intTypePromotion=3

Nghiên cứu trình tự một số gen độc lực của yersinia pestis và phát triển kỹ thuật multiplex PCR xác định Yersinia pestis gây bệnh ở Việt Nam

Chia sẻ: Nguyễn Triềuu | Ngày: | Loại File: PDF | Số trang:11

0
15
lượt xem
0
download

Nghiên cứu trình tự một số gen độc lực của yersinia pestis và phát triển kỹ thuật multiplex PCR xác định Yersinia pestis gây bệnh ở Việt Nam

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Mục tiêu nghiên cứu của bài viết nhằm xác định trình tự đầy đủ gen ypo2088 (trên nhiễm sắc thể [NST]), pla, caf1 (trên hai plasmid độc lực là pPCP1 và pMT1) của chủng vi khuẩn (VK) Yersinia pestis Yp1 phân lập ở Việt Nam và phát triển kỹ thuật PCR đa mồi xác định nhanh, chính xác Y. pestis gây bệnh. Nghiên cứu đã góp phần làm phong phú thêm những kết quả về đa dạng di truyền các gen độc lực của VK dịch hạch cũng như cung cấp công cụ phân tử hữu hiệu cho phép chẩn đoán nhanh và chính xác Y. pestis có độc lực.

Chủ đề:
Lưu

Nội dung Text: Nghiên cứu trình tự một số gen độc lực của yersinia pestis và phát triển kỹ thuật multiplex PCR xác định Yersinia pestis gây bệnh ở Việt Nam

TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015<br /> <br /> NGHIÊN CỨU TRÌNH TỰ MỘT SỐ GEN ĐỘC LỰC CỦA<br /> YERSINIA PESTIS VÀ PHÁT TRIỂN KỸ THUẬT MULTIPLEX PCR<br /> XÁC ĐỊNH YERSINIA PESTIS GÂY BỆNH Ở VIỆT NAM<br /> Đinh Thị Thu Hằng*; Nguyễn Thái Sơn**; Nguyễn Văn An**<br /> Cao Thị Dinh***; Triệu Thị Nguyệt***<br /> TÓM TẮT<br /> Mục tiêu: xác định trình tự đầy đủ gen ypo2088 (trên nhiễm sắc thể [NST]), pla, caf1 (trên<br /> hai plasmid độc lực là pPCP1 và pMT1) của chủng vi khuẩn (VK) Yersinia pestis Yp1 phân lập<br /> ở Việt Nam và phát triển kỹ thuật PCR đa mồi xác định nhanh, chính xác Y. pestis gây bệnh.<br /> Vật liệu và phương pháp: chủng Y. pestis Yp1 có đầy đủ độc lực được lưu giữ tại “Ngân hàng<br /> Chủng và Gen” của Học viện Quân y. Toàn bộ chiều dài gen ypo2088, pla và caf1 sau khi<br /> khuếch đại chính xác được tách dòng và phân tích trình tự. Từ kết quả phân tích trình tự kết<br /> hợp với trình tự các chủng tham chiếu trên Ngân hàng Gen, 3 cặp mồi là ypo2088F/R, plaF/R<br /> và caf1F/R đã thiết kế để khuếch đại đồng thời gen đích tương ứng trong phản ứng PCR đa<br /> mồi xác định VK dịch hạch gây bệnh. Kết quả và kết luận: tách dòng và phân tích trình tự đầy<br /> đủ 3 gen là ypo2088, pla và caf1 của chủng VK Y. pestis Yp1 phân lập ở Việt Nam. Xác định<br /> được 1 đột biến sai nghĩa trên gen pla, hai gen còn lại có mức độ tương đồng 100% khi so<br /> sánh với trình tự tham chiếu (mã số CP000900). Kết quả một lần nữa chứng minh, trình tự gen<br /> ypo2088, pla và caf1 rất ổn định, không có sự khác biệt đáng kể giữa các chủng Y. pestis.<br /> Trình tự đầy đủ 3 gen này đã được đăng ký trên Ngân hàng Gen Quốc tế với mã số lần lượt là<br /> KM880027, KM880025 và KM880026. Đã thiết kế thành công phản ứng PCR đa mồi khuếch<br /> đại đồng thời 3 gen đích xác định chính xác VK dịch hạch gây bệnh.<br /> *<br /> <br /> Từ khóa: Caf1 (F1 capsule antigene); Độc lực; PCR đa mồi; Yersinia pestis.<br /> <br /> Study on the Complete Sequences of Virulence Genes of Yersinia<br /> Pestis and Development of a Multiplex PCR Assay for Detection of<br /> Pathogenic Yersinia Pestis in Vietnam<br /> Summary<br /> Objectives: Sequence analysis of the entire ypo2088 gene (within bacterial chromosome),<br /> pla and caf1 genes (on the virulence plasmids pPCP1 and pMT1) of the pathogenic Yersinia<br /> pestis strain Yp1 isolated in Vietnam and development of a multiplex PCR assay for rapid and<br /> accurate detection of pathogenic Y. pestis. Materials and methods: Y. pestis strain Yp1 with full<br /> virulence was provided by Strain and Gene Bank of Vietnam Military Medical University. Total DNA<br /> was extracted from culture media following autoclaved inactivation. Subsequently, full-length ypo2088,<br /> * Học viện Quân y<br /> ** Bệnh viện Quân y 103<br /> *** Đại học Khoa học tự nhiên<br /> Người phản hồi (Corresponding): Đinh Thị Thu Hằng (hangdinhbio@gmail.com)<br /> Ngày nhận bài: 02/03/2015; Ngày phản biện đánh giá bài báo: 16/03/2015<br /> Ngày bài báo được đăng: 31/03/2015<br /> <br /> 57<br /> <br /> TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015<br /> pla and caf1 genes were amplified using high-fidelity PCR. The purified PCR products were<br /> cloned in pJET1.2/blunt by conventional recombinant methods and they were sequenced from<br /> both ends. According to these sequencing results and the reference sequences in Genbank,<br /> three primer pairs, including ypo2088F/R, plaF/R and caf1F/R, were designed in a multiplex PCR<br /> assay for detection of pathogenic Y. pestis. Results and conclusions: One missense mutation<br /> was identified in pla gene, two remaining genes were found to be 100% similar in sequence to<br /> the reference sequences of Y. pestis Angola (accession number KP000900). These results again<br /> demonstrate that ypo2088, pla, caf1 gene sequences are very conservative, with no significant<br /> difference among Y. pestis strains. The complete sequences of these genes were submitted to<br /> Genbank with accession number KM880027, KM880025 and KM880026, respectively. A multiplex<br /> PCR assay that amplifies these three target genes was successfully developed for rapid and<br /> accurate detection of pathogenic Y. pestis.<br /> *<br /> <br /> Key words: Caf1 (capsule fraction 1 gene); Multiplex PCR; pla (plasminogen gene);<br /> Yersinia pestis.<br /> <br /> ĐẶT VẤN ĐỀ<br /> Y. pestis là VK Gram âm, không sinh bào<br /> tử thuộc chi Yersinia - họ Enterobacteriaceae.<br /> Trong 11 loài thuộc chi Yersinia, chỉ có<br /> ba loài gây bệnh ở người là Y. pestis,<br /> Y. pseudotuberculosis và Y. enterocolitica.<br /> Loài nguy hiểm nhất, Y. pestis gây bệnh<br /> dịch hạch và viêm phổi cấp tính phân biệt<br /> với hai loài còn lại [8, 10]. Tiềm năng hủy<br /> diệt của dịch hạch đã được chứng minh<br /> qua thùc tÕ lµ 200 triệu ca tử vong trong<br /> lịch sử, dẫn đầu danh sách các bệnh<br /> truyền nhiễm nguy hiểm. Theo Tổ chức Y<br /> tế Thế giới, từ 1989 đến 2003, thế giới đã<br /> ghi nhận 38.310 ca nhiễm và 2.845 ca tử<br /> vong, tập trung chủ yếu ở châu Phi và<br /> châu Á - nơi thiếu hoặc chưa đáp ứng<br /> đầy đủ của hệ thống giám sát, các cơ sở<br /> chẩn đoán hay báo cáo dịch [5]. Đặc biệt,<br /> những năm gần đây, mối quan tâm đối<br /> với VK dịch hạch được đặt ở mức cao, do<br /> khả năng sử dụng Y. pestis như một loại<br /> vũ khí sinh học [8].<br /> Trên thế giới, toàn bộ hệ gen của<br /> một số chủng chuẩn như Y. pestis KIM5<br /> 58<br /> <br /> (thuộc về biovar Mediaevalis), CO92 (chủng<br /> biovar Orientalis) đã được giải trình tự,<br /> tạo thuận lợi cho nghiên cứu, xác định<br /> Y. pestis [9]. Genome của Y. pestis<br /> (chủng CO92) bao gồm một “NST” 4,65<br /> Mb và ba plasmid lần lượt là pLcr, pPCP1<br /> và pMT1. Ngoài các sản phẩm do hệ gen<br /> trên NST, yếu tố độc lực của Y. pestis là<br /> do gen trên các plasmid này đảm nhiệm.<br /> Trong đó, pPCP1 và pMT1 là 2 plasmid<br /> được xác định chỉ có riêng ở Y. pestis [8].<br /> pPCP1 (kích thước 9,6 kb), có gen quan<br /> trọng là pla mã hóa chất hoạt hóa<br /> plasminogen Pla, đóng vai trò quan trọng<br /> đối với khả năng xâm nhập của Y. pestis<br /> vào cơ thể qua da [4]. Plasmid còn lại<br /> là pMT1 có kích thước tương đối lớn<br /> (110 kb) tiêu biểu với các gen mã hóa<br /> cho kháng nguyên vỏ F1, gen biểu hiện<br /> phospholipase D (PID), cả hai đều có vai<br /> trò trong lây lan dịch hạch [8].<br /> Ở Việt Nam, bệnh dịch hạch còn xuất<br /> hiện rải rác ở khu vực Tây Nguyên như<br /> Gia Lai, ĐắK Lắk [5]. Nghiên cứu về<br /> Y. pestis cũng như bệnh dịch hạch chủ<br /> yếu tập trung về dịch tễ học, thống kê,<br /> <br /> TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015<br /> <br /> giám sát bệnh trên cơ sở các vùng sinh<br /> thái. Những kết quả nghiên cứu về phân<br /> tử VK dịch hạch còn hạn chế và đơn lẻ<br /> trên một số gen đích [1, 5]. Nghiên cứu<br /> này tách dòng và giải trình tự toàn bộ gen<br /> đặc trưng trên NST - ypo2088 và gen độc<br /> lực trên plasmid pPCP1, pMT1 tương<br /> ứng là pla và caf1 của chủng Y. pestis<br /> Yp1 phân lập ở Việt Nam. Đồng thời,<br /> nhóm tác giả đã phát triển kỹ thuật PCR<br /> đa mồi (multiplex PCR - mPCR) sử dụng<br /> 3 gen đích này để xác định chính xác VK<br /> dịch hạch có độc lực trong tự nhiên.<br /> Nghiên cứu đã góp phần làm phong phú<br /> thêm những kết quả về đa dạng di truyền<br /> các gen độc lực của VK dịch hạch cũng<br /> như cung cấp công cụ phân tử hữu hiệu<br /> cho phép chẩn đoán nhanh và chính xác<br /> Y. pestis có độc lực.<br /> VẬT LIỆU VÀ PHƯƠNG PHÁP<br /> NGHIÊN CỨU<br /> 1. Chủng vi khuẩn.<br /> Chủng Y. pestis Yp1 có độc lực và<br /> chủng đối chứng âm E. coli ATCC 25922<br /> do Ngân hàng Chủng và Gen của Học<br /> viện Quân y cung cấp, xác định đặc điểm<br /> <br /> hình thể, tính chất sinh vật hóa học bằng<br /> card định danh GN46 (Vitek 2 - BioMérieux)<br /> và thử nghiệm độc lực trên chuột nhắt<br /> trắng để khảo sát khả năng gây chết<br /> hàng loạt.<br /> 2. Tách chiết ADN và PCR.<br /> Chủng VK được bất hoạt ở điều kiện<br /> 121oC/20 phút, sau đó tách ADN tổng số<br /> theo quy trình của nhà sản xuất (ADN<br /> genome QIAGen minikit). Thiết kế các<br /> cặp mồi tách dòng dựa trên trình tự gen<br /> ypo2088, pla và caf1 trên Ngân hàng Gen<br /> và được tổng hợp bởi IDT (Mỹ). Sử dụng<br /> sinh phẩm Phusion High-Fidelity ADN<br /> polymerase (Thermo scientific) để phân<br /> lập gen đích với chu trình nhiệt, nhiệt độ<br /> gắn mồi TaoC và thời gian kéo dài chuỗi<br /> như sau: biến tính 98oC trong 30 giây,<br /> khuếch đại 30 - 32 chu kỳ (98oC, 8 giây;<br /> TaoC, 20 giây; 72oC, 30 - 35 giây), sau đó<br /> hoàn thành kéo dài chuỗi ở 72º trong<br /> 6 phút. Trong đó, nhiệt độ gắn mồi<br /> Ta oC và thời gian kéo dài chuỗi phụ<br /> thuộc vào trình tự mồi và kích thước<br /> sản phẩm.<br /> <br /> Bảng 1: Thông tin các mồi sử dụng trong nghiên cứu.<br /> TÊN MỒI<br /> <br /> MỤC ĐÍCH<br /> <br /> TRÌNH TỰ (5’-3’)<br /> <br /> NHIỆT ĐỘ GẮN<br /> KÍCH<br /> MỒI (Ta: oC) THƯỚC (bp)<br /> <br /> PCR/giải<br /> trình tự<br /> ypo2088F/BamHI<br /> <br /> PCR<br /> <br /> GGGATCCGTGATGATTAAGTTCATGCT<br /> <br /> 52<br /> <br /> 719<br /> <br /> PCR/giải<br /> trình tự<br /> <br /> CCTCGAGGTCTGTATTGCTGAGAAAAG<br /> <br /> 52<br /> <br /> 719<br /> <br /> plaF/EcoRI<br /> <br /> PCR<br /> <br /> CGAATTCGCAGAGAGATTAAGGGTGT<br /> <br /> 57<br /> <br /> 1019<br /> <br /> plaR/XhoI<br /> <br /> PCR<br /> <br /> ACTCGAGTTCCACAGACATCCTCCC<br /> <br /> 57<br /> <br /> 1019<br /> <br /> caf1F/BamHI<br /> <br /> PCR<br /> <br /> AGGATCCGGACACAAGCCCTCTCTAC<br /> <br /> 60<br /> <br /> 654<br /> <br /> ypo2088R/XhoI<br /> <br /> 59<br /> <br /> TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015<br /> caf1R/XhoI<br /> <br /> PCR<br /> <br /> TCTCGAGCGAGGGTTAGGCTCAAAGT<br /> <br /> 60<br /> <br /> 654<br /> <br /> pJET1.2_F<br /> <br /> Giải trình tự<br /> <br /> CGACTCACTATAGGGAGAGCGGC<br /> <br /> 58<br /> <br /> -<br /> <br /> pJET1.2_R<br /> <br /> Giải trình tự<br /> <br /> AAGAACATCGATTTTCCATGGCAG<br /> <br /> 58<br /> <br /> -<br /> <br /> GGATGAGATAACGCGGGTGT-F<br /> <br /> 56<br /> <br /> 103<br /> <br /> 56<br /> <br /> 438<br /> <br /> 56<br /> <br /> 271<br /> <br /> mPCR<br /> ypoF1/R1<br /> <br /> mPCR<br /> <br /> AGAGAATCGTGATGCCGTCC-R<br /> plaF1/R1<br /> <br /> mPCR<br /> <br /> CGGGATGCTGAGTGGAAAGT-F<br /> ATTACCCGCACTCCTTTCGG-R<br /> <br /> cafF1/R1<br /> <br /> mPCR<br /> <br /> CGCTTACTCTTGGCGGCTAT-F<br /> GCTGCAAGTTTACCGCCTTT-R<br /> <br /> 3. Tách dòng và giải trình tự gen.<br /> <br /> 4. Multiplex PCR.<br /> <br /> Tiến hành nối ghép trực tiếp sản phẩm<br /> <br /> Tham khảo trình tự các gen ypo2088,<br /> <br /> PCR tinh sạch của 3 gen ypo2088, pla<br /> <br /> pla và caf1 của chủng VK dịch hạch trên<br /> <br /> và caf1 với vector tách dòng pJET1.2/blunt<br /> <br /> Ngân hàng Gen kết hợp với kết quả giải<br /> <br /> nhờ T4-ligase (Thermo scientific). Sản<br /> <br /> trình tự trong nghiên cứu này, 3 cặp mồi<br /> <br /> phẩm nối ghép được biến nạp vào tế<br /> <br /> tương ứng với các gen đích trên được<br /> <br /> bào khả biến E. coli DH5 (Invitrogen)<br /> <br /> thiết kế trong phản ứng PCR đa mồi xác<br /> <br /> bằng phương pháp sốc nhiệt. Tiến hành<br /> kiểm tra các thể tái tổ hợp bằng PCR<br /> khuẩn lạc (PCR colony), cắt bằng enzym<br /> hạn chế AvaI và XbaI (Thermo scientific).<br /> Xác đinh trình tự các gen đích theo cả<br /> hai chiều theo phương pháp Sanger<br /> với các mồi trên vector pJET1.2F/R và<br /> mồi khuếch đại (bảng 1). Sử dụng phần<br /> <br /> định Y. pestis có độc lực (bảng 1). Thành<br /> phần mPCR như sau: 1,2X Dream Taq<br /> Buffer; 0,25 mM dNTPs; MgCl2 0,6 mM;<br /> 0,25 μM mồi xuôi, mồi ngược mỗi loại;<br /> Dream Taq 0,8U; ~ 10 ng ADN khuôn,<br /> điều chỉnh H2O đủ thể tích 25 μl. Chu<br /> trình nhiệt: biến tính 94oC/4 phút, tiếp<br /> theo là 30 chu kỳ (94oC/30 giây; 56oC/30<br /> giây; 72oC/30 giây), sau đó hoàn thành<br /> <br /> mềm Bioedit và Genious R7 để xử lý,<br /> <br /> kéo dài chuỗi ở 72º trong 6 phút. Sản<br /> <br /> nối ghép tạo trình tự toàn bộ gen<br /> <br /> phẩm mPCR được điện di kiểm tra trên<br /> <br /> ypo2088, pla, caf1, so sánh và phân tích<br /> <br /> gel agarose 1,5% TBE 0,5X; nhuộm ethidium<br /> <br /> trình tự đã xác định với trình tự trên<br /> <br /> bromide và quan sát bằng hệ thống soi<br /> <br /> Ngân hàng Gen.<br /> <br /> gel Dolphin-DOC.<br /> <br /> 60<br /> <br /> TẠP CHÍ Y - DƯỢC HỌC QUÂN SỰ SỐ 4-2015<br /> <br /> KẾT QUẢ NGHIÊN CỨU VÀ BÀN LUẬN<br /> 1. Tách dòng và giải trình tự toàn bộ gen ypo2088, pla và caf1.<br /> <br /> Hình 1: Kết quả kiểm tra sản phẩm tổng hợp các gen đích bằng Phusion ADN<br /> polymerase trên gel agrose 1,2%.<br /> a) M: Thang ADN chuẩn 100 bp (Thermo Scientific); 1: Sản phẩm tổng hợp gen ypo2088.<br /> b) M: Thang ADN chuẩn 1 kb (Thermo Scientific); 1, 2: Sản phẩm tổng hợp gen pla, caf1.<br /> <br /> ADN tổng số của chủng Y. pestis Yp1<br /> được dùng để phân lập gen ypo2088, pla<br /> và caf1 bằng PCR sử dụng Phusion HighFidelity ADN polymerase với các cặp mồi<br /> tách dòng tương ứng. Điện di kiểm tra<br /> sản phẩm PCR trên gel agarose 1,2%<br /> (hình 1) cho thấy, 3 sản phẩm khuếch đại<br /> rất đặc hiệu, thể hiện bằng các band đậm,<br /> rõ nét, không có band phụ, kích thước<br /> tương đương với tính toán lý thuyết.<br /> Theo như thiết kế, nếu khuếch đại<br /> thành công, các gen này sử dụng cặp mồi<br /> là ypo2088F/R, plaF/R và cafF/R sẽ cho<br /> sản phẩm có kích thước tương ứng là<br /> 645, 1019 và 654 bp, tương đương với<br /> kích thước sản phẩm PCR trên bản gel<br /> điện di. Việc lựa chọn gen đặc trưng<br /> của Y. pestis trên NST là ypo2088 và gen<br /> độc lực pla, caf1 trên plasmid được tham<br /> 61<br /> <br /> khảo từ một số nghiên cứu trên thế giới<br /> [4, 7, 10]. Nhóm nghiên cứu đã phân lập<br /> toàn bộ chiều dài của các gen này để<br /> phân tích trình tự của chủng VK dịch hạch<br /> có độc lực ở Việt Nam nhằm xác định có<br /> sự sai khác nào trong trình tự nucleotid<br /> với các chủng Y. pestis có độc lực trên<br /> thế giới.<br /> Như vậy, từ kết quả điện di kiểm tra<br /> sản phẩm PCR khuếch đại các gen đích<br /> và gen độc lực của Y. pestis như trên có<br /> thể kết luận, bước đầu đã khuếch đại<br /> thành công gen ypo2088, pla và caf1 của<br /> chủng Y. pestis Yp1 phân lập ở Việt Nam.<br /> Sau khi tinh sạch, các sản phẩm PCR<br /> này được gắn vào vector tách dòng<br /> pJET1.2/blunt. Plasmid tái tổ hợp chứa<br /> gen đích mong muốn, kiểm tra bằng PCR<br /> colony và enzym hạn chế AvaI và XbaI<br /> (hình 2).<br /> <br />

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản