intTypePromotion=1

Nhân dòng gen và vùng Promoter Ubiquitin từ cây ngô (Zea Mays L.)

Chia sẻ: Trinhthamhodang Trinhthamhodang | Ngày: | Loại File: PDF | Số trang:8

0
14
lượt xem
0
download

Nhân dòng gen và vùng Promoter Ubiquitin từ cây ngô (Zea Mays L.)

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

nhân dòng gen và vùng promoter ubiquitin từ cây ngô (Ubiquitin là một protein trong tế bào nhân thực và trình tự của nó có tính bảo thủ cao, ubiquitin tham gia vào nhiều quá trình của tế bào như: cân bằng giữa tổng hợp và thoái biến protein, cấu trúc chromatin, điều hành chu kỳ tế bào, sửa chữa DNA và phản ứng với sốc nhiệt và các stress khác. Gen mã hóa cho protein này (gen Ubiquitin) và promoter Ubiquitin đã được nhân dòng và nghiên cứu đánh giá khả năng hoạt động từ nhiều đối tượng như lúa, ngô, lay ơn. Promoter Ubiquitin có vai trò quan trọng trong thể hiện gen ở cây một lá mầm. Trong bài báo này, chúng tôi giới thiệu các kết quả về nhân dòng gen mã hóa cho protein Ubiquitin (gen Ubi) và promoter Ubiqitin từ dòng ngô H240 phục vụ cho nghiên cứu về công nghệ gen ở cây ngô.

Chủ đề:
Lưu

Nội dung Text: Nhân dòng gen và vùng Promoter Ubiquitin từ cây ngô (Zea Mays L.)

TẠP CHÍ SINH HỌC 2013, 35(3se): 114-121<br /> <br /> <br /> <br /> NHÂN DÒNG GEN VÀ VÙNG PROMOTER UBIQUITIN<br /> TỪ CÂY NGÔ (ZEA MAYS L.)<br /> <br /> Nguyễn Đức Thành*, Lê Hoàng Đức<br /> Viện Công nghệ sinh học, Viện Hàn lâm KH & CN Việt Nam, *nguyenducthanh_pcg@ibt.ac.vn<br /> <br /> TÓM TẮT: Ubiquitin là một protein trong tế bào nhân thực và trình tự của nó có tính bảo thủ cao,<br /> ubiquitin tham gia vào nhiều quá trình của tế bào như: cân bằng giữa tổng hợp và thoái biến protein, cấu<br /> trúc chromatin, điều hành chu kỳ tế bào, sửa chữa DNA và phản ứng với sốc nhiệt và các stress khác. Gen<br /> mã hóa cho protein này (gen Ubiquitin) và promoter Ubiquitin đã được nhân dòng và nghiên cứu đánh giá<br /> khả năng hoạt động từ nhiều đối tượng như lúa, ngô, lay ơn. Promoter Ubiquitin có vai trò quan trọng<br /> trong thể hiện gen ở cây một lá mầm. Trong bài báo này, chúng tôi giới thiệu các kết quả về nhân dòng<br /> gen mã hóa cho protein Ubiquitin (gen Ubi) và promoter Ubiqitin từ dòng ngô H240 phục vụ cho nghiên<br /> cứu về công nghệ gen ở cây ngô. Các kết quả nhận được cho thấy các vùng như: vùng promoter, vùng<br /> phiên mã và hộp TATA của gen Ubi nhân dòng được từ dòng ngô H240 có độ tương đồng cao so với các<br /> chuỗi gen tương đồng cùng loài trong gemone thực vật. Gen Ubi đã được đăng ký trên Ngân hàng Gen<br /> quốc tế với mã số JX947345.1. Kết quả nhận được trong nghiên cứu này sẽ góp phần đáng kể trong việc<br /> nghiên cứu và sử dụng promoter Ubiquitin trong chuyển gen ở các cây một lá mầm nói chung và cây ngô<br /> nói riêng.<br /> Từ khóa: Cây ngô, gen Ubiquitin, hộp TATA, mức độ tương đồng, promoter, vùng phiên mã.<br /> <br /> MỞ ĐẦU nhiều đối tượng như lúa, ngô, lay ơn [1, 3, 6].<br /> Ubiquitin là một protein trong tế bào nhân Các nghiên cứu đã cho thấy khả năng hoạt động<br /> thực và trình tự của nó có tính bảo thủ cao, của promoter này cao gấp mười lần hoạt động<br /> ubiquitin tham gia vào nhiều quá trình của tế của promoter CaMV35S khi điều khiển biểu<br /> bào như: cân bằng giữa tổng hợp và thoái biến hiện gen ngoại lai trên cây một lá mầm. Hoạt<br /> protein, cấu trúc chromatin, điều hành chu kỳ tế tính của promoter Ubiquitin trong lúa chuyển<br /> bào, sửa chữa DNA và phản ứng với sốc nhiệt gen bằng các phương pháp chuyển qua tế bào<br /> và các stress khác. Promoter là vùng trình tự trần và mô sẹo thông qua đánh giá mức độ biểu<br /> nucleotide trong genome nằm ngược dòng về hiện của các gen chỉ thị và chọn lọc cho thấy<br /> phía đầu 5’ của vị trí khởi đầu phiên mã gen promoter này biểu hiện mạnh nhưng không phải<br /> (transcription start site-TSS). Promoter là thành ở tất cả các mô cũng như tất cả các giai đoạn<br /> phần quan trọng trong cấu trúc của tất cả các phát triển của cây lúa [2]. Nhìn chung, promoter<br /> gen, khởi đầu cho sự phiên mã, đóng vai trò Ubiquitin có hoạt tính mạnh trong các mô non<br /> then chốt trong việc biểu hiện gen. Theo khả có hoạt động trao đổi chất mạnh và ở hạt phấn<br /> năng biểu hiện, promoter được chia làm hai loại hoa [9].<br /> chính: promoter không đặc hiệu hay còn gọi là Trong bài báo này, chúng tôi giới thiệu các<br /> promoter cơ định và promoter đặc hiệu bao gồm kết quả về nhân dòng gen mã hóa cho protein<br /> promoter đặc hiệu mô tế bào, đặc hiệu giai đoạn Ubiquitin (gen Ubi) và promoter Ubiquitin từ<br /> phát triển và promoter cảm ứng. Hiện nay, có dòng ngô H240 phục vụ cho nghiên cứu về<br /> rất nhiều promoter hiệu quả được sử dụng rộng công nghệ gen ở cây ngô.<br /> rãi để điều khiển biểu hiện các gen ngoại lai<br /> trong cây trồng biến đổi gen như CaMV35S, VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU<br /> CaMV19S, nopaline synthase (NOS) (promoter Vật liệu<br /> trên các cây hai lá mầm), hay Actin và<br /> Ubiquitin (promoter trên các cây một lá mầm). Vật liệu nghiên cứu được sử dụng là các<br /> mẫu lá của dòng ngô H240 do Viện Nghiên cứu<br /> Promoter Ubiquitin đã được phân lập và ngô cung cấp. Vector tách dòng pBT do Phòng<br /> nghiên cứu đánh giá khả năng hoạt động từ<br /> <br /> <br /> 114<br /> Nguyen Duc Thanh, Le Hoang Duc<br /> <br /> Công nghệ tế bào thực vật, Viện Công nghệ biến nạp vào E. coli của vector tái tổ hợp có gắn<br /> Sinh học cung cấp. gen Ubi với vector pBT được kiểm tra bằng<br /> Phương pháp phản ứng colony PCR sử dụng cặp mồi đặc hiệu<br /> nhân bản Ubi. Đồng thời, các khuẩn lạc làm<br /> Thiết kế cặp mồi nhân gen Ubiquitin (Ubi) khuôn cho phản ứng colony-PCR sẽ được nuôi<br /> và promoter: thông tin về trình tự gen và lắc qua đêm ở 37oC trong 4 ml môi trường LB<br /> promoter Ubiquitin được khai thác trên ngân lỏng bổ sung 100 µg/ml kháng sinh Ampicillin<br /> hàng gen quốc tế thông qua trang Web NCBI. hoặc 50 µg/ml kháng sinh Kanamycin để tách<br /> Dựa trên thông tin về gen polyUbiquitin1 plasmid. Tách DNA plasmid và kiểm tra sự có<br /> (Ubi1) trên ngân hàng gen có mã số mặt của gen Ubi bằng cắt bởi enzyme giới hạn<br /> DQ141598.1 và sử dụng phần mềm Primer 3 BamHI được tiến hành theo như Sambrook et al.<br /> [10] để thiết kế cặp mồi đặc hiệu cho nhân gen (1989) [11]. Trình tự nucleotide của gen Ubi<br /> Ubi. Xác định các vị trí cắt của enzyme giới được xác định bằng máy giải trình tự ABI<br /> hạn, vị trí bám của mồi và xác định các thông số PRISM® 3100 Avant Genetic Analyzer, sử dụng<br /> kỹ thuật của mồi, như: nhiệt độ nóng chảy bộ kit BigDye® Terminator V3.1 Cycle<br /> (Tm), tỷ lệ GC, chiều dài mồi bằng phần mềm Sequencing tại Phòng Thí nghiệm Trọng điểm<br /> NEBcutter V2.0 (New England Biolab INC). về công nghệ gen, Viện Công nghệ sinh học.<br /> Tách chiết DNA genome: DNA genome Thành phần phản ứng PCR đọc trình tự gồm<br /> được tách từ các mẫu lá ngô theo phương pháp mồi, DNA plasmid đã được tinh sạch, BigDye,<br /> CTAB của Saghai Maroof et al. (1994) [12]. đệm tương ứng trong tổng thể tích 15 µl. Chu<br /> trình nhiệt trên máy luân nhiệt GenAmp® PCR<br /> Nhân bản gen Ubi và promoter: Gen Ubi và System 9700 gồm 25 chu kỳ: 96oC: 1 phút,<br /> promoter Ubiquitin được nhân bản từ DNA 96oC: 10 giây, 50oC: 5 giây, 60oC: 4 phút. Sau<br /> genome tách từ lá ngô bằng phản ứng PCR với đó, sản phẩm PCR được tinh sạch và điện di<br /> cặp mồi đặc hiệu được thiết kế. Thành phần trong ống vi mao quản để đọc trình tự. Trình tự<br /> phản ứng bao gồm: đệm 10 x PCR: 2,5 µl; nucleotide nhận được của gen Ubi được so sánh<br /> MgCl2 (25 mM): 1,5 µl; dNTP (1 mM): 1 µl; với trình tự của Ubi1 (DQ141598.1) và một số<br /> mồi xuôi (50 ng/µl): 1 µl; mồi ngược (50 trình tự đã công bố trên Ngân hàng Gen quốc tế<br /> ng/µl): 1 µl, ; Taq DNA polymerase (5 U/µl): 1 bằng phần công cụ BLAST của NCBI.<br /> µl ; DNA (50 ng/ µl): 1 µl và nước cất vô trùng:<br /> 12 µl. Phản ứng PCR được thực hiện trên máy Phân tích promoter: xác định vùng<br /> luôn nhiệt PTC-100 (MJ Research, Inc) với 35 promoter, vùng phiên mã của gen Ubi nhận<br /> chu kỳ: 94oC: 1 phút; 58oC: 1 phút, 72oC: 2 được bằng phần mềm TSSP/ Prediction of<br /> phút; kết thúc phản ứng ở 72oC trong 8 phút. PLANT Promoters, Softberry, Inc. So sánh các<br /> Sản phẩm PCR được kiểm tra bằng điện di trên vị trí của promotor, vùng phiên mã gen Ubi từ<br /> gel agarose 1%. dòng ngô H240 và gen Ubi1 đã công bố<br /> (DQ141598.1) với dữ liệu các chuỗi gen tương<br /> Nhân dòng gen Ubi, propotor Ubiquitin và đồng cùng loài trong gemone thực vật bằng<br /> đọc trình tự: phân đoạn DNA nhân được sau chương trình PromH(W) (Promoter prediction<br /> phản ứng PCR có kích thước tương ứng với using orthologous sequences<br /> kích thước lý thuyết của Ubi1 được tinh sạch (http://linux1.softberry.com/berry.phtml); xác<br /> bằng bộ kit AccuPrep® Gel Purification định vùng kết thúc phiên mã bằng chương trình<br /> (Bioneer) theo hướng dẫn của nhà sản xuất. Sau ARNold-Program Finding terminator<br /> khi tinh sạch phân đoạn này được gắn vào (Gautheret and Lambert, 2001) [4].<br /> vector nhân dòng pBT để tạo vector tái tổ hợp.<br /> Các quá trình tạo vector tái tổ hợp được thực KẾT QUẢ VÀ THẢO LUẬN<br /> hiện theo như mô tả của Sambrook et al. (1989)<br /> [11]. Vector tái tổ hợp chứa gen Ubi sau đó Kết quả thiết kế mồi đặc hiệu<br /> được biến nạp vào chủng vi khuẩn E. coli chủng Dựa trên trình tự gen Ubi1 trên Ngân hàng<br /> DH5α bằng phương pháp sốc nhiệt. Kết quả Gen NCBI với mã số DQ141598.1, bằng phần<br /> <br /> <br /> 115<br /> TẠP CHÍ SINH HỌC 2013, 35(3se): 114-121<br /> <br /> mềm Primer 3 [10], trình tự của cặp mồi đặc trình tự tương ứng là: UbiF2: 5’-TACTGC<br /> hiệu cho nhân bản gen Ubi được thiết kế. Mồi AGGTGCAGCGT GACCCG-3’ và 5’-TAGG<br /> xuôi UbiF có trình tự là 5’- ATCCTGCAGAAGTAACACCAAACAA-3’<br /> TAGTGCAGCGTGACCCG - 3’ và mồi ngược (bảng 1). Mồi xuôi có chiều dài 23 nucletide<br /> UbiR có trình tự là 5’-TATGCAGAAGTAACA nhiệt độ nóng chảy (Tm) là 65,8 oC và tỷ lệ GC<br /> CCAAACAA-3’. Để thuận tiện cho việc nhân là 65.2%, còn mồi ngược có chiều dài 29<br /> dòng trong vector pBT mồi xuôi và mồi ngược nucletide nhiệt độ nóng chảy (Tm) là 59,6 oC và<br /> được gắn thêm trình tự các điểm cắt tương ứng tỷ lệ GC là 41,3%. Cặp mồi sẽ nhân được chuỗi<br /> của các enzyme giới hạn BamHI (GGATCC) nucleotide có chiều dài theo lý thuyết khoảng 2<br /> và PstI (CTGCAG). Kết quả mồi xuôi (UbiF2) kb tương đương với chiều dài của gen<br /> và mồi ngược (UbiR2) để nhân bản gen Ubi có Ubiquitin.<br /> <br /> Bảng 1. Trình tự mồi dùng cho nhân bản promoter Ubiquitin<br /> Tỷ lệ GC Chiều<br /> Tên Trình tự mồi thiết kế nhân bản gen Ubiquitin Tm (oC)<br /> (%) dài<br /> UbiF2 5’ - TACTGCAGGTGCAGCGTGACCCG - 3’ 65,8 65,2 23<br /> 5’- TAGGATCCTGCAGAAGTAACACCAAA 41,3<br /> UbiR2 59,6 29<br /> CAA-3’<br /> <br /> Kết quả nhân bản gen Ubi và promoter Kết quả nhân dòng gen Ubi và promoter<br /> Ubiquitin<br /> Sau khi nhân bản, băng có kích thước tương<br /> Với cặp mồi đặc hiệu được thiết kế, gen Ubi tự độ dài của gen Ubiquitin được tinh sạch và<br /> và promoter Ubiquitin đã được nhân bản từ được gắn vào plasmid pBT và biến nạp vào<br /> DNA genome dòng ngô H240 (hình 1). Kết quả chủng E. coli DH5α. Kết quả điện di sản phẩm<br /> điện di trên hình 1 cho thấy, sản phẩm PCR chỉ PCR khuẩn lạc với cặp mồi đặc hiệu UbiF2 và<br /> có một băng duy nhất có kích thước khoảng 2 UbiR2 được trình bầy trên hình 2.<br /> kb, tương đương với kích thước của gen<br /> Ubiquitin và promoter theo lý thuyết.<br /> <br /> <br /> <br /> <br /> Hình 1. Kết quả điện di sản phẩm PCR nhân Hình 2. Kết quả điện di sản phẩm PCR nhân<br /> bản gen Ubi gen Ubi từ plasmid trong các khuẩn lạc 2, 3<br /> M. DNA marker 1 kb (Biolabs); 1. Đối chứng âm<br /> và 4; M. DNA marker 1 kb (Biolabs); 1. Đối<br /> (phản ứng PCR không có DNA của H240); 2. sản<br /> phẩm PCR nhân bản gen Ubiquitin từ DNA genome chứng âm (phản ứng PCR không có khuẩn lạc);<br /> dòng ngô H240 với cặp mồi UbiF2 và UbiR2 được 2, 3, 4. tương ứng với plasmid từ các dòng<br /> thiết kế. khuẩn lạc 2, 3 và 4.<br /> <br /> <br /> <br /> 116<br /> Nguyen Duc Thanh, Le Hoang Duc<br /> <br /> vào plasmid pBT và nhân dòng trong E. coli<br /> DH5α. Kết quả này cũng được khẳng định bằng<br /> kết quả cắt plasmid pBT có chứa phân đoạn gen<br /> Ubi bằng enzyme BamHI. Sau khi cắt bằng<br /> enzyme này và phân lập các đoạn cắt trên gel<br /> agorose 1%, trên ảnh điện di có thể nhìn rõ hai<br /> băng : băng 3 kb tương ứng với độ dài của<br /> plasmid pBT và băng 2 kb tương ứng với độ dài<br /> của gen Ubi (hình 3).<br /> Kết quả so sánh trình tự và phân tích<br /> promoter Ubiquitin<br /> Hình 3. Kết quả cắt kiểm tra phân đoạn gen Ubi Kết quả so sánh trình tự phân đoạn đoạn gen<br /> từ dòng ngô H240 trong plasmid pBT. M: DNA Ubi mang promoter Ubiquitin từ dòng ngô<br /> marker 1 kb (Biolabs); 2 , 3, 4: tương ứng với H240 với trình tự gen trên Ngân hàng Gen<br /> plasmid từ các dòng khuẩn lạc 2, 3, và 4 được NCBI và trình tự Ubi1 có mã số DQ141598.1<br /> cắt bằng enzyme BamHI (Zea mays cultivar Nongda 105 polyUbiquitin-1<br /> (Ubi-1) gene, promoter region and 5' UTR)<br /> Như vậy là phân đoạn gen Ubi đã được gắn được trình bày ở bảng 2.<br /> <br /> Bảng 2. Kết quả so sánh mức độ tương đồng trình tự gen Ubi mang promoter Ubiquitin tách từ<br /> dòng ngô H240 và gen Ubi1 với vùng promoter đã công bố với mã số DQ141598.1<br /> Mã số Ngân Mức độ so Giá trị Mức độ tương<br /> Tên gen<br /> hàng gen sánh E đồng<br /> DQ141598.1 Gen polyUbiquitin-1 (Ubi-1) từ 99% 0,0 94%<br /> dòng ngô Nongda 105 Zea<br /> mays, vùng promoter và không<br /> phiên mã đầu 5'<br /> <br /> Bảng 3. Kết quả so sánh trình tự gen Ubi mang promoter Ubiquitin từ dòng ngô H240 với một số<br /> trình tự trên Ngân hàng Gen quốc tế khác<br /> Mức Giá Mức độ<br /> Mã số Tên gen, vector độ so trị tương Tác giả<br /> sánh E đồng<br /> AB201314.1 Cloning vector pSB4U DNA, 99% 0.0 93% Kuraya et al.<br /> complete sequence (2004) [7]<br /> FJ750577.1 Cre-lox Univector acceptor vector 99% 0.0 93% Jia et al.<br /> pCR701 complete sequence (2009) [5]<br /> AY452753.1 Reporter vector pUbiGUSPlus; 99% 0.0 93% Vickers et al.<br /> pUbiSXR, complete sequence (2003) [15]<br /> S94464.1 polyUbiquitin [maize, Genomic, 3841 99% 0.0 93% Christensen et<br /> nt] al. (1992) [1]<br /> U29159.1 Zea mays clone MubG1 Ubiquitin 99% 0.0 93% Liu et al.<br /> gene, complete cds (1995) [8]<br /> AY342393.1 Zea diploperennis polyUbiquitin-1 98% 0.0 94% Streatfield et<br /> (Ubi-1) gene, promoter region and 5' al. (2003)<br /> UTR [13]<br /> <br /> <br /> <br /> <br /> 117<br /> TẠP CHÍ SINH HỌC 2013, 35(3se): 114-121<br /> <br /> Kết quả trên bảng 2 cho thấy, mức độ Qua bảng 3 có thể thấy, trình tự của gen<br /> nucleotide tương đồng giữa gen Ubi tách Ubi nhân dòng được có độ tương đồng cao với<br /> từ dòng ngô H240 nhân dòng được với trình tự trình tự một số gen và vector mang promoter<br /> gen polyUbiquitin-1 (Ubi-1) từ dòng ngô Ubiquitin đã công bố, đặc biệt là trình tự gen<br /> Nongda 105 Zea mays, vùng promoter và vùng Ubiquitin trong các dòng ngô chuyển gen. Như<br /> không phiên mã đầu 5' (DQ141598.1) là 94%. vậy, có thể khẳng định gen Ubi nhân dòng được<br /> Ngoài ra, chúng tôi còn tiến hành so sánh với có độ tin cậy cao. Gen Ubi từ dòng ngô H240 đã<br /> các trình tự nucleotide khác trên Ngân hàng Gen được đăng ký trên Ngân hang Gen quốc tế<br /> quốc tế và thu được các kết quả thể hiện trong NCBI với mã số JX947345.1 (Zea mays<br /> bảng 3. ubiquitin 1 (Ubi) gene, promoter region).<br /> <br /> >gi_410109644_gb_JX947345.1_ Zea mays ubiquitin 1 _Ubi_ gene, promoter<br /> region<br /> TACTGCAGGTGCAGCGTGACCCGGTCGTGCCCCTCTCTAGAGCTCTAGAGTAGAGCATTG 60<br /> CATGTCTAAGTTATAAAAAATTACCACATATTTTTTTTGTACACTTGTGTTTGAAGTGCA 120<br /> GTTTATCTATCTCTATACATATATTTAAACTTCACTATATGAATAATATAGTCTATAGTA 180<br /> TTAAAATAATATCAATGTTTTAGATGATTATATAACTGAGCTGCTAGACATGGTCTAAAG 240<br /> GACAACCGAGTATTTTGACAACATGACTCTACAGTTTTATCTTTTTAGTGTGCGTGTGTT 300<br /> CTTTTTACTTTTGCAAATAGCTTCACCTATATAATACTTCATCCATTTTATTAGTACATC 360<br /> CATTTACTAAATTTTTAGTACATCTATTTTATTCTATTTTAGCCTCTAAATTAAGAAAAC 420<br /> TTAAACTCTATTTTAGTTTTTTATTTAATAATTTAGATATAAAATAGAATAAAATAAAGT 480<br /> GACTAAAAAATAACTAAATACCTTTTTAAGAAATAAAAAAACTAAGGAACCATTTTTCTT 540<br /> GTTCCGAGTAGATAATGACAGCCTGTTCAACGCCGTCGACGAGTCTAACCGGAACACCCC 600<br /> ATCAGCGAACCCAGGCAGCGTCGCGTCCGGTTCAAGCGAAGCAGAACGCCACGGGCATCT 660<br /> TCTGTAGCTGCCCTTTCTGGACCCCCTCTCTCCGAGAGAAGGTTTCCGCTCCCACCGTTG 720<br /> GACTTGCTCCCGCTGTTCGGCATCCCAGAAAATTGCGTGGGCGGGAGCGGCAGACGTGAG 780<br /> CCGGCACGGGCAGGCGGCCTTCCTTCTCACGGCACCGGCAGCTACGGGGGATTCCCTTTC 840<br /> CCACCGCTCCTTTCGCTTTTCCTTCCTCGCCCGCCGTAATAAATAGACACCCCCCCTCCC 900<br /> Hộp TATA<br /> ACACCCTCTTTCCCCCAACCTCGTGTTGTTCGGAGCGCACACACACACAACCAGATCTCC 960<br /> CCCCAAACCCACCCGTCGGCACCTCCCGCTTCAAGGTACGCCGCTCGTCCTCCCCCCCCC 1020<br /> CCCCTCTCTCTACCTTCTCTAGATCGGCGTTCCGGTCCATGGTTAGGGCCCCGGTAGTTC 1080<br /> TACTTCTGTTCATGTTTGTGTTAGATCCGTGTTTGTGTTAGATCCGTGCTGCTAGCGTTC 1140<br /> GTACACGGATGCGACCTGTACGTCAGACACGTTCTGATTGCTAACTTGCCAGTGTTTCTC 1200<br /> TTTGGGGAATCCTGGGATGGCTCTAGCCGTTCCGCAGACGGGATCGATTTCATGATTTTT 1260<br /> TTTGTTTCGTTGCATAGGGTTTGGTTTGCCCTTTTCCTTTATTTCAATATATGCCGTGCA 1320<br /> Chuỗi kết thúc<br /> CTTGTTTGTCGGGTCATCTTTTCATGCTTTTTTTTGTCTTGGTTGTGATGATGTGGTCTG 1380<br /> GTTGGGCGGTCGTTCTAGATCGGAGTAGAATTCTGTTTCAAACTACCTGGTGGATTTATT 1440<br /> AATTTTGGATCTGTATGTGTGTGCCATACATATTCATAGTTACGAATTGAAGATGATGGA 1500<br /> TGGAAATATCGATCTAGGATAGGTATACATGTTGATGCGGGTTTTACTGGTGCATATACA 1560<br /> GAGATGCTTTTTGTTCGCTTGGTTGTGATGATGTGGTGTGGTTGGGCGGTCGTTCATTCG 1620<br /> TTCTAGATCGGAGTAGAATACTGTTTCAAACTACCTGGTGTATTTATTAATTTTGGAACT 1680<br /> GTATGTGTGTGTCATACATCTTCATAGTTACGAGTTTAAGATGGATGGAAATATCGATCT 1740<br /> AGGATAGGTATACATGTTGATGTGGGTTTTACTGATGCATATACATGATGGCATATGCAG 1800<br /> CATCTATTCATATGCTCTAACCTTGAGTACCTATCTATTATAATAAACAAGTATGTTTTA 1860<br /> TAATTATTTTGATCTTGATATACTTGGATGATGGCATATGCAGCAGCTATATGTGGATTT 1920<br /> TTTTAGCCCTGCCTTCATACGCTATTTATTTGCTTGGTACTGTTTCTTTGTCCGATGCTC 1980<br /> ATCCTGTTGTTTGGTGTTACTTCTGCAGGATCCTA 2040<br /> <br /> Hình 4. Vị trí promoter, hộp TATA và chuỗi kết thúc của gen Ubi từ dòng ngô H240<br /> <br /> <br /> <br /> 118<br /> Nguyen Duc Thanh, Le Hoang Duc<br /> <br /> Sử dụng phần mềm chuyên dụng dự đoán 1291 (bảng 4 và hình 4).<br /> chức năng (vùng promoter, vùng phiên mã,<br /> chuỗi kết thúc) và so sánh với các trình tự trên Kết quả so sánh các vị trí của vùng phiên<br /> ngân hàng gen, chúng tôi đã xác định được một mã gen Ubi của dòng ngô H240 và gen Ubi1 đã<br /> số vùng trình tự đặc biệt như vị trí promoter từ công bố với mã số DQ141598.1 với dữ liệu các<br /> 870 đến 920, hộp TATA nằm ở vị trí từ 877 đến chuỗi gen tương đồng cùng loài trong gemone<br /> 885 bp và chuỗi kết thúc ở vị trí từ 1266 đến thực vật được thể hiện ở bảng 5.<br /> <br /> Bảng 4. Kết quả phân tích vùng promoter Ubiquitin từ dòng ngô H240<br /> Vị trí hộp Vị trí chuỗi<br /> Mã số Tên gen Vị trí promoter<br /> TATA kết thúc<br /> Gen Ubiquitin 1 (Ubi)<br /> 870-920 877-885<br /> JX947345.1 từ dòng ngô H240, 1266-1291<br /> vùng promoter<br /> <br /> Bảng 5. Mức độ tương đồng các vùng của gen Ubi từ dòng ngô H240 và gen Ubi1 từ Ngân hàng<br /> Gen (mã số DQ141598.1) so với các chuỗi gen tương đồng cùng loài trong gemone thực vật<br /> Mức độ tương<br /> Mức độ Mức độ Mức độ tương<br /> Mức độ tương đồng trung<br /> tương đồng tương đồng đồng chuỗi<br /> đồng của bình của yếu<br /> Mã số chung trong trong vùng bên phải vùng<br /> vùng hộp tố phiên mã<br /> vùng so phiên mã phiên mã<br /> TATA (PHt) trong vùng so<br /> sánh (PHa) (PHs) (PHss)<br /> sánh (PHr)<br /> JX947345.1<br /> (gen Ubiquitin<br /> 88% 100% 95% 100% 85%<br /> từ dòng ngô<br /> H240<br /> DQ141598.1<br /> (gen Poly<br /> 89% 88% 97% 100% 98%<br /> Ubiquitin1 từ<br /> Ngân hàng Gen)<br /> <br /> Kết quả trong bảng 5 cho thấy mức độ H240 có độ tương đồng cao với các gen<br /> tương đồng của vùng hộp TATA của hai gen so Ubiquitin tách từ các dòng ngô khác đã công bố<br /> với các chuỗi gen tương đồng cùng loài trong trên Ngân hàng Gen quốc tế. Đã xác định được<br /> gemone thực vật là 100%, trong khi mức độ vùng promoter Ubiquitin trên gen. Mức độ<br /> tương đồng trong vùng phiên mã của gen Ubi từ tương đồng về vùng promoter, vùng phiên mã<br /> dòng ngô H240 cao hơn so với gen Ubi1 đã và vùng hộp TATA của gen Ubi nhân dòng<br /> công bố (100% so với 88%) còn mức độ tương được có độ tương đồng cao so với các chuỗi gen<br /> đồng chung trong vùng so sánh là tương đương tương đồng cùng loài trong gemone thực vật.<br /> nhau (88 và 89%). Kết quả nhận được trong nghiên cứu này sẽ góp<br /> phần đáng kể trong việc nghiên cứu và sử dụng<br /> KẾT LUẬN<br /> promoter Ubiquitin trong chuyển gen ở các cây<br /> Từ những kết quả nhân dòng gen và phân một lá mầm nói chung và cây ngô nói riêng.<br /> tích promoter Ubiquitin từ dòng ngô H240 Lời cám ơn: Công trình được thực hiện trong<br /> chúng tôi rút ra kết luận sau: khuôn khổ đề tài “Nghiên cứu tạo dòng ngô bố<br /> Đã nhân dòng thành công gen Ubiquitin với mẹ được tăng cường khả năng tổng hợp tinh bột<br /> mức độ chính xác cao. Gen Ubi từ dòng ngô bằng công nghệ gen” thuộc Chương trình Trọng<br /> <br /> <br /> 119<br /> TẠP CHÍ SINH HỌC 2013, 35(3se): 114-121<br /> <br /> điểm phát triển và ứng dụng Công nghệ Sinh transformation of higher plants mediated by<br /> học trong lĩnh vực Nông nghiệp và phát triển Agrobacterium tumefaciens. Mol. Breed.,<br /> nông thôn đến năm 2020. 14: 309-320.<br /> 8. Liu L., Maillet D. S., Frappier J. R., Walden<br /> TÀI LIỆU THAM KHẢO<br /> D. B., Atkinson B. G. 1995.<br /> 1. Christensen A. H., Sharrock R. A, Quail P. Characterization, chromosomal mapping,<br /> H., 1992. Maize polyubiquitin genes: and expression of different polyubiquitin<br /> structure, thermal perturbation of expression genes in tissues from control and heat-<br /> and transcript splicing, and promoter shocked maize seedlings. Biochem. Cell<br /> activity following transfer to protoplasts by Biol. 73 (1-2): 19-30.<br /> electroporation. Plant Mol. Biol. 18 (4), 9. Rooke L., Byrne D., Salgueiro S. 2000.<br /> 675-689. Marker gene expression driven by the maize<br /> 2. Cornejo M. J., Luth D., Blankenship K. Ubiquitin promoter in transgenic wheat.<br /> M., Anderson O. D., Blechl A. E., 1993. Ann. Appl. Biol., 136: 167-172.<br /> Activity of a maize Ubiquitin promoter in 10. Rozen S., Skaletsky H. J., 2000. Primer3 on<br /> transgenic rice. Plant Mol. Biol., 23(3): 567- the WWW for general users and for<br /> 81. biologist programmers. In: Krawetz S,<br /> 3. Dalton S. J., Heywood E., Timms E. J., Misener S (eds) Bioinformatics Methods<br /> Morris P., 2007. A comparison of maize and Protocols: Methods in Molecular<br /> and rice Ubiquitin promoter activity using Biology. Humana Press, Totowa, NJ, pp<br /> the uidA (Gus) gene in maize: An enhanced 365-386.<br /> rice Ubiquitin promoter increases transgene 11. Sambrook J., Fritsch E.F., Maniatis T.,<br /> expression in maize compared with the 1989. Molecular Cloning: A Laboratory<br /> native maize Ubiquitin promoter. Plant Manual (2nd Edition). Cold Spring Harbor<br /> Transformation Technologies Conference, Laboratory, NY.<br /> Vienna, Austria, 4-7 February 2007.<br /> 12. Saghai Maroof M. A., Biyashev R. M.,<br /> 4. Gautheret D., Lambert A., 2001. Direct Yang G. P., Zhang Q., Allard R. W., 1994,<br /> RNA Motif Definition and Identification Extraordinarily polymorphic microsatellite<br /> from Multiple Sequence Alignments using DNA in barley: species diversity,<br /> Secondary Structure Profiles. J. Mol. Biol. chromosome location, and population<br /> 313:1003-1011. dynamics. Proc. Natl. Acad. Sci. USA., 91:<br /> 5. Jia F., Gampala S. S., Mittal A., Luo Q., 5466-5470.<br /> Rock C. D., 2009. Cre-lox univector 13. Streatfield S. J., Love R.T., 2003. Analysis<br /> acceptor vectors for functional screening in of the maize polyubiquitin-1 promoter heat<br /> protoplasts: analysis of Arabidopsis donor shock elements and generation of promoter<br /> cDNAs encoding Abscisic Acid variants with modified expression<br /> INSENSITIVE1-like protein phosphatases. characteristics. Unpublished<br /> Plant Mol. Biol., 70(6): 693-708.<br /> 14. Toki S., Takamatsu S., Nojiri C., Ooba S.,<br /> 6. Kamo K., Joung Y. H., Green K., 2009. Anzai H., Iwata M., Christensen A. H.,<br /> GUS expression in Gladiolus plants Quail P. H., Uchimiya H., 1992. Expression<br /> controlled by twoDladiolus Ubiquitin of a Maize Ubiquitin Gene Promoter-bar<br /> Promoter. Floricul. Ornam. Biotechnol., Chimeric Gene in Transgenic Rice Plants.<br /> 3(1): 10- 14. Plant Physiol., 100:1503-1507.<br /> 7. Kuraya Y., Ohta S., Fukuda M., Hiei Y., 15. Vickers C. E., Xue G. P., Gresshoff P. M.,<br /> Murai N., Hamada K., Ueki J., Imaseki H., 2003. A synthetic xylanase as a novel<br /> Komari T., 2004. Suppresion of transfer of reporter in plants. Plant Cell Rep., 22(2):<br /> T-DNA 'vector backbone' sequences by 135-140.<br /> multiple left border repeats in vectors for<br /> <br /> 120<br /> Nguyen Duc Thanh, Le Hoang Duc<br /> <br /> <br /> <br /> CLONING UBIQUITIN GENE<br /> WITH PROMOTER REGION FROM ZEA MAYS L.<br /> <br /> Nguyen Duc Thanh, Le Hoang Duc<br /> Institute of Biotechnology, VAST<br /> <br /> <br /> SUMMARY<br /> <br /> Ubiquitin is a protein in eukaryote cells and its sequence is highly conserved. The protein has been<br /> involved in many cellular processes, such as protein turnover, chromatin structure, cell cycle control, DNA<br /> repair and response to heat shock and other stresses. The gene codes for this protein (Ubiquitin gene) and its<br /> promoter have been cloned. The function of the gene and its promoter from many plants like rice, maize and<br /> gladiolus plants has been studied. Ubiquitin promoter plays an important role in gene expression in monocot.<br /> In this article, we present the results on cloning the gene coding for Ubiquitin protein (Ubi gene) and its<br /> promoter from maize line H240 for genetic engineering studies in maize. The data obtained showed that the<br /> promoter region, transcription region and TATA box region of cloned Ubi gene from maize line H240 have<br /> high level of homology comparing to orthologous sequenes in plant genome. The cloned Ubi gene was<br /> submited to the GenBank with assession number JX947345.1. The results of this study will, considerablely,<br /> contribute to the study and application of Ubiquitin promoter in gene transfer of monocot, in general, and<br /> maize, in particular.<br /> Keywords: Zea mays, homology, maize plant, promoter, TATA box, transcription region, Ubiquitin gene.<br /> <br /> Ngày nhận bài: 24-5-2013<br /> <br /> <br /> <br /> <br /> 121<br />
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2