intTypePromotion=1
ADSENSE

Sự hiện diện của bệnh đốm trắng, hoại tử gan tụy cấp và vi bào tử trùng trên tôm giống và tôm nuôi nước lợ ở đồng bằng sông Cửu Long

Chia sẻ: _ _ | Ngày: | Loại File: PDF | Số trang:14

7
lượt xem
0
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Nghiên cứu được thực hiện trên 600 mẫu tôm giống thu tại các tỉnh Ninh Thuận, Bình Thuận, Vũng Tàu, Bạc Liêu và 120 mẫu tôm nuôi nuớc lợ được thu tại các tỉnh Bạc Liêu, Bến Tre, Sóc Trăng, Trà Vinh và Cà Mau từ tháng 1 đến tháng 10 năm 2020 để kiểm tra các mầm bệnh nguy hiểm gồm WSSV, Vibrio parahaemolyticus và EHP bằng phương pháp PCR.

Chủ đề:
Lưu

Nội dung Text: Sự hiện diện của bệnh đốm trắng, hoại tử gan tụy cấp và vi bào tử trùng trên tôm giống và tôm nuôi nước lợ ở đồng bằng sông Cửu Long

  1. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II SỰ HIỆN DIỆN CỦA BỆNH ĐỐM TRẮNG, HOẠI TỬ GAN TỤY CẤP VÀ VI BÀO TỬ TRÙNG TRÊN TÔM GIỐNG VÀ TÔM NUÔI NƯỚC LỢ Ở ĐỒNG BẰNG SÔNG CỬU LONG Lê Hồng Phước1*, Nguyễn Hồng Lộc1 TÓM TẮT Nghiên cứu được thực hiện trên 600 mẫu tôm giống thu tại các tỉnh Ninh Thuận, Bình Thuận, Vũng Tàu, Bạc Liêu và 120 mẫu tôm nuôi nuớc lợ được thu tại các tỉnh Bạc Liêu, Bến Tre, Sóc Trăng, Trà Vinh và Cà Mau từ tháng 1 đến tháng 10 năm 2020 để kiểm tra các mầm bệnh nguy hiểm gồm WSSV, Vibrio parahaemolyticus và EHP bằng phương pháp PCR. Trên tôm giống tỷ lệ nhiễm WSSV, Vibrio parahaemolyticus gây AHPND và EHP lần lượt là 2,0; 3,6 và 4,8% trong mùa khô và 1,4; 2,6 và 7,2% trong mùa mưa. Đối với tôm nuôi thương phẩm, tỷ lệ nhiễm các mầm bệnh này là 13,5; 21,2 và 23,1% trong mùa khô và 17,7; 11,8 và 25,0% trong mùa mưa. Tỷ lệ nhiễm Vibrio parahaemolyticus trên tôm giống trong năm 2020 là 3,0%, thấp hơn so với năm 2019 (4,0%). Tương tự Vibrio parahaemolyticus, tỷ lệ nhiễm WSSV trên tôm giống trong năm 2020 thấp hơn năm 2019 (1,67% trong năm 2020 so với 1,88% trong năm 2019). Tỷ lệ nhiễm EHP trên tôm giống năm 2020 cũng thấp hơn so với năm 2019 (6,5% trong năm 2020 so với 7,88% trong năm 2019). Từ khóa: WSSV, Vibrio parahaemolyticus, EHP, tôm. I. ĐẶT VẤN ĐỀ tạo ao kỹ, quản lý chất lượng nước, sử dụng chế Từ năm 2010, người nuôi tôm ở Việt Nam phẩm vi sinh và tăng sức đề kháng. Đáng kể gặp phải dịch bệnh hoại tử gan tụy cấp tính nhất là việc sử dụng kháng sinh trộn vào thức ăn (Acute Hepatopancreatic Necrosis Disease- để phòng trị bệnh nhưng không theo hướng dẫn AHPND) gây chết hàng loạt tôm nuôi thương cụ thể hay tuân thủ theo các quy định. Chính vì phẩm. Đến tháng 05/2013 tác nhân gây bệnh vậy hiệu quả mang lại chưa ổn định và dễ dẫn hoại tử gan tụy cấp tính được xác định là Vibrio đến các hậu quả nghiêm trọng như kháng kháng parahaemolyticus. Bệnh hoại tử gan tụy cấp sinh hay dư lượng. tính đã gây thiệt hại nghiêm trọng trong nuôi Bệnh đốm trắng được phát hiện và gây thiệt tôm ở một số quốc gia, với tổn thất toàn cầu lại lớn trên tôm nuôi ở Trung Quốc năm 1992 trên 1 tỷ USD mỗi năm. Bệnh thường xảy ra sau đó lây lan sang các Nam Mỹ và Châu Á. khoảng 8 ngày sau khi thả nuôi, bệnh phát triển Từ năm 1995 đến nay hầu như năm nào bệnh một cách nhanh chóng và gây chết nghiêm trọng đốm trắng cũng có xuất hiện trên tôm nuôi ở trong vòng 20-30 ngày sau khi thả nuôi (Han nước ta. Mặc dù đã có rất nhiều nghiên cứu tìm và ctv., 2015). Dấu hiệu lâm sàng của tôm bệnh giải pháp phòng bệnh đốm trắng nhưng hiện nay như bao ruột rỗng hoặc bị đứt đoạn, mềm vỏ, vẫn chưa có một giải pháp cụ thể cho bệnh này gan tụy nhạt màu, sưng hoặc teo nhỏ, có nhiều ngoài các biện pháp tổng hợp như an toàn sinh điểm đen. Các giải pháp tổng hợp được áp dụng học, chọn con giống tốt và tăng sức đề kháng để phòng trị bệnh bao gồm con giống tốt, cải cho tôm nuôi. 1 Viện Nghiện cứu Nuôi trồng Thủy sản II * Email: lehongphuoc@yahoo.com 74 TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020
  2. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II Năm 2009, lần đầu tiên trên tôm sú nuôi ở thiệt hại là hơn 204.000 ha (Cục Thú Y, 2020). Thái Lan phát hiện vi bào tử trùng mới có tên Xuất phát từ thực tế trên, chúng tôi thực là EHP (Enterocytozoon hepatopenaei) nhưng hiện nghiên cứu “Sự hiện diện bệnh đốm trắng, chưa được người nuôi chú ý. Cho đến năm 2011 hoại tử gan tụy cấp và vi bào tử trùng trên tôm bệnh do loài vi bào tử trùng này trở nên nghiêm giống và tôm nuôi nước lợ ở ĐBSCL” với mục trọng hơn ở những trang trại nuôi trên 5 năm và tiêu: Đánh giá tình trạng nhiễm các mầm bệnh gần biển (Panakorn, 2012). EHP gây ảnh hưởng nguy hiểm này trên tôm giống và tôm nuôi ở lên hệ thống gan tụy của tôm và có hình thái ĐBSCL làm cơ sở cho việc cảnh báo cũng như giống với loài vi bào tử trùng chưa được đặt đề ra giải pháp phòng và quản lý. tên microsporian trong nghiên cứu nhiễm trên II. VẬT LIỆU VÀ PHƯƠNG PHÁP tôm Penaeus japonicas ở Úc năm 2001 (Tourtip 2.1. Vật liệu và ctv., 2009). Ở Việt Nam, bệnh do EHP cũng Tổng cộng 600 mẫu tôm sú và tôm thẻ chân được tìm thấy trong những năm gần đây trên trắng giống được thu tại các tỉnh Ninh Thuận, cả tôm sú và tôm thẻ chân trắng. Hiện nay, tình Bình Thuận, Vũng Tàu và Bạc Liêu (Bảng 1) và hình nhiễm EHP trên tôm nước lợ đang có chiều 120 mẫu tôm sú và tôm thẻ chân trắng thương hướng gia tăng. Đây là bệnh không gây chết phẩm được thu tại các tỉnh Bạc Liêu, Bến Tre, hàng loạt như bệnh đốm trắng, hoại tử gan tụy Trà Vinh, Cà Mau và Sóc Trăng (Bảng 2). Đối cấp nhưng có ảnh hưởng đáng kể đến sản lượng với mẫu tôm giống thu nguyên con cố định thu hoạch vì mức độ chậm lớn và tiêu tốn nhiều trong cồn 90o, mẫu tôm thương phẩm được thu thức ăn (tôm nuôi 90-100 ngày tuổi vẫn có thể từ các ao nuôi, thu nguyên con đối với tôm < chỉ đạt kích cỡ 4-5 g/con). 1g và thu phần đầu đối với tôm > 1g cố định Trong những năm gần đây cùng với biến trong cồn 90o. Ngoài ra còn có kết quả nghiên đổi khí hậu là dịch bệnh hàng năm đã làm ảnh cứu trong năm 2018, 2019 từ nhiệm vụ thường hưởng đáng kể đến sản lượng và gây thiệt hại lớn xuyên do Viện Nghiên cứu Nuôi trồng Thủy sản cho người nuôi tôm. Các tháng đầu năm 2020 II thực hiện trong năm 2018 và 2019 được cùng người nuôi tiếp tục gặp khó khăn về xâm nhập nhóm nghiên cứu thực hiện với cùng phương mặn làm ảnh hưởng đến mùa vụ thả nuôi không pháp thu và phân tích mẫu (Lê Hồng Phước và theo kế hoạch ban đầu. Tính đến 10 tháng đầu ctv., 2019). năm 2020, tổng diện tích nuôi tôm bị thiệt hại Các hóa chất chính: DNA Taq polymerase là 39.536,69 ha trong đó thiệt hại trên mô hình (Promega, Mỹ), dNTP (Promega, Mỹ) các thâm canh và bán thâm canh là 7.616,35 ha, mồi đã được thiết kế và công bố trên các tạp quảng canh, quảng canh cải tiến là 31.392,62 ha chí trên thế giới (IDT, Mỹ) (Bảng 3), Agarose và các mô hình khác là 527,72 ha. Thiệt hại do (Promega, Mỹ), Gel-Red (Invitrogen, Mỹ), bệnh là 5.482,71 ha và không rõ nguyên nhân Sodium hydroxide (Promega, Mỹ), Sodium là 31.275,14 ha. Trong giai đoạn từ 2016 đến dodecyl sulfate (Merk, Đức). tháng 8/2020 tổng diện tích tôm nuôi nước lợ bị TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020 75
  3. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II Bảng 1. Số mẫu tôm giống thu. Tôm sú giống Tôm thẻ giống Tỉnh Mùa khô Mùa mưa Mùa khô Mùa mưa Bình Thuận 10 25 40 30 Ninh Thuận 20 40 60 80 Vũng Tàu 10 25 30 30 Bạc Liêu 20 50 60 70 Tổng 60 140 190 210 Ghi chú: Mùa mưa từ tháng 6-11; mùa khô từ tháng 1-5. Bảng 2. Số mẫu tôm nuôi nước lợ thâm canh thu ở các tỉnh. Tôm sú giống Tôm thẻ giống Tỉnh Mùa khô Mùa mưa Mùa khô Mùa mưa Bạc Liêu 5 6 6 10 Bến Tre 6 6 5 5 Sóc Trăng 6 6 6 10 Trà Vinh 2 4 5 7 Cà Mau 5 4 6 10 Tổng 24 26 28 42 Ghi chú: Mùa mưa từ tháng 6-11; mùa khô từ tháng 1-5. Bảng 3. Trình tự mồi sử dụng trong nghiên cứu. Tác Kích thước Tên mồi Trình tự (5’-3’) Tác giả nhân sản phẩm F1 AGAGCCCGAATAGTGTTTCCTCAGC 1100 bp R1 CAGGCAATATAGCCCGTTTGGG Kiatpathomchai WSSV R2 ATTGCCAATGTGACTAAGCGG 526 bp và ctv., 2001 R3 AACACAGCTAACCTTTATGAG 250 bp VpPirB-392F TGATGAAGTGATGGGTGCTC3 VP 392 bp Han và ctv., 2015 VpPirB-392R TGTAAGCGCCGTTTAACTCA EHP 510F GCCTGAGAGATGGCTCCCACGT EHP 510 bp Tang và ctv., 2015 EHP 510R GCGTACTATCCCCAGAGCCCGA 2.2. Phương pháp nghiên cứu EHP và AHPND). Mẫu được đồng nhất trong 2.2.1. Phương pháp tách chiết DNA tổng 1 ml dung dịch ly trích thô DNA NaOH-SDS số từ mẫu tôm (0,025N – 0,0125%). Sau đó, mẫu được ủ ở DNA tổng số từ mẫu tôm được tách chiết khoảng 94-99°C trong 10 phút và được làm theo phương pháp của Kiatpathomchai và ctv. lạnh nhanh trong nước đá lạnh (khoảng 4-8°C). (2001) với một số thay đổi nhỏ. Lấy 50-100 Tiếp theo, mẫu được ly tâm với tốc độ 13.000 mg mô tôm cho mẫu tôm giống, 50-100 mg mô vòng trong 5 phút. Cuối cùng, 1-2 µl dịch nổi sẽ mang cho mẫu tôm nuôi (chỉ tiêu WSSV), 50 được dùng làm bản mẫu cho các phản ứng PCR. mg-100 mg mô gan cho mẫu tôm nuôi (chỉ tiêu 76 TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020
  4. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II 2.2.1. Phương pháp semi-nested PCR phát 2.2.3. Phương pháp PCR phát hiện EHP hiện WSSV trên tôm (Kiatpathomchai và ctv., trên tôm (Tang và ctv., 2015) 2001) Sử dụng cặp mồi EHP 510 F/EHP 510R Sử dụng 4 mồi F/R1/R2/R3 (Bảng 3). (Bảng 3) để xác định sữ hiện diện của EHP trên Thành phần phản ứng bao gồm: 200 mM dNTP, mẫu tôm thu. Thành phần phản ứng bao gồm: 1,5 mM MgCl2, 0,1 µM mồi F1, 0,2 µM mồi R1, 200 mM dNTP, 1,5 mM MgCl2, 0,1 µM mồi và 0,3 µM mồi R2, 0,5 µM mồi R3, 1,25 unit Taq 0,625 unit Taq polymerase trong tổng thể tích polymerase trong tổng thể tích 50 µl. Với chu 50 µl. Chu trình nhiệt: 94°C/3 phút; 40 chu kỳ: trình nhiệt: 930/5 phút; 5 chu kỳ: 93oC/20 giây, 94°C/30 giây, 60°C/30 giây, 72°C/30 giây; kết 70oC/20 giây, 72oC/20 giây; 20 chu kỳ: 93oC/20 thúc 72oC/5 phút. Sản phẩm PCR sau đó được giây, 55oC/20 giây, 72oC/20 giây, 25 chu kỳ: điện di trên gel agarose 2% và nhuộm với thuốc 93oC/20 giây, 70oC/20 giây, 72oC/20 giây. Sản nhuộm GelRed, kích thước dự kiến là 510 bp. phẩm PCR sau đó được điện di trên gel agarose III. KẾT QUẢ 2% và được nhuộm với thuốc nhuộm GelRed. 3.1. Sự hiện diện của WSSV, V. Nếu mẫu nhiễm vi rút ở mức độ nặng, sản phẩm parahaemolyticus gây AHPND và EHP trên dự kiến có kích thước 1100 bp, 526 bp và 250 tôm giống bp. Nếu mẫu nhiễm vi rút ở mức độ trung bình, 3.1.1. WSSV trên tôm giống sản phẩm dự kiến có kích thước 526 bp và 250 Trong năm 2020 ghi nhận tỷ lệ nhiễm bp. Nếu mẫu nhiễm vi rút ở mức độ nhẹ sản WSSV trên tôm giống sú và thẻ chân trắng là phẩm dự kiến có kích thước 250 bp. 1,67%. Trong mùa khô 2020, có 60 mẫu tôm 2.2.2. Phương pháp PCR xác định V. sú giống và 190 mẫu tôm thẻ giống được kiểm parahaemolyticus gây bệnh AHPND (Han và tra. Ghi nhận có 2 mẫu tôm sú và 3 mẫu tôm ctv., 2015) thẻ nhiễm WSSV (tỷ lệ 3,33% và 1,58%) có Sử dụng cặp mồi VpPirB-392/ VpPirB- nguồn gốc ở Ninh Thuận, Bình Thuận, Vũng 392R (Bảng 3). Thành phần phản ứng bao gồm: Tàu và Bạc Liêu. Trong mùa mưa 2020, trong 0,2 mM dNTP, 1,5 mM MgCl2, 0,5µM mỗi mồi tổng số 140 mẫu tôm sú giống và 210 mẫu tôm và 0,625 unit Taq polymerase trong tổng thể tích thẻ giống được kiểm tra, có 2 mẫu tôm sú giống 50 µl. Chu trình nhiệt: 35 chu kỳ: 93oC/3 phút; nhiễm WSSV (1,43%), trong đó có 1 mẫu ở 94°C/30 giây, 60°C/30 giây, 72°C/30 giây; kết Ninh Thuận và 1 mẫu ở Bạc Liêu. Có 3 mẫu thúc: 72°C/7 phút. Sản phẩm PCR sau đó được tôm thẻ giống nhiễm WSSV (1,43%), các mẫu điện di trên gel agarose 2% và nhuộm với thuốc này có nguồn gốc từ Bạc Liêu và Ninh Thuận, nhuộm GelRed, kích thước dự kiến là 392 bp. kết quả chi tiết được thể hiện trong Bảng 4. Bảng 4. Kết quả kiểm tra virus gây bệnh đốm trắng WSSV trên tôm giống PL (Postlarvae). Tổng số mẫu Số mẫu (+) Tổng số mẫu Số mẫu (+) Loại Tỉnh kiểm tra kiểm tra Mùa khô Mùa mưa Bình Thuận 10 0 25 0 Ninh Thuận 20 1 40 1 PL sú Vũng Tàu 10 1 25 0 Bạc Liêu 20 0 50 1 Tổng 60 2 (3,33%) 140 2 (1,43%) TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020 77
  5. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II Tổng số mẫu Số mẫu (+) Tổng số mẫu Số mẫu (+) Loại Tỉnh kiểm tra kiểm tra Mùa khô Mùa mưa Bình Thuận 40 1 30 0 Ninh Thuận 60 1 80 1 PL thẻ Vũng Tàu 30 0 30 0 Bạc Liêu 60 1 70 2 Tổng 190 3 (1,58%) 210 3 (1,43%) Tổng cộng 250 5 (2,00%) 350 5 (1,43%) 3.1.2. Kết quả kiểm tra V. parahaemolyticus mùa mưa 2020, trong tổng số 140 mẫu tôm sú gây AHPND trên tôm giống giống và 210 mẫu tôm thẻ giống được kiểm Trong mùa khô 2020, có 60 mẫu tôm sú tra, có 5 mẫu (3,57%) tôm sú giống nhiễm vi giống và 190 mẫu tôm thẻ giống được kiểm tra. khuẩn V. parahaemolyticus gây AHPND và 4 Ghi nhận có 3 mẫu tôm sú giống (5,0%) nhiễm mẫu tôm thẻ giống (1,9%) nhiễm vi khuẩn V. V. parahaemolyticus gây AHPND gồm 1 mẫu parahaemolyticus gây AHPND (Bảng 5). Từ ở Ninh Thuận, 1 mẫu ở Bình Thuận và 1 mẫu kết quả kiểm tra mẫu tôm giống cho thấy tỷ lệ ở Bạc Liêu. Đối với tôm thẻ chân trắng có 6 nhiễm V. parahaemolyticus là 3,0% trong đó tỷ mẫu (3,16%) nhiễm V. parahaemolyticus gây lệ nhiễm trong mùa khô là 3,6% và trong mùa AHPND, trong đó có 2 mẫu ở Ninh Thuận, 2 mưa là 2,57%. mẫu ở Vũng Tàu và 2 mẫu ở Bạc Liêu. Trong Bảng 5. Kết quả kiểm tra V. parahaemolyticus gây AHPND trên tôm giống. Tổng số mẫu Số mẫu (+) Tổng số mẫu Số mẫu (+) Loại Tỉnh kiểm tra kiểm tra Mùa khô Mùa mưa Bình Thuận 10 1 25 1 Ninh Thuận 20 1 40 2 PL sú Vũng Tàu 10 0 25 0 Bạc Liêu 20 1 50 2 Tổng 60 3 (5,00%) 140 5 (3,57%) Bình Thuận 40 0 30 0 Ninh Thuận 60 2 80 1 PL thẻ Vũng Tàu 30 2 30 1 Bạc Liêu 60 2 70 2 Tổng 190 6 (3,16%) 210 4 (1,90%) Tổng cộng 250 9 (3,60%) 350 9 (2,57%) 3.1.3. Kết quả kiểm tra vi bào tử trùng với EHP, các mẫu này tập trung ở Ninh Thuận, EHP trên tôm giống Bình Thuận và Bạc Liêu. Đối với tôm thẻ giống Trong mùa khô 2020, kiểm tra 60 mẫu tôm kiểm tra 190 mẫu có 7 mẫu (3,68%) dương tính sú giống ghi nhận 5 mẫu (8,33%) dương tính với EHP. Trong mùa mưa với tổng số 140 mẫu 78 TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020
  6. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II tôm sú giống và 210 mẫu tôm thẻ giống được mùa mưa tỷ lệ nhiễm EHP trên tôm giống là kiểm tra, có 11 mẫu tôm sú (7,86%) và 14 mẫu 7,14%, cao hơn so với mùa khô là 4,8%, kết quả tôm thẻ (6,67%) nhiễm EHP. Như vậy trong chi tiết được thể hiện trong Bảng 6. Bảng 6. Kết quả kiểm tra vi bào tử trùng EHP trên tôm giống. Tổng số mẫu Số mẫu (+) Tổng số mẫu Số mẫu (+) Loại Tỉnh kiểm tra kiểm tra Mùa khô Mùa mưa Bình Thuận 10 1 25 2 Ninh Thuận 20 2 40 2 PL sú Vũng Tàu 10 0 25 1 Bạc Liêu 20 2 50 6 Tổng 60 5 (8,33%) 140 11 (7,86%) Bình Thuận 40 1 30 1 Ninh Thuận 60 3 80 3 PL thẻ Vũng Tàu 30 0 30 2 Bạc Liêu 60 3 70 8 Tổng 190 7 (3,68%) 210 14 (6,67%) Tổng cộng 250 12 (4,80%) 350 25 (7,14%) Các số liệu trong năm 2020 được so sánh năm 2019 (4,0%). Tỷ lệ nhiễm WSSV trong với năm 2018 và 2019 do cùng nhóm tác giả năm 2020 cũng thấp hơn so với năm 2019 (1,67 thực hiện (Lê Hồng Phước & Nguyễn Hồng và 1,88%). Với EHP cũng ghi nhận tương tự, Lộc, 2019). Kết quả so sánh cho thấy tỷ lệ tỷ lệ nhiễm trong năm 2020 là 6,17%, thấp hơn nhiễm V. parahaemolyticus trong năm 2020 là so với năm 2018 (7,75%) và năm 2019 (7,88%) 3,0%, thấp hơn so với năm 2018 (3,63%) và (Hình 1). Hình 1. Tỷ lệ nhiễm các mầm bệnh trên tôm giống trong năm 2018, 2019 & 2020. TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020 79
  7. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II Hình 2. Kết quả điện kiểm tra WSSV bằng phương pháp semi-nested PCR. Giếng 1, 2, 3, 4: mẫu âm tính. Giếng 5: mẫu dương tính. Giếng (-): mẫu chứng âm. Giếng (+): mẫu chứng dương. Giếng M: Thang P-Ladder-01-100 (Phusa Biochem). Hình 3. Kết quả kiểm tra Vibrio parahaemolyticus bằng phương pháp PCR. Giếng 1, 2, 3, 4, 5, 6, 7: mẫu âm tính. Giếng 8, 9: mẫu dương tính. Giếng (-): mẫu chứng âm. Giếng (+): mẫu chứng dương. Giếng M: Thang P-Ladder-01-100 (Phusa Biochem). Hình 4. Kết quả kiểm tra EHP bằng phương pháp PCR. Giếng 2, 3, 6, 7, 8: mẫu âm tính. Giếng 1, 4, 5, 9, 10: mẫu dương tính. Giếng (-): mẫu chứng âm. Giếng (+): mẫu chứng dương. Giếng M: Thang P-Ladder-01-100 (Phusa Biochem). 3.2. Sự hiện diện của WSSV, V. 8) và 12 mẫu nhiễm EHP (23,07%) (Bảng 9). parahaemolyticus gây AHPND và EHP trên Trong mùa mưa 2020 với tổng số 26 mẫu tôm tôm nuôi thương phẩm sú và 52 mẫu tôm thẻ có 12 mẫu nhiễm WSSV Trong mùa khô 2020, có 24 mẫu tôm sú (17,65%), 8 mẫu nhiễm V. parahaemolyticus và 28 mẫu tôm thẻ nuôi được kiểm tra 3 mầm gây AHPND (11,76%) và 17 mẫu nhiễm EHP bệnh nguy hiểm WSSV, V. parahaemolyticus (25,0%). Kết quả kiểm tra cho thấy, tỉ lệ nhiễm gây AHPND và EHP trong đó có 7 mẫu nhiễm WSSV và EHP trong các tháng mùa mưa cao WSSV (13,46%) (Bảng 7), 11 mẫu nhiễm V. hơn các tháng mùa khô. parahaemolyticus gây AHPND (21,15%) (Bảng Bảng 7. Kết quả kiểm tra WSSV trên mẫu tôm nuôi. Tổng số mẫu Số mẫu (+) Tổng số mẫu Số mẫu (+) Loại Tỉnh kiểm tra kiểm tra Mùa khô Mùa mưa Bạc Liêu 5 0 6 1 Bến Tre 6 1 6 0 Sóc Trăng 6 1 6 2 Sú Trà Vinh 2 0 4 2 Cà Mau 5 1 4 0 Tổng 24 3 (12,50%) 26 5 (19,23% 80 TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020
  8. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II Tổng số mẫu Số mẫu (+) Tổng số mẫu Số mẫu (+) Loại Tỉnh kiểm tra kiểm tra Mùa khô Mùa mưa Bạc Liêu 6 1 10 1 Bến Tre 5 0 5 0 Sóc Trăng 6 2 10 3 Thẻ Trà Vinh 5 0 7 1 Cà Mau 6 1 10 2 Tổng 28 4 (14,29%) 42 7 (16,67%) Tổng cộng 52 7 (13,46%) 68 12 (17,65%) Bảng 8. Kết quả kiểm tra V. parahaemolyticus trên mẫu tôm nuôi. Tổng số mẫu Số mẫu (+) Tổng số mẫu Số mẫu (+) Loại Tỉnh kiểm tra kiểm tra Mùa khô Mùa mưa Bạc Liêu 5 0 6 0 Bến Tre 6 2 6 2 Sóc Trăng 6 2 6 1 Sú Trà Vinh 2 1 4 0 Cà Mau 5 1 4 1 Tổng 24 6 (25,0%) 26 4 (15,38% Bạc Liêu 6 2 10 1 Bến Tre 5 1 5 0 Sóc Trăng 6 2 10 1 Thẻ Trà Vinh 5 0 7 1 Cà Mau 6 0 10 1 Tổng 28 5 (17,85%) 42 4 (9,52%) Tổng cộng 52 11 (21,15%) 68 8 (11,76%) Bảng 9. Kết quả kiểm tra vi bào tử trùng EHP trên mẫu tôm nuôi. Tổng số mẫu Số mẫu (+) Tổng số mẫu Số mẫu (+) Loại Tỉnh kiểm tra kiểm tra Mùa khô Mùa mưa Bạc Liêu 5 1 6 1 Bến Tre 6 1 6 2 Sóc Trăng 6 2 6 2 Sú Trà Vinh 2 1 4 1 Cà Mau 5 0 4 1 Tổng 24 5 (20,83%) 26 7 (26,92%) Bạc Liêu 6 2 10 3 Bến Tre 5 1 5 1 Sóc Trăng 6 2 10 2 Thẻ Trà Vinh 5 1 7 2 Cà Mau 6 1 10 2 Tổng 28 7 (25,0%) 42 10 (23,81%) Tổng cộng 52 12 (23,07%) 68 17 (25,00%) TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020 81
  9. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II Đối với bệnh đốm trắng trên tôm nuôi tụy cấp. Tỷ lệ nhiễm bệnh do vi bào tử trùng thương phẩm trong năm 2019 và 2020 cao hơn năm 2019 và 2020 cũng cao hơn so với 2018 so với năm 2018, tương tự cho bệnh hoại tử gan (Hình 5). Hình 5. Tỷ lệ nhiễm các mầm bệnh trên tôm nuôi thương phẩm trong năm 2018, 2019 & 2020. IV. THẢO LUẬN hiện tại các tỉnh, thành phố gồm: Quảng Ninh, Bệnh vi bào tử trùng không gây chết cấp tính Hải Phòng, Nam Định, Hà Tĩnh, Quảng Nam, trên tôm nhưng nó ảnh hưởng lớn đến sản lượng Phú Yên, Khánh Hòa, Ninh Thuận, Bình Thuận, và năng xuất nuôi (Lightner, 1996). Ở châu Long An, Bến Tre, Trà Vinh, Cần Thơ, Bạc Á cũng đã ghi nhận vi bào tử trùng xuất hiện Liêu, Sóc Trăng, Kiên Giang, Cà Mau. Trong trên tôm nuôi ở Malaysia, Thái Lan, Indonesia giai đoạn 2016-2020 bệnh do EHP đã gây thiệt và Việt Nam (Limsuwan, 1997; Flegel và ctv., hại tại một số địa phương do biểu hiện chậm 1992; Flegel., 2012). Gần đây nhất hai ký sinh lớn và có lúc kết hợp với bệnh khác (Cục Thú trùng gây thiệt hại trên tôm được ghi nhận đó Y, 2020). là vì bào tử trùng Entorocytozoon hepatopenaei Hội chứng phân trắng (White Feces (EHP) gây bệnh phân trắng trên tôm sú nuôi Syndrome -WFS) được tìm thấy do nhiều tác ở Việt Nam và bệnh chậm lớn và trắng trên nhân làm tôm chậm lớn, phân đàn, giảm ăn tôm thẻ chân trắng ở Thái Lan. Ký sinh trùng và có trường hợp chết rải rác liên tục. Những Halopsoridian gây chết hàng loạt và chậm lớn biểu hiện này thường được nhận thấy ở các trên tôm thẻ nuôi ở Indonesia (Flegel., 2012). bệnh khác liên quan đến tình trạng gan tụy Bệnh do vi bào tử trùng EHP được phát tôm nuôi như bệnh do EHP, hoại tử gan tụy do hiện tại Việt Nam năm 2014. Ngay sau khi nhận Vibrio parahaemolyticus và bệnh nhiễm giống được thông tin về bệnh do vi bào tử trùng EHP, vi khuẩn Vibrio nói chung gây hoại tử gan tụy Cục Thú Y đã có các báo cáo và hướng dẫn các (Septic Hepatopancreatic Necrosis -SHPN). địa phương chủ động triển khai giám sát thêm Vibrio gây SHPN có thể là tác nhân chính hoặc bệnh do EHP tại một số vùng nuôi tôm trọng tác nhân cơ hội và thường hiện diện chủ yếu điểm từ năm 2015. Đến nay, EHP đã được phát trong gan tụy tôm. Đặc biệt là khi gan tụy tôm bị 82 TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020
  10. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II yếu tố ban đầu làm tổn thương sẽ tạo điều kiện ở tất cả các tháng trong năm nhưng tập trung cho các Vibrio cơ hội gây bệnh và gây SHPN. nhiều vào các tháng có mùa vụ thả nuôi chính. Điều này cũng đã được chứng minh theo nhận Đối với mô hình nuôi thâm canh và bán thâm định của Aranguren và ctv. (2017), EHP được canh có diện tích bị thiệt hại do bệnh đốm trắng xác định là yếu tố làm tăng sự mẫn cảm của tăng từ 2016-2018 sau đó có xu hướng giảm. tôm thẻ chân trắng đối với bệnh gan tụy cấp Cụ thể là năm 2016 có 2.811 ha, năm 2018 có AHPND, SHPN và WFS. Do đó, việc kiểm soát 4.734 ha và 8 tháng đầu năm 2020 có 1.350 ha và phòng tránh loài vi bào tử trùng này trong bị nhiễm bệnh đốm trắng. Đối với mô hình nuôi quá trình nuôi là rất quan trọng. Trước đây có quảng canh và quảng canh cải tiến có diện tích thông tin cho rằng hội chứng phân trắng do nuôi bị thiệt hại do bệnh đốm trắng giảm dần từ nhiều tác nhân trong đó bao gồm Vibrio cholera, năm 2016. Cụ thể là năm 2016 có 1.079 ha và 8 ký sinh trùng Gregarine,  Bacilloplasma  sp., tháng đầu năm 2020 là 549 ha tôm nuôi bị bệnh Phascolarctobacterium sp., các loài tảo độc và đốm trắng (Cục Thú Y, 2020). không thấy liên quan đến EHP. Tuy nhiên theo Nghiên cứu của Rahman và ctv. (2007a, b) nghiên cứu gần đây cho thấy mối liên hệ giữa cho thấy nhiệt độ có liên quan đến sự nhân lên WFS và các tác nhân khác trong đó có vai trò của WSSV. Nhóm tác giả này bố trí thí nghiệm của EHP, SHPN kết hợp với môi trường bất lợi. gây nhiễm tôm với các nghiệm thức khác nhau Kết quả thu mẫu kiểm tra EHP bằng phương và thay đổi nhiệt độ giữa 27 và 33oC. Ở nghiệm pháp PCR trên vùng có WFS và vùng không có thức 27oC liên tục trong thời gian gây nhiễm tôm WFS cho thấy mẫu thu ở vùng có WFS có số với WSSV cho thấy tôm có dấu hiệu đốm trắng lượng vi rút EHP cao hơn vùng không có WFS sau 24 giờ và chết rất sớm sau 36 giờ gây nhiễm, (Aranguren và ctv., 2017). Điều này cho thấy tỷ lệ nhiễm đạt 100% sau 60 giờ gây nhiễm. Ở tôm bệnh phân trắng có nhiều nguy cơ nhiễm nghiệm thức duy trì nhiệt độ nước ổn định ở EHP hơn. 33°C cho tỷ lệ chết rất thấp từ 0-10%. Ở nghiệm Bệnh hoại tử gan tụy cấp được báo cáo lần thức trước gây nhiễm duy trì ở 27oC nhưng sau đầu vào cuối năm 2010 tại tỉnh Sóc Trăng, sau gây nhiễm duy trì ở 33oC cho thấy mức độ chết ở đó dịch bệnh đã lây sang hầu hết các địa phương mức thấp hơn so với nhóm nghiệm thức ổn định nuôi tôm trọng điểm ở ĐBSCL. Trong giai đoạn ở 27oC. Tỷ lệ chết ở nghiệm thức này đạt 100% từ 2016 đến nay, phạm vi xảy ra bệnh giảm dần sau 96 giờ gây nhiễm. Kết quả thí nghiệm này từ 306 xã năm 2016 và 237 xã năm 2018 xuống cho thấy khi tăng nhiệt độ có khả năng ức chế còn 136 xã năm 2020 (Cục Thú Y, 2020). Từ sự nhân lên của WSSV. Điều này khá trùng hợp năm 2016-2020 bệnh hoại tử gan tụy cấp có xu trong thực tế khi nhiệt độ thấp, mưa nhiều thì hướng giảm mạnh về diện tích mắc bệnh từ trên khả năng bùng phát dịch bệnh đốm trắng cũng 3.339 ha xuống 2.143 ha. Bệnh hoại tử gan tụy tăng cao. Một số nghiên cứu trên thế giới như cấp xảy ra trên tất cả mô hình nuôi tôm nước lợ Tendencia và Verreth (2011), Gao và ctv. (2011) nhưng nặng nhất là ở mô hình nuôi thâm canh cho thấy yếu tố độ mặn thấp, hàm lượng Vibrio (Cục Thú Y, 2020). tổng số trong nước ao cao và sự biến động nhiệt Bệnh đốm trắng xuất hiện hầu hết các vùng độ trong ngày lớn là những yếu tố liên quan tới nuôi tôm của cả nước nhưng chủ yếu tập trung sự bùng phát bệnh đốm trắng trên tôm. Ở điều tại các tỉnh thuộc ĐBSCL. Diện tích tôm nuôi kiện nhiệt độ trên 35oC và dưới 15oC sự xuất nước lợ mắc bệnh đốm trắng tăng từ năm 2016- hiện của bệnh đốm trắng giảm rõ rệt và khoảng 2017 sau đó có xu hướng giảm mạnh từ trên nhiệt độ từ 25-28oC là thích hợp nhất cho sự phát 5.873 ha (năm 2018) xuống còn 1.900 ha (8 triển của WSSV. Trong nghiên cứu này cho thấy tháng đầu năm 2020). Bệnh đốm trắng xuất hiện tôm nuôi trong mùa mưa có tỷ lệ nhiễm bệnh TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020 83
  11. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II đốm trắng 17,5% cao hơn so với mùa khô là ở Andhra Pradesh và Tamil Nadu (Ấn Độ) cho 13,4%. Trong phạm vi của nghiên cứu này cho kết quả tỷ lệ nhiễm EHP là 63,5%. Shen và ctv. thấy tỷ lệ nhiễm các mầm bệnh trong năm 2020 (2019) thu mẫu tôm nuôi trong ao đất và trong trên tôm giống thấp hơn so với năm 2018 và nhà màng ở tỉnh Jiangsu –Trung Quốc để kiểm 2019 có thể là do mức độ kiểm soát tôm bố mẹ, tra EHP bằng phương pháp kính hiển vi điện thức ăn cho tôm bố mẹ và an toàn sinh học trong tử, mô bệnh học và PCR. Kết quả cho thấy tỷ trại giống đã từng bước được cải thiện hơn. Đối lệ nhiễm EHP trong nhóm tôm chậm lớn nuôi với tôm nuôi thương phẩm tỷ lệ nhiễm các loại trong nhà màng khá cao (93%). Đối với nhóm mầm bệnh tăng cao có thể do ảnh hưởng ngày tôm nuôi chậm lớn trong ao đất cũng cho tỷ lệ càng tăng của mức độ thâm canh hóa. nhiễm gần bằng với nhóm tôm nuôi trong nhà Tỷ lệ nhiễm EHP trên tôm nuôi trong năm màng (91,3%). Tuy nhiên, tỷ lệ nhiễm EHP trên 2020 ở các tỉnh thuộc ĐBSCL được ghi nhận khá nhóm tôm bình thường nuôi trong nhà màng cao (từ 23-25%) (Lê Hồng Phước và ctv., 2020). chỉ ở mức 10,6% và thấp hơn rất nhiều so với Ở Thái Lan cũng ghi nhận tỷ lệ nhiễm EHP khá nhóm tôm bình thường nhưng nuôi trong ao đất cao (chiếm 60% số mẫu phân tích), bằng chứng (72,4%). đầu tiên cho thấy tỷ lệ nhiễm EHP cao ở tôm thẻ Hiện tượng EHP làm chậm tăng trưởng chân trắng từ một nghiên cứu đoàn hệ về dịch tễ đã được chứng minh khi phân tích mẫu bằng học đối với 196 ao nuôi ở Thái Lan được thực phương pháp Realtime PCR. Định lượng các hiện trong giai đoạn 2013–2014 để xác định các trường hợp nhiễm EHP ở tôm thẻ chân trắng cho yếu tố rủi ro liên quan đến hội chứng chết sớm thấy rằng sự hiện diện của hơn 1×103 copies/1 (EMS) (Sanguanrut và ctv., 2018). Trong một ng gan tụy được tách chiết DNA có tương quan phần của khảo sát này, gan tụy của tôm cũng với sự chậm phát triển của tôm nuôi (Liu và ctv., được kiểm tra EHP bằng phương pháp PCR và 2016; Rajendran và ctv., 2016). Tôm chậm lớn phát hiện 60% số ao dương tính với EHP bất kể được thể hiện ở giảm tăng trọng trong ngày, tôm tình trạng EMS của chúng như thế nào. Kết quả phân nhiều cỡ. Hơn nữa, có thông tin cho rằng này dẫn đến sự thông báo khẩn cấp của NACA nhiễm EHP có thể liên quan đến hội chứng phân về mối đe dọa của EHP đối với ngành nuôi tôm trắng (WFS) ở tôm thẻ chân trắng nuôi (Ha và toàn cầu vào năm 2015. ctv., 2010). Tuy nhiên, một báo cáo sau đó cho Theo Tourtip và ctv. (2009), bệnh do vi bào rằng đây có thể là một liên kết gián tiếp chứ tử trùng ngày càng tăng cao ở các nước Đông không phải trực tiếp (Tangprasittipap và ctv., Nam Á. Hiên nay, EHP ghi nhận là đã xuất hiện 2013). ở Trung Quốc, Indonesia, Malaysia, Việt Nam, V. KẾT LUẬN Thái Lan, Ấn Độ và một số nước ở vùng Nam Đối với tôm giống tỷ lệ nhiễm WSSV, Á. Theo Aranguren và ctv. (2017), EHP được Vibrio parahaemolyticus gây AHPND và EHP xác định là yếu tố làm tăng sự mẫn cảm của tôm trong năm 2020 lần lượt là 1,67; 3,0 và 6,5% thẻ chân trắng đối với bệnh gan tụy cấp AHPND trong đó không có sự khác biệt rõ rệt về tỷ lệ và triệu trứng SHPN (septic hepatopancreatic nhiễm theo mùa. necrosis) bao gồm hội chứng phân trắng và dị Đối với tôm thương phẩm tỷ lệ nhiễm hình gây ra bởi các loài vi khuẩn Vibrio. Do đó, WSSV, V. parahaemolyticus gây AHPND và việc kiểm soát và phòng tránh loài vi bào tử EHP trong năm 2020 lần lượt là 15,83; 15,83 trùng này trong quá trình nuôi là rất quan trọng. và 24,17% trong đó tỷ lệ nhiễm WSSV và EHP Rajendran và ctv. (2016) thu 137 mẫu tôm nuôi trong mùa mưa cao hơn trong khi tỷ lệ nhiễm thương phẩm giai đoạn 84-91 ngày nuôi với AHPND trong mùa mưa lại thấp hơn. trọng lượng 2,5-28,5g từ 3 trang trại nuôi tôm 84 TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020
  12. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II TÀI LIỆU THAM KHẢO disease (AHPND) in shrimps. Aquaculture Tài liệu tiếng việt Reports (2): 17–21. Cục Thú Y, 2020. Báo cáo kết quả phòng, chống Kiatpathomchai, W.,  Boonsaeng, V.,  Tassanakajon, dịch bệnh thủy sản giai đoạn 2016-2020 tại hội A.,  Wongteerasupaya, C.,  Jitrapakdee, nghị xây dựng kế hoạch quốc gia phòng chống S.,  Panyim, S., 2001. A non-stop, single-tube, dịch bệnh thủy sản giai đoạn 2021-2025 phục vụ semi-nested PCR technique for grading the xuất khẩu, Cần Thơ 9/2019. severity of white spot syndrome virus infections Lê Hồng Phước & Nguyễn Hồng Lộc, 2019. Sự in Penaeus monodon. Dis Aquat Organ 47(3): hiện diện của White Spot Syndrome Virus, 235-9. Vibrio parahaemolyticus và Enterocytzoon Lightner, D.V., 1996. A Handbook of Pathology and hepatopenaei trên tôm giống và tôm nuôi nước Diagnostic Procedures for Diseases of Penaeid lợ ở Đồng bằng sông Cửu Long. Tạp chí Nghề cá Shrimp. J World Aquac Soc, Baton Rouge. sông Cửu Long 15: 15-23. Limsuwan, C., 1997. Reducing the effects of Lê Hồng Phước, Trương Hồng Việt, Trần Minh white-spot baculovirususing PCR screeningand Thiện, Đoàn Văn Cường, Thới Ngọc Bảo, stressors. Aquat Anim Health Res Inst News 2020. Khảo sát sự hiện diện của vi bào tử trùng l6:1–2. Enterocytozoon hepatopenaei trên tôm nuôi, Liu, Y.M., Zhang, Q., Wan, X.Y., Ma, F., Huang, thức ăn công nghiệp và các loài động vật khác J., 2016. Development of real-time PCR assay trong ao nuôi tôm. Tạp chí Nghề cá sông Cửu for detecting microsporidian Enterocytozoon Long 16: 27-37. hepatopenaei and the application in shrimp Tài liệu tiếng Anh samples with different growth rates. Prog. Fish. Aranguren, L.F., Jee Eun Han, Kathy, F.J., Tang, Sci. 37: 119–126. 2017. Enterocytozoon hepatopenaei (EHP) is a Panakorn, S., 2012. Opinion article: more on early risk factor for acute hepatopancreatic necrosis mortality syndrome in shrimp. Aqua Culture disease (AHPND) and septic hepatopancreatic Asia Pacific, 8 (1): 8-10. necrosis (SHPN) in the Pacific white shrimp Rahman, M.M., Corteel, M., Dantas-Lima, J.J., Penaeus vannamei. Aquaculture 471: 37-42. Wille, M., Alday-Sanz, V., Pensaert, M.B., Flegel, T.W., Boonyaratpalin, S., Fegan, D.F., Guerin, Sorgeloos, P., Nauwynck, H.J, 2007a. Impact of M., and Sriurairatana, S.,1992. High mortality of daily fluctuations of optimum (27°C) and high black tiger prawns from cotton shrimp disease in water temperature (33°C) on Penaeus vannamei Thailand. In: Shariff M, Subasinghe RP, Arthur juveniles infected with white spot syndrome JR, editors. Diseases in Asian Aquaculture I. Fish virus (WSSV). Aquaculture 269: 107–113. Health Section, Asian Fisheries Society. Manila: Rahman, M.M., Corteel, M., Wille, M., Alday-Sanz, 181–197. V., Pensaert, M.B., Sorgeloos, P., Nauwynck, H.J, Flegel, T.W., 2012. Historic emergence, impact 2007b. The effect of raising water temperature to and current status of shrimp pathogens in Asia. 33 °C in Penaeus vannameijuveniles at different Journal of Invertebr Pathol 110: 166-173. stages of infection with white spot syndrome Gao, H., Kong, J., Li, Z., Xiao, G., Meng, X., 2011. virus (WSSV). Aquaculture 272: 240–245. Quantitative analysis of temperature, salinity and Rajendran, K.V., Shivam, S., Ezhil Praveena, P., pH on WSSV pro-liferation in Chinese shrimp Sahaya Rajan, J.J., Sathish Kumar, T., Satheesha, Fenneropenaeus chinensisby real-time PCR. A., 2016. Emergence of Enterocytozoon Aquaculture 312: 26-31. hepatopenaei (EHP) in farmed Penaeus Ha, N.T., Ha, D.T., Thuy, N.T., Lien, V.T.K., 2010. (Litopenaeus) vannamei in India. Aquaculture Occurrence of microsporidia Enterocytozoon 454: 272-280. hepatopenaei in white feces disease of cultured Sanguanrut, P., Munkongwongsiri, N., black tiger shrimp (Penaeus monodon) in Kongkumnerd, J., Thawonsuwan, J., Thitamadee, Vietnam. Aquat Anim Dis. S., Boonyawiwat, V., Tanasomwang, V., Flegel, Han, J.E., Mohney, L.L., Tang, K.F.J., Pantoja, T.W., Sritunyalucksana, K., 2018. A cohort study C.R., Lightner, D.V., 2015. Plasmid mediated of 196 Thai shrimp ponds reveals a complex tetracycline resistance of Vibrio parahaemolyticus etiology for early mortality syndrome (EMS). associated with acute hepatopancreatic necrosis Aquaculture 493: 26-36. TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020 85
  13. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II Shen, H., Qiao, Y., Wan, X., Jiang, G., Fan, Feces Syndrome in Whiteleg Shrimp Penaeus X., Li, H., Shi, W., Wang, L. and Zhen, X., (Litopenaeus) vannamei. BMC veterinary 2019.  Prevalence of shrimp microsporidian research 9(1): 139. parasite Enterocytozoon hepatopenaei in Jiangsu Tendencia, E.A., Verreth, J.A.J., 2011. Temperature Province, China. Aquacult Int 27: 675–68. fluctuation,low salinity, watermicroflora: risk Tang, K.F.J., Pantoja, C.R., Redman, R.M., Han, J.E., factors for WSSV outbreaksin Penaeus monodon. Tran, L.H., Lightner, D.V., 2015. Development Isr J Aquacult-Bamid 63: 1−7. of in situ hybridization and PCR assays for Tourtip, S., Wongtripop, S., Stentiford, G.D., the detection of Enterocytozoon hepatopenaei Bateman, K.S., Sriurairatana, S., Chavadej, J., (EHP), a microsporidian parasite infecting Sritunyalucksana, K., Withyachumnarnkul, B, penaeid shrimp. J Invertebr Pathol 130: 37–41. 2009. Enterocytozoon hepatopenaei sp. Nov Tangprasittipap, A., Srisala, J., Chouwdee, S., (Microsporida: Enterocytozoonidae), a parasite Somboon, M., Chuchird, N., Limsuwan, C., of the black tiger shrimp Penaeus monodon Srisuvan, T., Flegel, T.W., and Sritunyalucksana, (Decapoda: Penaeidae): Fine structure and K., 2013. The Microsporidian Enterocytozoon phylogenetic relationships. J Invertebr Pathol Hepatopenaei Is Not the Cause of White 102(1): 21-29. 86 TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020
  14. VIỆN NGHIÊN CỨU NUÔI TRỒNG THỦY SẢN II THE PRESENCE OF WHITE SPOT SYNDROME VIRUS, Vibrio parahaemolyticus AND Enterocytozoon hepatopenaei IN POSTPARVAE AND MARINE SHRIMP CULTURED IN MEKONG DELTA Le Hong Phuoc1*, Nguyen Hong Loc1 ABSTRACT This study was conducted with 600 postlarvae samples collected at Ninh Thuận, Binh Thuan, Vung Tau, Bac Lieu provinces and 120 farmed shrimp sample collected at Bac Lieu, Soc Trang, Ben Tre, Tra Vinh and Ca Mau. The samples were collected from Janary to October of 2020 and tested for some dangerous pathogenic agents including WSSV, Vibrio parahaemolyticus and EHP via PCR method. The prevalence of postlarvae samples positive with WSSV, Vibrio parahaemolyticus and EHP were 2.0%, 3.6% and 4.8%, respectively in dry season while. In rainy season the postlarvae were infected with WSSV, Vibrio parahaemolyticus and EHP with the prevalence of 1.4%, 2.6% and 7.2%, respectively. The percentage of farmed shrimp samples positive with WSSV, Vibrio parahaemolyticus and EHP in dry season were 13.5%, 21.2% and 23,1%, respectively. In rainy season, farmed shrimp were infected with these pathogens wth the prevalence of 17.7; 11.8 and 25.0% respectively. The percentage of postlarve samples positive with Vibrio parahaemolyticus in 2020 is 3.0%. It is lower than that of 2019 (4.0%). The percentage of postlarve samples positive with WSSV in 2020 is also lower than in 2019. It was 1.67% in 2020 and 1.88% in 2019. EHP infection in postlarvae was also lower than that of 2019 (6.5% in 2020 compare to 7.88% in 2019). Keywords: WSSV, Vibrio parahaemolyticus, EHP, shrimp Người phản biện: TS. Ngô Huỳnh Phương Thảo Người phản biện: PGS. TS. Từ Thanh Dung Ngày nhận bài: 10/11/2020 Ngày nhận bài: 10/11/2020 Ngày thông qua phản biện: 12/12/2020 Ngày thông qua phản biện: 15/12/2020 Ngày duyệt đăng: 25/12/2020 Ngày duyệt đăng: 25/12/2020 1 Research Institute for Aquaculture No.2 *Email: lehongphuoc@yahoo.com TẠP CHÍ NGHỀ CÁ SÔNG CỬU LONG - SỐ 18 - THÁNG 12/2020 87
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD


intNumView=7

 

Đồng bộ tài khoản
2=>2