu hạn và hàm lượng nước tương đối, DT51  2 giơ ̀ và10 gi   ơ ̀ không co s ́ ự  khac biêt so v ́ ̣ ơí  và   MTD720   đã   được   xác   định   như   những  đôi ch́ ưng ́  0 giơ, tuy nhiên  ̀ ở  mô  chôì  co s ́ ự  giống chịu hạn tốt và kém tương ứng trong số  ́ ̣ khac biêt đang kê 2,5 lân khi x́ ̉ ̀ ử  lý 10 giơ ̀ so  14 giống đậu tương được khảo sát. Dựa trên  vơi  ́ 0 giơ. Nh ̀ ư  vây, cung v ̣ ̀ ơi nghiên c ́ ưu nay, ́ ̀   hai giống đậu tương này, chúng tôi tiếp tục  chung tôi ghi nhân ́ ̣  gen  GmHK07  không  có  sự  phân tích biểu hiện của gen  GmHK07 dưới xử  ̉ biêu hiên đap  ̣ ́ ưng v ́ ơi stress  ́ ở  mô rê. S ̃ ự  biêủ   lý hormone ABA vốn là hormone đóng vai trò  ̣ hiên gia tăng cua gen nay  ̉ ̀ ở  mô chôì khi xử  lý  quan trọng trong điều hòa đáp ứng hạn để xác  mât n ́ ươc cho thây s ́ ́ ự  biêu hiên cua gen nay la ̉ ̣ ̉ ̀ ̀  định vai trò của gen này trong sự  dẫn truyền  ̣ phu thuôc mô, ph ̣ ụ  thuộc vào giông đâu t ́ ̣ ương  tín hiệu ABA. Kết quả cho thấy sự giảm biểu   ̀ ương phap x va ph ́ ử ly han. ́ ̣ hiện của GmHK07 được quan sát trong cả mô  Trong cơ chế đáp ứng hạn, thực vật có hai  rễ  (6,4 lần) và chôi (2,5 l ̀ ần) của giống đậu  con đường chính để  dẫn truyền tín hiệu đến  tương chịu hạn kém MTD720 dưới điều kiện  điều   hòa   biểu   hiện   gen   đích,   bao   gồm   con  xử  lý ABA 10 giờ so với 0 giờ (hình 1A, 1B).  đường phụ thuộc ABA và con đường độc lập  Trong   khi   ở   giống   đậu   tương   chịu   hạn   tốt  ABA   [].   Như   vậy,   dựa   trên   những   kết   quả  DT51,  GmHK07  không   có   sự   thay   đổi   biểu  trên, có thể  xác định  GmHK07  là yếu tố  phụ  hiện đáng kể ở mô rễ và chôi đ ̀ ược xử lý ABA  thuộc ABA do sự  biểu hiện thay đổi của nó  ở  10 giờ so với 2 giơ. K ̀ ết quả cũng cho thấy  dưới điều kiện xử lý ABA. rằng, có sự  tương quan giảm biểu hiện của   Hình   1.  Sự   biểu   hiện   tương   đối  của  gene  GmHK07  so với  Fbox  ở  mô   rễ   (a)   và   mô   thân  (b)   của   hai  giống MTD720 và DT51 dưới điều  kiện xử  lý ABA  0 giơ ̀ và  10 giơ.̀  Nồng độ  ABA là 100 µM được xử  lý   khi   cây   tăng   trưởng   được   12  ngày tuổi. Sự  biểu hiện có ý nghĩa  thống kê được xác định với * (P 
  4. Nguyen Binh Anh Thu et al. Hình   2.  Sự   biểu   hiện   tương   đối  của  gene  GmHK07  so với  Fbox  ở  mô   rễ   (a)   và   mô   thân  (b)   của   hai  giống MTD720 và DT51 dưới điều  kiện   xử   lý   hạn.   Thời   gian   xử   lý  hạn được bắt đầu sau khi trồng 12  ngày tuổi. Sự  biểu hiện co y nghia ́ ́ ̃  thống kê được xác định với * (P 
  5. Khảo sát sự biểu hiện của gen mã hóa GmHK07 Thường ́ ̣ Gia tri P Hạn ́ ̣ Gia tri P Rễ 97,5 0,00264 125,9 0,00002 Chôì 190,9 0,00039 296,8 0,00723 KẾT LUẬN elements   downstream   of   AHK5   in   the  stomatal   closure   response   of   Arabidopsis  Dưới   điều   kiện   xử   lý   ABA   và   hạn,   sự  thaliana.  Plant Signal. Behav., 7(11): 1467­ giảm biểu hiện GmHK07  ở  các mô rễ và chôì  1476. của MTD720 cũng như  sự  tích lũy biểu hiện  cao trong các mô của MTD720 so với DT51   6. Nishiyama   R.,   Le   D.   T.,   Watanabe   Y.,  cho thây vai trò đi ́ ều hòa âm tính của gen này  Matsui   A.,   Tanaka   M.,   Seki   M.,  trong cơ  chế  đáp  ứng với hormone ABA cũng  Yamaguchi­Shinozaki   K.,   Shinozaki   K.,  như  stress hạn  ở  đậu tương và có thể  được  Tran L­S. P., 2012. Transcriptome analyses  ứng   dụng   trong   kỹ   thuật   di   truyền   để   tăng  of a salt­tolerant cytokinin­deficient mutant  cường tính chống chịu stress thông qua nghiên  reveal   differential   regulation   of   salt   stress  cứu ức chế biểu hiện hoặc gây im lặng gen.  response by cytokinin deficiency. PloS One,  7(2): e32124. TÀI LIỆU THAM KHẢO 7. Shinozaki   K.,   Yamaguchi­Shinozaki   K.,  1. Hwang I., Chen H. C., Sheen J., 2002. Two­ 2007.  Gene   networks   involved   in   drought  component signal transduction pathways in  stress response and tolerance.  J. Exp. Bot.,  Arabidopsis.  Plant   Physiol.,   129(2):   500­ 58(2): 221­227. 515. 8. Thao N. P., Thu N. B. A., Hoang X. L. T.,  2. Le   D.   T.,   Aldrich   D.   L.,   Valliyodan   B.,  Ha V. C., Tran L­S. P., 2013. Differential  Watanabe   Y.,   Ha   V.   C.,   Nishiyama   R.,  expression analysis of a subset of drought­ Guttikonda S. K., Quach T. N., Gutierrez­ responsive  GmNAC  genes   in   two   soybean  Gonzalez   J.   J.,   Tran   L­S.   P.,   2012.  cultivars differing in drought tolerance.  Int.  Evaluation of candidate reference genes for  J. Mol. Sci., 14(12): 23828­23841. normalization   of   quantitative   RT­PCR   in  9. Thu   N.   B.   A.,   Hoang  X.   L.   T.,   Doan   H.,  soybean tissues under various abiotic stress  Nguyen T­H., Bui D., Thao N. P., Tran L­S.  conditions. PloS One, 7(9): e46487. P.,   2014a.  Differential   expression   analysis  3. Le   D.   T.,   Nishiyama   R.,   Watanabe   Y.,  of a subset of  GmNAC  genes in shoots of  Mochida   K.,   Yamaguchi­Shinozaki   K.,  two contrasting drought­responsive soybean  Shinozaki K., Tran L­S. P., 2011. Genome­ cultivars DT51 and MTD720 under normal  wide  expression profiling of  soybean two­ and   drought   conditions.  Mol.   Biol.   Rep.,  component   system   genes   in   soybean   root  41(9): 5563­5569. and shoot tissues under dehydration stress.  10. Thu N. B. A., Nguyen Q. T., Hoang X. L.  DNA Res., 18(1): 17­29. T.,   Thao   N.     P.,   Tran   L­S.   P.,   2014b.  4. Manavalan L. P., Guttikonda S. K., Tran L­ Evaluation   of   drought   tolerance   of   the  S.   P.,   Nguyen   H.   T.,   2009.   Physiological  Vietnamese   soybean   cultivars   provides  and   molecular   approaches   to   improve  potential   resources   for   soybean  production  drought   resistance   in   soybean.  Plant   Cell  and genetic engineering.  Biomed Res. Int.,  Physiol., 50(7): 1260­1276. 2014: 809736. 5. Mira­Rodado V., Veerabagu M., Witthöft J.,  11. Nguyễn   Bình   Anh   Thư,   Hoàng   Thị   Lan  Teply   J.,   Harter   K.,   Desikan   R.,   2012.  Xuân, Nguyễn Phương Thảo, 2014. Đánh  Identification   of   two­component   system  giá sự  biểu hiện của các gen mã hóa nhân   127
  6. Nguyen Binh Anh Thu et al. tố   phiên   mã  GmNAC092,  GmNAC083  và  Phương   Thảo,   2014.   Khảo   sát   sự   biểu  GmNAC057 trong đáp ứng hạn ở hai giống  hiện của gen  GmHK06  và  GmRR34  dưới  đậu   tu7ơng   Williams   82   và   MTD777­2.  điều   kiện   thiếu   nước   ở   hai   giống   đậu  Tạp chí Sinh học, 36(1se): 244­249. tương MTD777­2 và DT20. Tạp chí Sinh  12. Hoàng   Thị   Lan   Xuân,   Nguyễn   Hồ   Thủy  học, 36(1se): 232­236. Dung,   Nguyễn   Bình   Anh   Thư,   Nguyễn  EXPRESSION OF GmHK07 GENE IN RESPONSE TO ABA AND DROUGHT  TREATMENTS OF DROUGHT TOLERANT (DT51) AND SUSCEPTIVE  (MTD720) SOYBEAN VARIETIES Nguyen Binh Anh Thu, Doan Ngoc Hieu, Nguyen Phuong Thao International University, VNU, Hochiminh city SUMMARY  Abscisic acid (ABA) is an important phytohormone involving in plant adaptation to abiotic stress. Gene  expression study in response to ABA helps to identify the candidate genes for improvement of crop tolerance   genetic engineering. In this study, the regulatory role of GmHK07 was investigated in two soybean varieties  having contrasting phenotypes, including the drought­tolerant (DT51) and ­sensitive (MTD720) phenotypes,  under ABA and drought stress treatment. The qRT­PCR results of 12­day­old plants subjected to 100  µM  ABA treatment  showed that  GmHK07  was repressed significantly in root and shoot tissues of MTD720.  Besides, the expression of this gene in MTD720 shoots was 158­folds and 85­folds higher than those of DT51  at normal condition and 10 hours of ABA treatment, respectively, whereas, this expression in MTD720 roots  was 195­ and 67­folds higher than those of DT51. Under drought stress, high transcript of this gene was also   observed in both tissues of MTD720 relative to that of DT51. Together, GmHK07 is considered as a potential  negative  regulator   not  only  in  drought   tolerance   but  also  in ABA  response,  and  can  be  used  in genetic  engineering approach to enhance plant adaptation to abiotic stresses.  Keywords: Abiotic stress, abscisic acid, drought, GmHK07, qRT­PCR, soybean. Ngày nhận bài: 22­10­2014 128

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản