intTypePromotion=1
Array
(
    [0] => Array
        (
            [banner_id] => 143
            [banner_name] => KM - Normal
            [banner_picture] => 316_1568104393.jpg
            [banner_picture2] => 413_1568104393.jpg
            [banner_picture3] => 967_1568104393.jpg
            [banner_picture4] => 918_1568188289.jpg
            [banner_picture5] => 
            [banner_type] => 6
            [banner_link] => https://alada.vn/uu-dai/nhom-khoa-hoc-toi-thanh-cong-sao-ban-lai-khong-the.html
            [banner_status] => 1
            [banner_priority] => 0
            [banner_lastmodify] => 2019-09-11 14:51:45
            [banner_startdate] => 2019-09-11 00:00:00
            [banner_enddate] => 2019-09-11 23:59:59
            [banner_isauto_active] => 0
            [banner_timeautoactive] => 
            [user_username] => minhduy
        )

)

Tách dòng và xác định trình tự của gene crtY mã hóa cho Lycopene cyclase từ Pantoea ananatis

Chia sẻ: Thi Thi | Ngày: | Loại File: PDF | Số trang:4

0
9
lượt xem
0
download

Tách dòng và xác định trình tự của gene crtY mã hóa cho Lycopene cyclase từ Pantoea ananatis

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Nghiên cứu này của chúng tôi là tách dòng và xác định trình tự của gene crtY từ vi khuẩn Pantoea ananatis. Gene crtY đƣợc tách dòng có chiều dài 1161 bp với trình tự tƣơng đồng 100% với trình tự gene crtY phân lập từ vi khuẩn Pantoea ananatis đã công bố trên ngân hàng gene NCBI mã số D90087.2 . Kết quả của nghiên cứu này là tiền đề cho mục tiêu tạo chủng E. coli có khả sản xuất ß-carotene.

Chủ đề:
Lưu

Nội dung Text: Tách dòng và xác định trình tự của gene crtY mã hóa cho Lycopene cyclase từ Pantoea ananatis

Đỗ Mạnh Cƣờng và đtg<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> 83(07): 55 - 58<br /> <br /> Đỗ Mạnh Cường, Nguyễn Xuân Vũ*, Dương<br /> Văn Cường<br /> <br /> TÁCH DÒNG VÀ XÁC ĐỊNH TRÌNH<br /> TỰ CỦA GENE CRTY<br /> MÃ HÓA CHO LYCOPENE CYCLASE<br /> TỪ PANTOEA ANANATIS<br /> <br /> Trường Đại học Nông Lâm - ĐH Thái Nguyên<br /> <br /> TÓM TẮT<br /> ß-carotene, một hợp chất carotenoid, có vai trò là tiền chất vitamin A, tăng cƣờng hệ miễn dịch và chống<br /> một số bệnh ung thƣ ở đƣờng tiêu hóa. ß-carotene đƣợc sử dụng nhiều trong y tế, công nghiệp thực<br /> phẩm, dƣợc phẩm và mỹ phẩm. Việc cung cấp ß-carotene từ các nguồn tự nhiên có một số yếu điểm nhƣ<br /> thiếu tính chủ động phụ thuộc vào thời vụ và chi phí cao. Do vậy, nhu cầu đặt ra là cần xây dựng nguồn<br /> cung cấp ß-carotene nhân tạo. Trong con đƣờng sinh tổng hợp ß-carotene, enzyme lycopene cyclase,<br /> đƣợc mã hóa bởi gene crtY, xúc tác phản ứng chuyển hóa lycopene thành ß-carotene. Nghiên cứu này<br /> của chúng tôi là tách dòng và xác định trình tự của gene crtY từ vi khuẩn Pantoea ananatis. Gene crtY<br /> đƣợc tách dòng có chiều dài 1161 bp với trình tự tƣơng đồng 100% với trình tự gene crtY phân lập từ vi<br /> khuẩn Pantoea ananatis đã công bố trên ngân hàng gene NCBI mã số D90087.2 . Kết quả của nghiên<br /> cứu này là tiền đề cho mục tiêu tạo chủng E. coli có khả sản xuất ß-carotene.<br /> Từ khóa: ß-carotene, pro-vitamin A, crtY, Lycopene cyclase<br /> <br /> ĐẶT VẤN ĐỀ*<br /> Carotenoid là nhóm sắc tố tự nhiên đƣợc tổng<br /> hợp chủ yếu trong thực vật, tảo, vi khuẩn và<br /> nấm [9]. Carotenoid có vai trò trong hình thành<br /> màu sắc, che chắn ánh sáng và hình thành một<br /> số hormone [10]. Trong công nghiệp<br /> carotenoid đƣợc dùng làm dƣợc phẩm, thực<br /> phẩm dinh dƣỡng, chất phụ gia thức ăn cho<br /> động vật, phẩm màu làm mỹ phẩm và thực<br /> phẩm [5]. Do khả năng chống oxi hóa,<br /> carotenoid mang lại lợi ích cho sức khỏe con<br /> <br /> *<br /> <br /> ngƣời, bảo vệ da dƣới tác động của ánh nắng<br /> mặt trời, tăng cƣờng chức năng hệ miễn dịch,<br /> ngăn ngừa hay làm chậm quá trình phát bệnh<br /> của các bệnh mãn tính có tác dụng trong<br /> điều trị và phòng ngừa một số bệnh ung thƣ<br /> [3,5,6].<br /> ß-carotene, với vai trò là tiền chất vitamin A,<br /> tăng cƣờng hệ miễn dịch và chống một số<br /> bệnh ung thƣ [1] đã trở thành một trong<br /> những chất đƣợc quan tâm nhất trong nhóm<br /> carotenoid. Cơ thể con ngƣời không tự tổng<br /> hợp đƣợc ß-carotene mà phải hấp thụ từ thức<br /> ăn [2].<br /> <br /> Tel: 0915565282; Email: vubio@yahoo.com<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> 55<br /> <br /> http://www.lrc-tnu.edu.vn<br /> <br /> Đỗ Mạnh Cƣờng và đtg<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> 83(07): 55 - 58<br /> <br /> tổng hợp bởi hãng Alpha DNA. Các hoá chất<br /> sử dụng trong các thí nghiệm đƣợc cung cấp từ<br /> các hãng Merk, Sigma và Invitrogen.<br /> Bảng 1. Cặp mồi sử dụng nhân gene CrtY.<br /> Tên mồi<br /> CrtY-F<br /> <br /> Hình 1. Con đƣờng sinh tổng hợp các chất<br /> carotenoid<br /> <br /> CrtY-R<br /> <br /> Trình tự<br /> 5’TGAATTCAGGAGGTGTCTTA<br /> AATGGGAGCGGCTAT3’<br /> 5’GCAAGCTTTTAACGATGAGT<br /> CGTCATAATGG3’<br /> <br /> Tất cả carotenoid đều đƣợc xây dựng từ đơn<br /> phân Isopentenyl diphosphate (IPP) và<br /> dimethylallyl diphosphate (DMAPP). Hiện nay<br /> đã có hơn 20 gene crt chịu trách nhiệm tổng<br /> hợp nên các enzyme xúc tác quá trình tổng<br /> hợp carotenoids đƣợc tách dòng từ các loại<br /> sinh vật nhƣ vi khuẩn, vi khuẩn lam, nấm, tảo<br /> cho đến thực vật bậc cao [4]. Một trong những<br /> vi khuẩn có thể cung cấp các gene enzyme để<br /> tổng hợp carotenoid là vi khuẩn Pantoea<br /> ananatis (trƣớc đây gọi là Erwinia uredevora)<br /> [8]. ß-carotene đƣợc tổng hợp từ lycopene nhờ<br /> enzyme lycopene cyclase đƣợc mã hóa bởi<br /> gene crtY (Hình 1).<br /> Với mục tiêu tạo chủng E. coli có khả năng sản<br /> xuất β-carotene, chúng tôi tiến hành tách dòng<br /> và xác định trình tự gene crtY từ Pantoea<br /> ananatis.<br /> VẬT LIỆU VÀ PHƢƠNG PHÁP<br /> NGHIÊN<br /> CỨU<br /> Vi khuẩn Pantoea ananatis (có DNA đƣợc sử<br /> dụng làm khuôn cho phản ứng PCR) đƣợc mua<br /> từ hãng DSMZ (Deutsche Sammlung von<br /> Mikroorganismen Zellkulturen GmbH). Vi<br /> khuẩn E.coli DH5α đƣợc cung cấp bởi Viện<br /> Công nghệ Sinh học, Viện Khoa học và Công<br /> nghệ Việt Nam dùng làm vật chủ cho quá trình<br /> biến nạp. Chúng tôi sử dụng vector tách dòng<br /> pLUG® TA-cloning và các bộ KIT DNAspinTM Plasmid DNA Puification, MEGAspinTM Agarose Gel Extraction mua từ hãng<br /> iNtRON BiotechnologyTM cho các bƣớc thí<br /> nghiệm. Cặp mồi dùng trong PCR (bảng 1)<br /> đƣợc thiết kế dựa trên trình tự các nucleotid ở<br /> 2 đầu gene CrtY đã đƣợc công bố trên ngân<br /> hàng gene NCBI mã số D90087.2 và đƣợc<br /> <br /> Vi khuẩn Pantoea ananatis dạng đông khô<br /> đƣợc nuôi phục hồi theo hƣớng dẫn của nhà<br /> cung cấp, sau đó đƣợc nuôi trong môi trƣờng<br /> Nutrient Broth ở điều kiện hiếu khí, nhiệt độ<br /> 250C, lắc 120 vòng/phút trong 16h. Dịch vi<br /> khuẩn đƣợc ly tâm 4000 vòng/phút trong 8<br /> phút để thu cặn tế bào. 2 µl cặn tế bào đã pha<br /> loãng 10 lần đƣợc sử dụng làm khuôn cho<br /> PCR. Chƣơng trình PCR đƣợc thiết lập 25 chu<br /> kỳ, mỗi chu kỳ bao gồm 3 bƣớc biến tính 950C<br /> 45 giây, gắn nối 550C 45 giây, và kéo dài 720C<br /> 90 giây. Sản phẩm PCR đƣợc điện di trên gel<br /> agarose 1% sau đó chiết lại sử dụng bộ KIT<br /> MEGA- spinTM Agarose Gel Extraction theo<br /> hƣớng dẫn của nhà sản xuất. Phản ứng gắn nối<br /> TA giữa sản phẩm PCR với vector pLUG ở<br /> nhiệt độ 160C qua đêm, thành phần phản ứng<br /> pLUG 1μl, sản phẩm PCR 2μl, H2O 4μl, dung<br /> dịch đệm 10X của T4 2μl, enzyme T4 DNA<br /> ligase 1μl. Sản phẩm phản ứng gắn nối đƣợc<br /> biến nạp vào tế bào khả biến E. coli chủng<br /> DH5α bằng phƣơng pháp sốc nhiệt 420C trong<br /> 90 giây, sau đó cấy trải trên môi trƣờng LB<br /> đặc có bổ sung ampicilin 100µg/ml, 16µl Xgal<br /> và 4µl IPTG để chọn lọc. Những khuẩn lạc<br /> trắng đƣợc nhặt nuôi riêng rẽ trong 7 ml môi<br /> trƣờng LB lỏng có bổ sung ampicilin<br /> 100µg/ml ở điều kiện nhiệt độ 370C, lắc 120<br /> vòng/phút trong khoảng 14-16h. Plasmid đƣợc<br /> tách chiết bằng bộ KIT DNA- spinTM Plasmid<br /> DNA Purification theo hƣớng dẫn của nhà sản<br /> xuất. Các dòng plamid đƣợc cắt kiểm tra bằng<br /> enzyme giới hạn HindIII. Cuối cùng, chúng tôi<br /> tiến hành xác định trình tự nucleotid của đoạn<br /> xen trên máy xác định trình tự tự động của<br /> hãng Applied Biosystems.<br /> KẾT QUẢ VÀ THẢO LUẬN<br /> Kết quả nhân gene crtY.<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> 56<br /> <br /> http://www.lrc-tnu.edu.vn<br /> <br /> Đỗ Mạnh Cƣờng và đtg<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> Sản phẩm PCR đƣợc điện di trên gel agarose<br /> 1% (hình 2). Đƣờng chạy số 1 xuất hiện 2<br /> băng, 1 băng sáng rõ tại vị trí cao hơn băng<br /> 1000 bp và thấp hơn băng 1250 bp của thang<br /> DNA chuẩn tƣơng đƣơng kích thƣớc lý thuyết<br /> của gene crtY là 1161 bp. Nhƣ vậy, gene crtY<br /> có thể đã đƣợc khuếch đại đặc hiệu. Băng mờ<br /> phía dƣới thấp hơn băng 100 bp của thang<br /> chuẩn là primer dimers.<br /> 1<br /> <br /> 2<br /> <br /> 1250 bp<br /> <br /> 83(07): 55 - 58<br /> <br /> Hình 3 cho thấy các dòng 2 và 3 xuất hiện 2<br /> băng khích thƣớc khoảng 3 kb và hơn 1 kb lần<br /> lƣợt tƣơng ứng với vector pLUG mạch thẳng<br /> và gene crtY. Đƣờng chạy số 1 xuất hiện băng<br /> khoảng 1kb có thể là đoạn xen không mong<br /> muốn. Dòng 2 và 3 đƣợc chọn, dòng 1 bị loại<br /> bỏ.<br /> Kết quả xác định trình tự nucleotide dòng<br /> crtY-2<br /> Kết quả giải trình tự dòng crtY-2 thu đƣợc<br /> trình tự trùng khớp 100% với trình tự gene<br /> crtY từ Pantoea ananatis đã công bố trƣớc đó<br /> trên ngân hàng gene NCBI với mã số<br /> D90087.2 (hình 4).<br /> <br /> 1000 bp<br /> <br /> Hình2.2 Kết<br /> : Kết<br /> quả<br /> PCR<br /> nhân<br /> Hình<br /> quả<br /> PCR<br /> nhân<br /> genegene<br /> CrtYCrtY<br /> Đường<br /> chạy<br /> PCR<br /> Đƣờng<br /> chạy1:1:Sản<br /> Sản phẩm<br /> phẩm PCR<br /> Đƣờng<br /> chạy<br /> 2: Thang<br /> DNA<br /> chuẩn<br /> 1Kb 1 kb<br /> Đường<br /> chạy<br /> 2: Thang<br /> DNA<br /> chuẩn<br /> <br /> Kết quả tách dòng gene crtY<br /> Kết quả sang lọc dòng thu đƣợc 3 khuẩn lạc<br /> trắng. Kết quả cắt plasmid tái tổ hợp bằng<br /> HindIII, vị trí cắt đƣợc thiết kế ở 2 đầu T của<br /> pLUG và không hiện diện trong trình tự gene<br /> crtY, đƣợc thể hiện ở hình 3.<br /> 1<br /> <br /> 2<br /> <br /> A<br /> <br /> M<br /> <br /> 3<br /> <br /> M<br /> <br /> 3kb<br /> <br /> 3kb<br /> <br /> 1kb<br /> <br /> 1kb<br /> <br /> B<br /> <br /> Hình 3. Kết quả cắt plasmid tái tổ hợp bằng<br /> HindIII<br /> Đường chạy 1,2(A) và 3(B): Các dòng plasmid tái<br /> tổ hợp có khả năng mang gene crtY<br /> Đường chạy M : Thang chuẩn DNA 1kb<br /> <br /> GTGGGAGCGG<br /> <br /> CTATGCAACC<br /> <br /> GCATTATGAT<br /> <br /> CTGATTCTCG<br /> <br /> TGGGGGCTGG<br /> <br /> ACTCGCGAAT<br /> <br /> GGCCTTATCG<br /> <br /> CCCTGCGTCT<br /> <br /> TCAGCAGCAG<br /> <br /> CAACCTGATA<br /> <br /> TGCGTATTTT<br /> <br /> GCTTATCGAC<br /> <br /> GCCGCACCCC<br /> <br /> AGGCGGGCGG<br /> <br /> GAATCATACG<br /> <br /> TGGTCATTTC<br /> <br /> ACCACGATGA<br /> <br /> TTTGACTGAG<br /> <br /> AGCCAACATC<br /> <br /> GTTGGATAGC<br /> <br /> TTCGCTGGTG<br /> <br /> GTTCATCACT<br /> <br /> GGCCCGACTA<br /> <br /> TCAGGTACGC<br /> <br /> TTTCCCACAC<br /> <br /> GCCGTCGTAA<br /> <br /> GCTGAACAGC<br /> <br /> GGCTACTTCT<br /> <br /> GTATTACTTC<br /> <br /> TCAGCGTTTC<br /> <br /> GCTGAGGTTT<br /> <br /> TACAGCGACA<br /> <br /> GTTTGGCCCG<br /> <br /> CACTTGTGGA<br /> <br /> TGGATACCGC<br /> <br /> GGTCGCAGAG<br /> <br /> GTTAATGCGG<br /> <br /> AATCTGTTCG<br /> <br /> GTTGAAAAAG<br /> <br /> GGTCAGGTTA<br /> <br /> TCGGTGCCCG<br /> <br /> CGCGGTGATT<br /> <br /> GACGGGCGGG<br /> <br /> GTTATGCGGC<br /> <br /> AAACTCAGCA<br /> <br /> CTGAGCGTGG<br /> <br /> GCTTCCAGGC<br /> <br /> GTTTATTGGC<br /> <br /> CAGGAATGGC<br /> <br /> GATTGAGCCA<br /> <br /> CCCGCATGGT<br /> <br /> TTATCGTCTC<br /> <br /> CCATTATCAT<br /> <br /> GGATGCCACG<br /> <br /> TTAATTGAAG<br /> <br /> ACACGCACTA<br /> <br /> TATCGATAAT<br /> <br /> GCGACATTAG<br /> <br /> ATCCTGAACG<br /> <br /> CGCGCGGCAA<br /> <br /> GTCGATCAGC<br /> <br /> AAAATGGTTA<br /> <br /> TCGCTTCGTG<br /> <br /> TACAGCCTGC<br /> <br /> CGCTCTCGCC<br /> <br /> GACCAGATTG<br /> <br /> AATATTTGCG<br /> <br /> ACTATGCCGC<br /> <br /> GCAACAGGGT<br /> <br /> TGGCAGCTTC<br /> <br /> AGACATTGCT<br /> <br /> GCGTGAAGAA<br /> <br /> CAGGGCGCCT<br /> <br /> TACCCATCAC<br /> <br /> CCTGTCGGGC<br /> <br /> AATGCCGAGG<br /> <br /> CATTCTGGCA<br /> <br /> GCAGCGCCCC<br /> <br /> CTGGCCTGTA<br /> <br /> GTGGATTACG<br /> <br /> TGCCGGTCTG<br /> <br /> TTCCATCCTA<br /> <br /> CCACCGGCTA<br /> <br /> TTCACTGCCG<br /> <br /> CTGGCGGTTG<br /> <br /> CCGTGGCCGA<br /> <br /> CCGCCTGAGC<br /> <br /> GCACTTGATG<br /> <br /> TCTTTACGTC<br /> <br /> GGCCTCAATT<br /> <br /> CACCAGGCTA<br /> <br /> TTAGGCATTT<br /> <br /> TGCCCGCGAG<br /> <br /> CGCTGGCAGC<br /> <br /> AGCAGCGCTT<br /> <br /> TTTCCGCATG<br /> <br /> CTGAATCGCA<br /> <br /> TGCTGTTTTT<br /> <br /> AGCCGGACCC<br /> <br /> GCCGATTCAC<br /> <br /> GCTGGCGGGT<br /> <br /> TATGCAGCGT<br /> <br /> TTTTATGGTT<br /> <br /> TACCTGAAGA<br /> <br /> TTTAATTGCC<br /> <br /> CGTTTTTATG<br /> <br /> CGGGAAAACT<br /> <br /> CACGCTGACC<br /> <br /> GATCGGCTAC<br /> <br /> GTATTCTGAG<br /> <br /> CGGCAAGCCG<br /> <br /> CCTGTTCCGG<br /> <br /> TATTAGCAGC ATTGCAAGCC ATTATGACGA<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> 57<br /> <br /> CTCATCGTTA<br /> <br /> http://www.lrc-tnu.edu.vn<br /> <br /> A<br /> <br /> Đỗ Mạnh Cƣờng và đtg<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> Hình 4 : Kết quả giải trình tự gene crtY từ<br /> dòng crtY-2<br /> <br /> 83(07): 55 - 58<br /> <br /> [5]. Lee P.C., Schmidt-Dannert C. (2002)<br /> Metabolic engineering towards biotechnological<br /> production of carotenoids in microorganisms. Appl<br /> Microbiol<br /> Biotechnol<br /> 60:1-11.<br /> DOI:<br /> 10.1007/s00253-002-1101-x.<br /> [6]. Lenore Arab, Steck S. (2000) Lycopene and<br /> cardiovascular disease. Am J Clin Nutr 71:1691S5S; discussion 1696S-7S.<br /> [7]. Lu Q.Y., Hung J.C., Heber D., Go V.L., Reuter<br /> V.E., Cordon-Cardo C., Scher H.I., Marshall J.R.,<br /> Zhang Z.F. (2001) Inverse associations between<br /> plasma lycopene and other carotenoids and prostate<br /> cancer. Cancer Epidemiol Biomarkers Prev 10:74956.<br /> [8]. Misawa N., Nakagawa M., Kobayashi K.,<br /> Yamano S., Izawa Y., Nakamura K., Harashima K.<br /> (1990) Elucidation of the Erwinia uredovora<br /> carotenoid biosynthetic pathway by functional<br /> analysis of gene products expressed in Escherichia<br /> coli. J Bacteriol 172:6704-12.<br /> [9]. Schmidt-Dannert C., Umeno D., Arnold F.H.<br /> (2000) Molecular breeding of carotenoid<br /> biosynthetic pathways. Nat Biotechnol 18:750-3.<br /> DOI: 10.1038/77319.<br /> 10. Vershinin A. (1999) Biological functions of<br /> carotenoids--diversity and evolution. Biofactors<br /> 10:99-104.<br /> <br /> KẾT LUẬN<br /> Tách dòng và giải trình tự thành công gene<br /> crtY mã hóa enzyme lycopene cyclase từ vi<br /> khuẩn Pantoea ananatis.<br /> TÀI LIỆU THAM KHẢO<br /> [1]. Bendich A. (2004) From 1989 to 2001: what<br /> have we learned about the "biological actions of<br /> beta-carotene" J Nutr 134:225S-230S.<br /> [2].Fujisawa M., Watanabe M., Choi S.K.,<br /> Teramoto M., Ohyama K., Misawa N. (2008)<br /> Enrichment of carotenoids in flaxseed (Linum<br /> usitatissimum) by metabolic engineering with<br /> introduction of bacterial phytoene synthase gene<br /> crtB. J Biosci Bioeng 105:636-41. DOI: S13891723(08)70121-X [pii]10.1263/jbb.105.636.<br /> [3]. Giovannucci E. (1999) Tomatoes, tomatobased products, lycopene, and cancer: review of the<br /> epidemiologic literature. J Natl Cancer Inst 91:31731.<br /> [4]. Joseph Hirschberg M.C., Mark Harker, Tamar<br /> Lotan, Varda Mann and Iris Pecker. (1997 )<br /> Molecular genetics of the carotenoid biosynthesis<br /> pathway in plants and algae. Pure and Applied<br /> Chemistry 69:10.<br /> <br /> SUMMARY<br /> CLONING AND SEQUENCING OF crtY GENE ENDCODE LYCOPENE CYCLASE<br /> FROM PANTOEA ANANATIS BACTERIA<br /> Do Manh Cuong, Nguyen Xuan Vu*, Duong Van Cuong<br /> College of Agriculture and Forestry, Thai Nguyen University<br /> <br /> ABSTRACT<br /> ß-carotene, a carotenoid compound, plays critical roles in human metabolism including serving as<br /> precursor for vitamin A synthesis, strengthening the immune system, and preventing some digestive<br /> cancers. ß-carotene has been widely used in medicine, food industry, pharmaceuticals, and cosmetics.<br /> The inactive supply of ß-carotene from natural sources has some remarkable weaknesses such as season<br /> dependence and high cost. Therefore, it is necessary to engineer other artificial ß-carotene sources. In<br /> the natural ß-carotene biosynthetic pathway, lycopene cyclase, encoded by the gene crtY, is responsible<br /> for converting lycopene to ß-carotene. In this study we have cloned and sequenced crtY from Pantoea<br /> ananatis. The nucleotide sequence of the cloned 1161 bp crtY is 100% matched with the P. ananatis<br /> crtY previously published on NCBI gene bank (D90087.2). The cloned crtY will subsequently be used<br /> for engineering a ß-carotene producible E. coli strain.<br /> Keywords: ß-carotene, pro-vitamin A, crtY, Lycopene cyclase<br /> <br /> *<br /> <br /> Tel: 0915565282; Email: vubio@yahoo.com<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> 58<br /> <br /> http://www.lrc-tnu.edu.vn<br /> <br />

CÓ THỂ BẠN MUỐN DOWNLOAD

Đồng bộ tài khoản