intTypePromotion=3

Nghiên cứu đa dạng di truyền tập đoàn nhãn bản địa Việt Nam bằng kĩ thuật SSR (Microsatellite)

Chia sẻ: Leon Leon | Ngày: | Loại File: PDF | Số trang:9

0
140
lượt xem
28
download

Nghiên cứu đa dạng di truyền tập đoàn nhãn bản địa Việt Nam bằng kĩ thuật SSR (Microsatellite)

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Nhãn là cây trồng quan trọng trong hệ thống nông nghiệp ở Việt Nam. Các thông tin trên mức độ đa dạng di truyền và nguồn gốc là rất quan trọng đối với nguồn gen bảo tồn, lựa chọn và phát triển các nhãn thương mại quan trọng. Trong nghiên cứu của chúng tôi, 10 SSR dấu hiệu có nguồn gốc từ vải-một quan hệ họ hàng gần gũi với nhãn-đã được sử dụng để đánh giá di truyền sự đa dạng của các giống cây địa phương của nhãn. Gen D? A được chiết xuất từ ​​48 mẫu thuộc đến 22 giống địa phương...

Chủ đề:
Lưu

Nội dung Text: Nghiên cứu đa dạng di truyền tập đoàn nhãn bản địa Việt Nam bằng kĩ thuật SSR (Microsatellite)

  1. NGHIÊN C U ĐA D NG DI TRUY N T P ĐOÀN NHÃN B N Đ A VI T NAM B NG KĨ THU T SSR (MICROSATELLITE) Khu t H u Trung1, guy n Trư ng Khoa1, Tr n Minh Hoa1, gô H ng Bình2, Lê Th Tươi3, guy n Xuân Vi t3, ng Tr ng Lương1 SUMMARY Studying of genetics diversity of native longans in Vietnam utilizing SSR technique Longan is an important crop in agricultural systems in Vietnam. The information on level of genetic diversity and origin is very important for conservation gene resource, selection and development of commercially important longan. In our study, 10 SSR markers derived from lychee-a close kinship with longan- were used to evaluate genetic diversity of local cultivars of longan. Genomic D A was extracted from 48 samples belong to 22 local cultivars for the PCR amplification of the SSR loci. The PCR products were resolved on denaturing polycrylamide gel. A total of 27 alleles were detected with an average of 2.7 alleles per locus. Polymorphism information content (PIC) value ranges from 0.0 to 0.75, with an average of 0.24. Heterozygosity percentage ranges from 0% to 30% data missing is 15%. Genetic similarity was determined using Jaccard’s similarity coefficient and final dendrogram construction using a UPGMA clustering methods showed that 48 samples were divided into 9 distinguished heterotic groups with genetic similarity from 0.22 to 1.0. All of the information has diversified application in longan study in the future. Keywords: Dimocarpus longan, native, genetic diversity, heterozygosity, SSR makers. ch n l c, nhân gi ng và b o t n m t cách I. TV N t phát, các cá th có phNm ch t t t ư c Cây nhãn (Dimocapus longan Lour.) nhân lên, di th c và ư c t tên ch y u thu c h Sapindaceae là loài cây ăn qu d a vào m t s các c i m hình thái ho c nhi t i có giá tr kinh t cao. nư c ta, a i m phát sinh. Vì v y, ã gây ra s nhãn ư c tr ng ph bi n và t p trung t i nh m l n và hi u sai v xu t x , ngu n g c m t s khu v c hình thành các vùng chuyên b n a và m i quan h di truy n gi a các canh v i nhi u gi ng nhãn n i ti ng như: gi ng. ây cũng chính là nguyên nhân làm Nhãn l ng Hương Chi và nhãn ư ng Phèn thu h p a d ng di truy n và d n n tình c a Hưng Yên, nhãn cùi c a Lào Cai, nhãn tr ng xói mòn ngu n gen nhãn [2]. tiêu Da Bò c a Bà R a-Vũng Tàu, nhãn Chi n lư c b o t n tài nguyên a d ng xu ng Cơm Vàng c a Ti n Giang... Các di truy n, nh n d ng chính xác các ngu n gi ng nhãn c a Vi t Nam ch y u ư c gen ph c v công tác lưu gi và ăng kí b n 1 Vi n Di truy n N ông nghi p; 2 Vi n N ghiên c u Rau qu ; 3 i h c Sư ph m Hà N i.
  2. quy n nh ng cây tr ng b n a, c bi t là II. V T LI U VÀ PHƯƠN G PHÁP nh ng cây có giá tr kinh t cao là r t c n N GHIÊN C U thi t. Tuy nhiên, Vi t N am các báo cáo v 1. V t li u nghiên c u cây nhãn m i ch t p trung ch y u vào nghiên c u các c tính nông h c và nghiên - V t li u s d ng bao g m 48 m u c u a d ng di truy n m c hình thái [3,4]. thu c 22 gi ng nhãn b n a c a Vi t Nam Trong báo cáo này chúng tôi s d ng 12 m i ư c thu t i vư n t p oàn c a Vi n Nghiên SSR ã ư c thi t k cho cây v i là m t cây c u Rau qu -Trâu Quỳ, Gia Lâm, Hà N i; ăn qu có quan h di truy n g n v i cây Vi n Cây ăn qu mi n Nam-Long nh, nhãn nghiên c u a d ng di truy n c a Ti n Giang; và t i các a phương ang t p oàn nhãn b n a c a Vi t N am. tr ng ph bi n các gi ng nhãn này (b ng 1). B ng 1. Danh sách các gi ng nhãn nghiên c u TT Tên m u Ngu n g c Đ a đi m thu m u 1 Nhãn l ng (PH-S99-1.1) Hưng Yên Vi n Nghiên c u Rau qu 2 Nhãn l ng B14 Hưng Yên Vi n Nghiên c u Rau qu 3 Nhãn l ng (PH-M99-2.2) Hưng Yên Vi n Nghiên c u Rau qu 4 Nhãn cùi (YB-10) Yên Bái Vi n Nghiên c u Rau qu 5 Nhãn cùi (YB-28) Yên Bái Vi n Nghiên c u Rau qu 6 Nhãn cùi (LC-4) Lào Cai Vi n Nghiên c u Rau qu 7 Nhãn cùi (LC-9) Lào Cai Vi n Nghiên c u Rau qu 8 Nhãn cùi (LC11) Lào Cai Vi n Nghiên c u Rau qu 9 Đư ng Phèn Hưng Yên Hưng Yên Đ a phương 10 Nhãn cùi (HTM-1) Hà Tây Vi n Nghiên c u Rau qu 11 Tiêu Da bò Ti n Giang Vi n Cây ăn qu mi n Nam 12 Xu ng Cơm Vàng Ti n Giang Vi n Cây ăn qu mi n Nam 13 Nhãn tiêu Lá B u Ti n Giang Vi n Cây ăn qu mi n Nam 14 Nhãn nư c N1 Hưng Yên Vi n Nghiên c u Rau qu 15 Nhãn thóc T1 Hưng Yên Vi n Nghiên c u Rau qu 16 Nhãn l ng B10 Hưng Yên Vi n Nghiên c u Rau qu 17 Nhãn cùi B5 Hưng Yên Vi n Nghiên c u Rau qu 18 Nhãn l ng B7 Hưng Yên Vi n Nghiên c u Rau qu 19 Nhãn l ng DH3 Phú Th Vi n Nghiên c u Rau qu 20 Nhãn l ng VT22 Vĩnh Phúc Vi n Nghiên c u Rau qu 21 Nhãn l ng TQ20 Tuyên Quang Vi n Nghiên c u Rau qu
  3. 22 Nhãn cùi C2 Hưng Yên Vi n Nghiên c u Rau qu - 12 c p m i SSR ư c s d ng có ký tin v trình t l p, kích thư c, s alen trên hi u t LMLY1 n LMLY12 (b ng 2) do m i locus ã ư c Viruel và Hormaza phát hãng Invitrogen cung c p d a vào các thông hi n cây v i (Viruel, Hormaza, 2004). B ng 2. Tên và trình t các c p m i SSR TT C pm i Trình t m i xuôi Trình t m i ngư c 1 LMLY1 TTTGTGTAATTTGTCGTACTT ATGAAAGATGAGAAGAAAAAG 2 LMLY2 AAGATGAGATGAGTGTTTTTAC GAATACTTTTTGACTTGTTCTC 3 LMLY3 GAGTAGATAAAAATGGTAATGG CACCTACACCTCCCTATATT 4 LMLY4 CAAATAACATGAAAAAGATGA ATGTCAATATGTCAGTGTCTCT 5 LMLY5 TGGAGAGGACATGATTACTA AAAGAGAATTGCACAGAAAC 6 LMLY6 AAGGAATAAAGCTATCAATAAA GATCTCTATCTCATCAAACCT 7 LMLY7 ACCTTCTTGAATAGGATAAAG TCAGATGAGATAGATTAGAAAGA 8 LMLY8 ATGATGGTAGAGGTCAAGTT CCCTATGAGAGAGAAAATATAA 9 LMLY9 CATTATCTTCTTTATTACCA CACAAGTATTTTCTCTGC 10 LMLY10 AATAGGGTTTGTGTAATTTGT ATATCAAAGGCGATAGATTC 11 LMLY11 GTTTTCATATTGGACTTATTTT ACTCATATTTCATTCTCTCACT 12 LMLY12 GAAGCTGTCTTACACTCCAC ACAAACCTAGAAACCAAAAG - i n di s n ph m PCR và nhu m: 2. Phương pháp nghiên c u S n phNm PCR ư c bi n tính trư c khi - Tách chi t AD t ng s : Lá bánh ch y i n di trên gel polyacrylamide 4,5% t c a các m u gi ng ư c thu th p, x và ư c phát hi n b ng phương pháp lý và tách chi t ADN t ng s theo nhu m b c. phương pháp CTAB như mô t c a Cheng et al. (1994). - Phương pháp phân tích và x lý s - Ch y PCR: Các ph n ng PCR ư c li u: K t qu ư c th ng kê d a vào s th c hi n theo chu trình nhi t: 940C (5 xu t hi n hay không xu t hi n c a các băng phút), 35-37 chu kì [940C (40s); 550C-600C ADN; h s PIC (Polymorphic Information Content-Ch s thông tin a hình c a m i) (30s), 720C (30s-1 phút)] và k t thúc 720C (5 phút). ư c tính theo công th c: PIC = 1- ΣPi2 (trong ó Pi là t n s xu t hi n c a alen th
  4. i). S li u ư c x lý, phân tích b ng 1. H s PIC, s alen và t ng s băng chương trình Excel version 5.0 và ph n AD th hi n trên t ng m i m m NTSYSpc 2.1 K t qu phân tích 10 m i SSR v i 48 m u thu c 22 gi ng nhãn ư c trình bày III. K T QU VÀ TH O LU N b ng 3. B ng 3. H s PIC, s alen/locus và t ng s alen c a t ng m i SSR TT C pm i S alen/locus T ng s alen/m i PIC 1 LMLY1 2 44 0,05 2 LMLY2 4 46 0,57 3 LMLY3 3 51 0,31 4 LMLY4 - - - 5 LMLY5 1 48 0,00 6 LMLY6 2 54 0,19 7 LMLY7 3 54 0,12 8 LMLY8 - - - 9 LMLY9 1 42 0,00 10 LMLY10 6 24 0,75 11 LMLY11 4 52 0,41 12 LMLY12 1 43 0,00 T ng 27 458 2,40 Trung bình 2,7 45,8 0,24 (-): không khu ch i c 22 gi ng nhãn nghiên c u S li u b ng 3 cho th y: Trong s 12 2. T l d h p (H%) c a các m u gi ng c p m i SSR c a cây v i, có 10 c p m i nhãn nghiên c u khu ch i c 22 gi ng nhãn nghiên c u T l các locus d h p (H%) cao nh t là thu ư c t ng s 27 lo i alen, trung bình 25% m u N32; các m u N10, N17, N34, 2,7 alen/locus. Có 3 c p m i (LMLY5, N42, N46 và N47 có m c d h p là 20%; 24 LMLY9 và LMLY12) ch thu ư c các m u có m c d h p t 11,1% n 14,3%; 17 locus ơn hình; 7 c p m i (LMLY1, m u ng h p c 10 locus nghiên c u LMLY2, LMLY3, LMLY6, LMLY7, (m c d h p là 0%). Như v y, phân tích v i LMLY10 và LMLY11) cho các locus a 10 locus thì t l d h p trung bình c a c hình. Trong ó: 2 m i ch thu ư c 2 alen, t p oàn là khá th p (8,7%). K t qu trên 2 m i thu ư c 3 alen, 2 m i thu ư c 4 cũng cho th y gi a các gi ng có s khác alen, 1 m i thu ư c 6 alen (b ng 3). T ng nhau v m c d h p; gi a các m u trong s alen thu ư c là 458 (trung bình là 45,8 cùng m t gi ng cũng có s khác nhau các alen/m i). H s a hình (PIC-Polymorphic locus nghiên c u. Nh ng k t qu này r t Information Content) c a 10 m i dao ng h u ích so sánh gi a các gi ng v i nhau, t 0 ( các m i ch xu t hi n băng ơn nghiên c u a d ng di truy n bên trong gi ng, xác nh ngu n g c các m u gi ng hình) n 0,75 ( m i LMLY10 có 6 alen và nh n d ng chính xác nh ng m u gi ng th hi n); h s PIC trung bình c a c t p (cá th ưu vi t) trong t p oàn ph c v oàn là 0,24. công tác ch n, t o và nhân gi ng.
  5. Hình 1. K t qu i n di s n phNm PCR c a 48 m u nhãn v i c p m i LMLY7 (marker φX174) B ng 4. T l d h p (H%) c a các m u gi ng nhãn d a trên k t qu phân tích 10 locus SSR TT Kí hi u Tên gi ng H% TT Kí hi u Tên gi ng H% 1 N1 Nhãn l ng (PH-S99-1.1) 0 25 N25 Đư ng Phèn Hưng Yên 14,3 2 N2 Nhãn l ng (PH-S99-1.1) 0 26 N26 Đư ng Phèn Hưng Yên 12,5 3 N3 Nhãn l ng (PH-S99-1.1) 0 27 N27 Đư ng Phèn Hưng Yên 0 4 N4 Nhãn l ng B14 11,1 28 N28 Nhãn cùi (HTM-1) 0 5 N5 Nhãn l ng B14 0 29 N29 Nhãn cùi (HTM-1) 0 6 N6 Nhãn l ng B14 11,1 30 N30 Nhãn cùi (HTM-1) 10 7 N7 Nhãn l ng (PH-M99-2.2) 0 31 N31 Tiêu Da Bò 14,3 8 N8 Nhãn l ng (PH-M99-2.2) 10,0 32 N32 Tiêu Da Bò 25,0 9 N9 Nhãn l ng (PH-M99-2.2) 10,0 33 N33 Tiêu Da bò 0 10 N10 Nhãn cùi (YB-10) 20,0 34 N34 Xu ng Cơm Vàng 20,0 11 N11 Nhãn cùi (YB-10) 10,0 35 N35 Xu ng Cơm Vàng 11,1 12 N12 Nhãn cùi (YB-10) 11,1 36 N36 Xu ng Cơm Vàng 12,5 13 N13 Nhãn cùi (YB-28) 11,1 37 N37 Nhãn tiêu Lá B u 0 14 N14 Nhãn cùi (YB-28) 11,1 38 N38 Nhãn tiêu Lá B u 0 15 N15 Nhãn cùi (YB-28) 11,1 39 N39 Nhãn tiêu Lá B u 0 16 N16 Nhãn cùi (LC-4) 10,0 40 N40 Nhãn nư c N1 0 17 N17 Nhãn cùi (LC-4) 20,0 41 N41 Nhãn thóc T1 11,1 18 N18 Nhãn cùi (LC-4) 12,5 42 N42 Nhãn l ng B10 20,0 19 N19 Nhãn cùi (LC-9) 0 43 N43 Nhãn cùi B5 10,0 20 N20 Nhãn cùi (LC-9) 0 44 N44 Nhãn l ng B7 11,1 21 N21 Nhãn cùi (LC-9) 11,1 45 N45 Nhãn l ng DH3 12,5 22 N22 Nhãn cùi (LC11) 0 46 N46 Nhãn l ng VT22 20,0 23 N23 Nhãn cùi (LC11) 11,1 47 N47 Nhãn l ng TQ20 20,0 24 N24 Nhãn cùi (LC11) 0 48 N48 Nhãn cùi C2 11,1 Trung bình 8,7 3. K t qu phân tích m i quan h di S li u thu ư c t 10 m i SSR ư c truy n c a t p oàn nhãn nghiên c u th ng kê và phân tích b ng ph n m m
  6. NTSYSpc2.1, t ó thi t l p ư c h s Nhóm 1.3 có 8 m u: N3, N5, N6, N7, tương ng di truy n và sơ cây quan h N8 và N9 thu c gi ng nhãn l ng; N28 và ch ng lo i c a các m u nhãn (hình 2). N30 thu c gi ng nhãn cùi. D a vào sơ hình cây cho th y: Nhóm 1.4 có 8 m u: N4, N44, N45, m c tương ng di truy n 57%, 48 m u N47 (nhãn l ng); N21, N29, N43, N48 gi ng nhãn nghiên c u ư c chia thành 2 (nhãn cùi). nhóm l n: Nhóm 1.5 có duy nh t m u N27 (gi ng Nhóm I: Bao g m 39 m u gi ng u ư ng Phèn Hưng Yên). thu c các gi ng nhãn phân b mi n B c ư c chia thành nhóm nh hơn: Nhóm II bao g m 9 m u gi ng thu c các gi ng nhãn phân b mi n Nam ư c Nhóm 1.1 có 13 m u: N1, N2 và N46 chia thành 3 nhóm nh hơn: thu c các gi ng nhãn l ng N11, N12, N19, N20, N22 và N24 thu c các gi ng nhãn cùi; Nhóm 2.1 có 3 m u N31, N32 và N33 N25 và N26 thu c gi ng nhãn ư ng Phèn u thu c gi ng nhãn tiêu Da Bò. Trong ó Hưng Yên; N40 thu c gi ng nhãn nư c; N31 và N32 có ki u gen tương t nhau và N41 thu c gi ng nhãn thóc. Trong ó các có h s tương ng di truy n v i m u N33 nhóm m u (N1 và N40), (N2, N20, N24), là 0,83. (N41, N46) và (N11, N12, N25 và N26) có ki u gen tương t nhau c 10 locus nghiên Nhóm 2.2 có 3 m u N34, N35 và N36 c u (H s tương ng di truy n là 1). u thu c gi ng nhãn xu ng Cơm Vàng, có Nhóm 1.2 g m 9 m u: N10, N13, N14, ki u gen tương t nhau các locus nghiên N15, N16, N17, N18 và N23 u thu c các c u (H s tương ng di truy n là 1). gi ng nhãn cùi; N42 thu c gi ng nhãn l ng. Nhóm 2.3 có 3 m u N37, N38 và N39 Trong ó, các m u trong các nhóm m u u thu c gi ng nhãn tiêu Lá B u, có ki u (N10, N18), (N13, N14, N15, N16) và gen tương t nhau các locus nghiên c u (N17, N23) có ki u gen tương t nhau các (H s tương ng di truy n là 1). locus nghiên c u (H s tương ng di truy n là 1).
  7. Hình 2. Sơ quan h ch ng lo i c a 48 m u nhãn nghiên c u
  8. T¹p chÝ khoa häc vµ c«ng nghÖ n«ng nghiÖp ViÖt Nam K t qu phân nhóm cho th y: S khác bi t gi a 2 nhóm l n là các gi ng nhãn mi n B c và các gi ng nhãn mi n Nam; các m u trong cùng m t gi ng có h s tương ng di truy n cao ư c phân trong cùng m t nhóm có th là do ư c nhân gi ng theo phương pháp nhân gi ng vô tính b ng chi t cành, ghép cành t nh ng cây có chung m t ngu n g c; các m u cùng m t gi ng có h s tương ng th p ư c phân các nhóm khác nhau có th do gi ng có n n di truy n r ng ho c do s di th c và g i tên theo tên a phương khác nhau. IV. K T LU N T p oàn nhãn b n a c a Vi t Nam r t a d ng và phong phú, k t qu phân tích v i 10 m i SSR trên 48 m u thu c 22 gi ng nhãn b n a c a Vi t Nam ã thu ư c 27 lo i alen khác nhau (s alen th hi n/m i trung bình là 2,7); h s PIC dao ng t 0,0 n 0,75 (trung bình 0,24); t l các locus d h p c a các m u nghiên c u dao ng t 0% n 25,0%. m c tương ng 57%, 48 m u nhãn ư c phân thành 8 nhóm khác bi t thu c 2 nhóm l n, h u như các m u c a m i gi ng u n m trong m t nhóm riêng và có th d dàng phân bi t v i các gi ng nhãn khác. K t qu này là cơ s xác nh các marker phân t nh n d ng chính xác các gi ng nhãn b n a c a Vi t Nam. D a vào s sai khác gi a các m u trong cùng m t gi ng (s a d ng di truy n bên trong gi ng) có th xác nh ngu n g c phát sinh c a các m u gi ng, ch n ra các cá th ưu vi t ph c v công tác ch n, t o gi ng, nhân gi ng và b o t n có hi u qu các ngu n gen nhãn quý c a Vi t Nam. TÀI LI U THAM KH O 1 Billote ., Lagoda P.J.L., Risterucci A.M., Baurens F.C., 1999. Microsatellite- enriched libraries: applied methodology for the development of SSR markers in tropical crops. Fruits 54: 277-288. 2 Cheng Y.J., Guo W.W., Yi H.L., Pang X.M., Deng X.X., 2003. An efficient protocol for genomic ADN extraction from Citrus species. Plant Mol. Biol. Reporter 21: 177. 3 Li M., Zheng X., Zhu Y., Wang X., Liang S., Li L. and Wu X., 2006, Development and characterization of SSR markers in lychee (Litchi chinensis). Molecular Ecology otes 6: 1205-1207. 4 Li M.F., Zheng X.Q., 2004. Development of SSR markers in lychee (Litchi chinensis). Yichuan 26: 2911-2916. 5 Viruel M.A., Hormaza J.I., 2004. Development, characterization and variability analysis of microsatellites in lychee (Litchi chinensis Sonn., Sapindaceae). Theoretical Applied Genetics108: 896-902. 8
  9. T¹p chÝ khoa häc vµ c«ng nghÖ n«ng nghiÖp ViÖt Nam gư i ph n bi n: GS.TSKH. Tr n Duy Quý 9

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản