intTypePromotion=3

Nghiên cứu đánh giá khả năng biệt hóa của tế bào gốc trung mô từ mô mỡ người thành tế bào giống tế bào gan in vitro

Chia sẻ: Ni Ni | Ngày: | Loại File: PDF | Số trang:7

0
36
lượt xem
1
download

Nghiên cứu đánh giá khả năng biệt hóa của tế bào gốc trung mô từ mô mỡ người thành tế bào giống tế bào gan in vitro

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Bài viết trình bày kết quả khảo sát khả năng biệt hóa của tế bào gốc trung mô từ mô mỡ (adipose-derived stem cells-ADSCs) thành tế bào giống tế bào gan in vitro bằng môi trường biệt hóa sử dụng hóa chất. Bằng các phương pháp kiểm tra kết quả sau biệt hóa chúng tôi đã chứng minh được ADSCs có khả năng biệt hóa in vitro thành tế bào giống tế bào gan.

Chủ đề:
Lưu

Nội dung Text: Nghiên cứu đánh giá khả năng biệt hóa của tế bào gốc trung mô từ mô mỡ người thành tế bào giống tế bào gan in vitro

TẠP CHÍ SINH HỌC 2014, 36(1se): 209-215<br /> <br /> NGHIÊN CỨU ĐÁNH GIÁ KHẢ NĂNG BIỆT HÓA CỦA TẾ BÀO GỐC TRUNG<br /> MÔ TỪ MÔ MỠ NGƯỜI THÀNH TẾ BÀO GIỐNG TẾ BÀO GAN IN VITRO<br /> Nguyễn Thị Kim Nguyền*, Trương Hải Nhung, Mai Thị Trang,<br /> Nguyễn Hải Nam, Phạm Văn Phúc<br /> Trường Đại học Khoa học tự nhiên, ĐHQG tp Hồ Chí Minh, *ntknguyen@hcmus.edu.vn<br /> TÓM TẮT: Nghiên cứu của chúng tôi trình bày kết quả khảo sát khả năng biệt hóa của tế bào gốc trung<br /> mô từ mô mỡ (adipose-derived stem cells-ADSCs) thành tế bào giống tế bào gan in vitro bằng môi trường<br /> biệt hóa sử dụng hóa chất. Bằng các phương pháp kiểm tra kết quả sau biệt hóa chúng tôi đã chứng minh<br /> được ADSCs có khả năng biệt hóa in vitro thành tế bào giống tế bào gan. Tế bào giống tế bào gan<br /> (hepatocyte-like cells-HPCs) có sự thay đổi hình thái từ dạng đặc trưng của tế bào gốc trung mô sang dạng<br /> đa giác với tỷ lệ giữa thể tích nhân tế bào và tế bào chất tăng lên, hình thái này tương tự với tế bào nhu mô<br /> gan. Ngoài ra, HPCs biểu hiện cao các gen hướng gan như: α-fetoprotein, albumin, CK18, CK19 so với<br /> ADSCs đối chứng. Đồng thời, kết quả nhuộm PAS (Periodic acid-Schiff stain) cho thấy HPCs có khả<br /> năng dự trữ glycogen.<br /> Từ khóa: Bệnh gan, biệt hóa tế bào, tế bào gan, tế bào gốc.<br /> MỞ ĐẦU<br /> <br /> Xơ gan là một trong những bệnh phổ biến<br /> và là nguyên nhân dẫn đến tử vong cao trong số<br /> các bệnh liên quan đến gan ở Việt Nam. Các<br /> phương pháp điều trị hiện tại đối với căn bệnh<br /> này là cấy ghép gan. Tuy nhiên, việc cấy ghép<br /> gan tồn tại các nhược điểm như khan hiếm<br /> nguồn cấy ghép, giá thành cao và khả năng gây<br /> thải loại miễn dịch.<br /> Tế bào gốc trung mô MSCs (mesenchymal<br /> stem cell) được xem như một nguồn vật liệu tiềm<br /> năng trong liệu pháp điều trị bệnh nhằm thay thế<br /> các tế bào hoặc cơ quan mất chức năng của cơ<br /> thể trong đó có tổn thương gan. Đến nay, MSCs<br /> có thể được phân lập từ rất rất nhiều nguồn khác<br /> nhau nhằm cung cấp nguồn vật liệu đa dạng và<br /> dồi dào cho liệu pháp cấy ghép. Trong số đó, tế<br /> bào gốc trung mô từ mô mỡ ADSCs (adiposederived stem cells) là một ứng cử viên tiềm năng<br /> vì ngoài khả năng tự làm mới và tiềm năng biệt<br /> hóa đa dòng như tế bào gốc trung mô, ADSCs<br /> còn là một nguồn dồi dào cho liệu pháp cấy ghép<br /> tự thân khắc phục các vấn đề về thải loại miễn<br /> dịch trong cấy ghép dị cá thể [2].<br /> Trong các báo cáo trước đó, hADSCs<br /> (human adipose-derived stem cells) đã được<br /> chứng minh có khả năng làm giảm xơ gan trong<br /> mô hình chuột bị xơ gan bằng TAA bởi khả<br /> năng biệt hóa thành tế bào gan nhằm thay thế<br /> <br /> cho các tế bào gan bị hư hỏng hoặc cảm ứng các<br /> tế bào nội sinh trong gan tăng sinh và thực hiện<br /> chức năng [6]. Do đó, trong nghiên cứu này<br /> chúng tôi tiến hành kiểm tra khả năng biệt hóa<br /> in vitro của tế bào ADSCs thành các tế bào<br /> giống tế bào gan để hướng tới các nghiên cứu<br /> tiếp theo nhằm ứng dụng chúng trong điều trị<br /> các bệnh thoái hóa tế bào gan.<br /> VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU<br /> <br /> Tế bào hADSCs sử dụng trong nghiên cứu<br /> này được cung cấp bởi phòng thí nghiệm Tế bào<br /> gốc, Trường đại học Khoa học tự nhiên.<br /> Nuôi cấy tăng sinh hADSCs<br /> Tế bào hADSCs sau khi được thu nhận và<br /> xác định đặc điểm của tế bào gốc trung mô sẽ<br /> được nuôi cấy thứ cấp trong môi trường MSC<br /> Cult Kit (Công ty GeneWorld, Việt Nam). Khi<br /> đạt mật độ 80-90% diện tích bề mặt bình nuôi<br /> cấy, tế bào được xử lý với trypsin/EDTA 0,25%<br /> (Công ty GeneWorld, Việt Nam) và được cấy<br /> chuyền sang bình nuôi cấy mới.<br /> Biệt hóa định hướng gan in vitro<br /> Quy trình biệt hóa: tế bào hADSCs được<br /> nuôi cấy tăng sinh đến P3. Khi tế bào đạt mật<br /> độ 80% bề mặt bình nuôi cấy tiến hành cấy<br /> chuyền qua đĩa 12 giếng được phủ với<br /> fibronectin 5 µg/ml để biệt hóa. Khi tế bào P4<br /> đạt mật độ 80-90% bề mặt nuôi cấy, tiến hành<br /> 209<br /> <br /> Nguyen Thi Kim Nguyen et al.<br /> <br /> biệt hóa với hai môi trường biệt hóa. Tế bào<br /> được biệt hóa qua hai giai đoạn:<br /> Giai đoạn 1: tế bào hADSC P4 được nuôi<br /> cấy 7 ngày trong môi trường cảm ứng với thành<br /> phần là môi trường nuôi cấy được bổ sung với<br /> HGF 20 ng/ml, bFGF 10 ng/ml và nicotiamide<br /> 4,9 mM.<br /> Giai đoạn 2: sau 7 ngày tiến hành thay bằng<br /> môi trường biệt hóa với thành phần gồm môi<br /> trường nuôi cấy bổ sung với OMS 20 ng/ml,<br /> dexamethasone 1 µmol/l và ITS 10 ng/ml trong<br /> 3 tuần.<br /> <br /> Kiểm tra đặc điểm của HPCs sau biệt hóa<br /> Trong quá trình biệt hóa tế bào sử dụng<br /> kính hiển vi quan sát hình thái và ghi nhận sự<br /> thay đổi hình thái mỗi ngày.<br /> Để so sánh mức độ biểu hiện gen định<br /> hướng của tế bào sau biệt hóa với tế bào đối<br /> chứng (tế bào hADSCs không biệt hóa và tế bào<br /> ung thư gan người HepG2), phản ứng RT-PCR<br /> (SuperScript® III One-Step RT-PCR System<br /> with Platinum®Taq, InvitrogenTM) được sử<br /> dụng cùng với các cặp mồi chuyên biệt cho các<br /> gen đặc trưng cho tế bào gan (bảng 1).<br /> <br /> Bảng 1. Các cặp mồi được sử dụng trong nghiên cứu (Sigma)<br /> Tên gen<br /> CK18<br /> CK19<br /> Albumin<br /> Anpha<br /> fetoprotrein<br /> Fibronectin<br /> <br /> Mồi xuôi<br /> Mồi ngược<br /> Mồi xuôi<br /> Mồi ngược<br /> Mồi xuôi<br /> Mồi ngược<br /> Mồi xuôi<br /> Mồi ngược<br /> Mồi xuôi<br /> Mồi ngược<br /> <br /> Trình tự<br /> GAGATCGAGGCTCTCAAGGA<br /> CAAGCTGGCCTTCAGATTTC<br /> ATGGCCGAGCAGAACCGGAA<br /> CCATGAGCCGCTGGTACTCC<br /> TGCTTGAATGTGCTGATGACAG<br /> AAGGCAAGTCAGCAGGCATCTC<br /> TGCAGCCAAAGTGAAGAGGGAA<br /> CATAGCGAGCAGCCCAAAGAAG<br /> TGAAGAGGGGCACATGCTGA<br /> GTGGGAGTTGGGCTGACTCG<br /> <br /> Kết quả điện di sản phẩm PCR được phân<br /> tích bằng phần mềm ImageJ (National Institutes<br /> of Health) nhằm so sánh mức độ biểu hiện các<br /> gen định hướng gan của các dòng tế bào.<br /> Kiểm tra chức năng dự trữ glycogen<br /> Để kiểm tra chức năng dự trữ glycogen của<br /> tế bào giống tế bào gan sau biệt hóa, tế bào<br /> hADSCs đối chứng, HepG2 và HPCs được cố<br /> định và nhuộm PAS ở bệnh viện Chợ Rẫy,<br /> thành phố Hồ Chí Minh.<br /> KẾT QUẢ VÀ THẢO LUẬN<br /> <br /> Nuôi cấy thứ cấp tế bào hADSCs<br /> Kết quả nhuộm Giemsa quan sát hình thái<br /> cho thấy, tế bào hADSCs không có sự thay đổi<br /> hình thái sau nhiều thế hệ từ P3, P4, P5 và P6<br /> (hình 1).<br /> Kết quả biệt hóa thành tế bào giống tế bào<br /> gan<br /> 210<br /> <br /> Kích thước sản<br /> phẩm (bp)<br /> 357<br /> 328<br /> 162<br /> 217<br /> 274<br /> <br /> Từ giai đoạn biệt hóa ngày 5, tế bào đã có<br /> sự thay đổi hình thái, cụ thể là chuyển từ dạng<br /> đặc trưng trung mô sang dạng tế với hình dạng<br /> đa giác đặc trưng với tế bào gan (hình 2). Bên<br /> cạnh đó, một số tế bào trong nghiên cứu này ở<br /> giai đoạn trưởng thành cũng xuất hiện 2 nhân<br /> tương tự nghiên cứu của Lotfi (2012) [3] và<br /> Schwartz (2002) [7]. Hình thái đa nhân của tế<br /> bào cảm ứng giai đoạn trưởng thành được kiểm<br /> tra thông qua phương pháp nhuộm H & E và<br /> Hoechst. Sự thay đổi hình dạng của tế bào cảm<br /> ứng theo thời gian (tế bào có hình thái giống tế<br /> bào gan) là một trong những tiêu chí ban đầu<br /> đánh giá quá trình biệt hóa của hADSCs thành<br /> tế bào giống tế bào gan.<br /> Dựa vào kết quả (hình 3a) chúng tôi nhận<br /> thấy sản phẩm RT-PCR gen CK19 xuất hiện ở<br /> giếng 2 và 3 với kích thước như dự đoán (357<br /> bp), trong khi đó không có sản phẩm xuất hiện<br /> <br /> TẠP CHÍ SINH HỌC 2014, 36(1se): 209-215<br /> <br /> ở giếng số 1. Kết quả của (hình 3b) chứng tỏ tế<br /> bào biệt hóa thành tế bào giống tế bào gan đang<br /> ở giai đoạn sớm vì CK19 là gen đặc trưng của tế<br /> bào mật, các tế bào tiền thân của gan, tế bào ung<br /> thư gan [11].<br /> Kết quả ở hình 3 cho thấy, gen α-fetoprotein<br /> xuất hiện ở giếng số 1, 2, 3 với một vạch có<br /> kích thước như dự đoán. So sánh cường độ sáng<br /> của sản phẩm RT-PCR gen α-fetoprotein bằng<br /> <br /> phần mềm ImageJ, chúng tôi nhận thấy, cường<br /> độ sáng của α-fetoprotein ở giếng số 2, 3 gấp 8<br /> lần so với giếng số một (hADSCs). Cùng với<br /> kết quả kiểm tra sự biểu hiện của gen CK19, sự<br /> biểu hiện của gen α-fetoprotein ở nhóm biệt hóa<br /> góp phần khẳng định các tế bào biệt hóa thành<br /> tế bào giống tế bào gan đang trải qua giai đoạn<br /> sớm trong quá trình trưởng thành của tế bào<br /> gan.<br /> <br /> Hình 1. Hình thái tế bào hADSCs ở thế hệ thứ 3 (a), thứ 4 (b), thứ 5 (c) và thứ 6 (d)<br /> <br /> Hình 2. Hình thái tế bào hADSCs sau khi biệt hóa ngày 0 (a), ngày thứ 5 (b),<br /> ngày thứ 15 (c), ngày thứ 21 (d)<br /> 211<br /> <br /> Nguyen Thi Kim Nguyen et al.<br /> <br /> a<br /> <br /> b<br /> <br /> Hình 3. a. Kết quả điện di kết quả RT-PCR sau 5 ngày biệt hóa: giếng 1. Đối chứng (ADSC chưa<br /> biệt hóa); giếng 2. ADSC biệt hóa sau 5 ngày; giếng 3. Chứng dương (tế bào ung thư gan HepG2);<br /> b. Kết quả phân tích độ sáng của các gen chuyên biệt giữa các lô thí nghiệm bằng phần mềm<br /> ImageJ: 1. ADSCs đối chứng; 2. ADSC biệt hóa ngày 5; 3. HepG2.<br /> a<br /> <br /> b<br /> <br /> Hình 4. a. Kết quả RT-PCR gen albumin và CK18: 1. ADSCs đối chứng; 2. ADSC biệt hóa ngày<br /> 21; 3. HepG2; b. Kết quả phân tích độ sáng của các gen chuyên biệt giữa các lô thí nghiệm bằng<br /> phần mềm ImageJ: 1. ADSCs đối chứng; 2. ADSC biệt hóa ngày 21; 3. HepG2.<br /> So sánh với các kết quả nghiên cứu sự biểu<br /> hiện các gen albumin, CK18 của Schwartz et al.<br /> (2002) [7]; Seo et al. (2005) [8]; Banas et al.<br /> (2007) [1] kết quả mà chúng tôi đạt được cũng<br /> tương tự như các kết quả đã công bố trong các<br /> nghiên cứu của các tác giả trên (hình 4).<br /> 212<br /> <br /> Ngoài ra, chúng tôi còn phân tích thêm sự biểu<br /> hiện của Bcl-2, là gen mã hóa cho protein kháng<br /> apoptosis ở tế bào ung thư gan [9], bên cạnh chức<br /> năng kháng sự tự chết của tế bào (apoptosis), Bcl-2<br /> còn có chức năng kháng stress oxy hóa và biểu hiện<br /> mạnh ở tế bào ung thư hay khi gan bị tổn thương.<br /> <br /> TẠP CHÍ SINH HỌC 2014, 36(1se): 209-215<br /> <br /> a<br /> <br /> b<br /> <br /> Hình 5. (a) Kết quả RT-PCR gen Bcl2 và Gapdh: (1) ADSCs đối chứng; (2) ADSC biệt hóa ngày<br /> 21; (3) HepG2; (b) Kết quả phân tích độ sáng của các gen chuyên biệt giữa các lô thí nghiệm bằng<br /> phần mềm ImageJ: (1) ADSCs đối chứng; (2) ADSC ngày biệt hóa 21; (3) HepG2<br /> <br /> Hình 6. Kết quả nhuộm PAS: tế bào hADSCs P4 (a), tế bào HepG2 (b), tế bào HPC (c)<br /> Kết quả RT-PCR gen Bcl-2 (hình 5a) ở<br /> nhóm đối chứng và nhóm biệt hóa có vạch mờ<br /> như nhau, còn ở lô HepG2 vạch sáng và rõ hơn<br /> có kích thước đúng như dự đoán (101 bp). Kết<br /> quả điện so sánh cường độ sáng của gen sử<br /> dụng phần mềm ImageJ (hình 5b) cho thấy,<br /> cường độ sáng của gen Bcl-2 ở nhóm HepG2<br /> gấp đôi cường độ sáng ở nhóm đối chứng (tế<br /> bào hADSCs không biệt hóa) và lô biệt hóa. Kết<br /> quả này cho thấy quá trình cảm ứng biệt hóa<br /> hADSCs thành tế bào giống tế bào gan bằng<br /> môi trường chứa nhân tố cảm ứng<br /> dexamethasone và ITS không làm cho hADSC<br /> biểu hiện gen ung thư.<br /> Kết quả nhuộm PAS cho thấy, tế bào HPC<br /> có tế bào chất bắt màu hồng với thuốc nhuộm so<br /> với đối chứng hADSCs. Tuy nhiên, cường độ<br /> <br /> màu vẫn còn thấp hơn nhiều so với HepG2, kết<br /> quả này chứng tỏ HPC có khả năng dự trữ<br /> glycogen tương tự như tế bào gan (hình 6).<br /> Trong giai đoạn 1 của quá trình biệt hóa,<br /> chúng tôi sử dụng các nhân tố biệt hóa như<br /> HGF, FGF và nicotinamide. Ở giai đoạn 2,<br /> dexamethasone và ITS được dùng tiếp tục trong<br /> việc cảm ứng biệt hóa và trưởng thành các tế<br /> bào hADSCs thành tế bào giống tế bào gan.<br /> Theo nhiều báo cáo, dexamethasone là một<br /> hormone glucocorticoid tổng hợp, tác động lên<br /> các thụ thể trong tế bào chất, xúc tiến sự tổng<br /> hợp glucose và glycogen ở gan, ức chế sự phát<br /> triển của nguyên bào sợi và các tế bào ung thư<br /> gan. Trong nuôi cấy in vitro, dexamethasone<br /> thường được bổ sung vào môi trường nuôi để<br /> làm tăng khả năng sống sót và chức năng của tế<br /> 213<br /> <br />

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản