intTypePromotion=1
ADSENSE

Thiết kế vector mang gen HA1 của virus H5N1 sử dụng trong chuyển gen thông qua vi khuẩn A.rhizogenes

Chia sẻ: Thi Thi | Ngày: | Loại File: PDF | Số trang:5

51
lượt xem
2
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Trong nghiên cứu này, nhằm tạo cơ sở cho việc sản xuất vaccine A/H5N1 ra môi trường nuôi cấy rễ tơ thuốc lá chuyển gen, chúng tôi đã tiến hành thiết kế vector chuyển gen HA1 biểu hiện kháng nguyên bề mặt của virus cúm A/H5N1 mang đoạn trình tự tín hiệu giúp cho protein HA1 có thể tiết ra môi trường nuôi cấy. Đoạn gen HA1 đã được tách dòng và nối với đoạn trình tự tín hiệu, cấu trúc này được ghép nối thành công vào vector chuyển gen pK7WG2D bằng kỹ thuật lai Gateway.

Chủ đề:
Lưu

Nội dung Text: Thiết kế vector mang gen HA1 của virus H5N1 sử dụng trong chuyển gen thông qua vi khuẩn A.rhizogenes

Nguyễn Huy Hoàng và Đtg<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> 89(01/2): 147 - 151<br /> <br /> THIẾT KẾ VECTOR MANG GEN HA1 CỦA VIRUS H5N1 SỬ DỤNG TRONG<br /> CHUYỂN GEN THÔNG QUA VI KHUẨN A.RHIZOGENES<br /> Nguyễn Huy Hoàng*, Vũ Thị Như Trang<br /> Đại học Y dược Thái Nguyên<br /> <br /> TÓM TẮT<br /> H5N1 là một biến chủng của virus cúm A, là nguyên nhân gây ra dịch cúm gia cầm. Để ngăn ngừa<br /> sự lây nhiễm virus, phương pháp phổ biến nhất là tiêm phòng vaccine. Hằng năm, Việt Nam cần<br /> một lượng vaccine rất lớn để tiêm chủng phòng bệnh. Hiện nay, chuyển gen mã hóa các kháng<br /> nguyên nhằm sản xuất vaccine tái tổ hợp vào thực vật, cụ thể là vào các cây trồng là nguồn thức ăn<br /> chính cho con người, động vật nuôi là một trong những hướng đi có triển vọng. Tuy nhiên, xu<br /> hướng sử dụng hệ thống nuôi cấy sinh khối tế bào để sản xuất các dược phẩm sinh học tái tổ hợp<br /> cũng được bắt đầu quan tâm nghiên cứu và ứng dụng. Trong nghiên cứu này, nhằm tạo cơ sở cho<br /> việc sản xuất vaccine A/H5N1 ra môi trường nuôi cấy rễ tơ thuốc lá chuyển gen, chúng tôi đã tiến<br /> hành thiết kế vector chuyển gen HA1 biểu hiện kháng nguyên bề mặt của virus cúm A/H5N1<br /> mang đoạn trình tự tín hiệu giúp cho protein HA1 có thể tiết ra môi trường nuôi cấy. Đoạn gen<br /> HA1 đã được tách dòng và nối với đoạn trình tự tín hiệu, cấu trúc này được ghép nối thành công<br /> vào vector chuyển gen pK7WG2D bằng kỹ thuật lai Gateway.<br /> Từ khóa: biểu hiện gen, HA, vaccine thực vật, H5N1, rễ tơ.<br /> <br /> ĐẶT VẤN ĐỀ*<br /> Cúm gà (avian influenza) là một bệnh truyền<br /> nhiễm cấp tính của các loài chim, kể cả gia<br /> cầm và thuỷ cầm, do các subtype khác nhau<br /> thuộc nhóm virus cúm A gây nên. Do có sức<br /> đề kháng tự nhiên tốt nên một số loài chim<br /> mang virus gây bệnh, nhưng không có biểu<br /> hiện của bệnh. Đây là mối nguy hiểm lan<br /> truyền bệnh cho các loài gia cầm khác. Ngoài<br /> ra, chúng còn là nguồn tàng trữ biến đổi nguồn<br /> gen tạo nên các subtype mới. Các subtype<br /> virus cúm A gây bệnh trên người đều có<br /> nguồn gốc tiến hoá biến thể và biến chủng từ<br /> động vật và sau khi thích ứng trên người thì<br /> gây bệnh, trước đây đã tạo nên những vụ dịch<br /> thảm khốc, rồi biến mất sau một thời gian lại<br /> tái hiện và gây nên đại dịch mới [1, 3].<br /> Để phòng chống sự lây lan mạnh mẽ của đại<br /> dịch cúm gia cầm, hàng năm Việt Nam cần<br /> một lượng vaccine rất lớn để tiêm chủng cho<br /> hàng trăm triệu con gà, vịt. Ngoài những công<br /> nghệ sẵn có, Việt Nam đang tìm kiếm những<br /> công nghệ sản xuất vaccine mới có ý nghĩa<br /> kinh tế, an toàn và hiệu quả cao. Vaccine ăn<br /> được có nguồn gốc từ thực vật sẽ là nguồn<br /> *<br /> <br /> Tel: 0984.434.797; Email: huyhoangytn@gmail.com<br /> <br /> vaccine đáp ứng được các tiêu chí đó, đồng<br /> thời được xem là hướng nghiên cứu mới vì<br /> mục đích chăm sóc sức khỏe cộng đồng phù hợp<br /> với những nước đang phát triển như Việt Nam.<br /> Chuyển gen mã hóa các kháng nguyên tái tổ<br /> hợp vào thực vật cụ thể là vào các cây trồng<br /> là nguồn thức ăn chính cho con người, động<br /> vật nuôi là một trong những hướng đi chính<br /> hiện nay. Tuy nhiên bên cạnh đó, một xu<br /> hướng cũng được bắt đầu quan tâm nghiên<br /> cứu và ứng dụng là sử dụng hệ thống nuôi<br /> cấy sinh khối tế bào để sản xuất các dược<br /> phẩm sinh học tái tổ hợp. So sánh với cây<br /> trồng chuyển gen, nuôi cấy tạo sinh khối tế<br /> bào thực vật có ưu điểm lớn là không đòi hỏi<br /> diện tích canh tác, không chịu ảnh hưởng của<br /> khí hậu, mùa vụ, sản phẩm thu được không<br /> mang các yếu tố độc hại từ thuốc trừ sâu,<br /> thuốc diệt cỏ và rút ngắn được rất nhiều thời<br /> gian trồng trọt. Thêm vào đó, nuôi cấy tế bào<br /> thực vật dễ dàng, môi trường nuôi cấy đơn<br /> giản, rẻ tiền, chủ động, có thể sản xuất một<br /> lượng sinh khối lớn trong khoảng thời gian<br /> ngắn. Đặc biệt hơn cả là ở hệ thống nuôi cấy<br /> lỏng các mô tế bào thực vật việc biểu hiện<br /> dược phẩm sinh học tái tổ hợp ra môi trường<br /> nuôi cấy đơn giản hơn rất nhiều [5]. Khác với<br /> nuôi cấy mô, nuôi cấy sinh khối tế bào thực<br /> vật không định hướng tạo ra cây hoàn chỉnh<br /> 147<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> http://www.lrc-tnu.edu.vn<br /> <br /> Nguyễn Huy Hoàng và Đtg<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> 89(01/2): 147 - 151<br /> <br /> mà chỉ phát triển các dòng tế bào như nuôi<br /> VẬT LIỆU VÀ PHƯƠNG PHÁP<br /> cấy mô sẹo, huyền phù tế bào, rễ tơ để tạo<br /> Chủng vi sinh vật và hệ gen<br /> sinh khối lớn các sản phẩm. Trong đó, rễ tơ<br /> Chủng E. Coli DH5α (Invitrogen) được sử<br /> được gây tạo ra bởi quá trình tương tác giữa<br /> dụng để nhân dòng gen.<br /> vi khuẩn đất A. rhizogenes và tế bào vật chủ.<br /> Ưu điểm trong nuôi cấy rễ tơ là có thể sinh<br /> Vector pUC18/Haop mang gen HA biểu hiện<br /> trưởng, phát triển tốt trên các môi trường nuôi<br /> kháng nguyên bề mặt virus cúm A, gen này<br /> cấy không bổ sung các chất kích thích sinh<br /> đã được chuyển mã để tối ưu cho biểu hiện ở<br /> trưởng, khả năng phân nhánh cao, kỹ thuật<br /> thực vật.<br /> nuôi cấy và chuyển gen dễ dàng. Hơn nữa,<br /> các rễ tơ có thể được nuôi cấy tạo sinh khối<br /> Vector pDONRTM221 (Invitrogen) được sử<br /> liên tục, rất có ý nghĩa trong dây chuyền sản<br /> dụng để tạo dòng gen bằng kỹ thuật Gateway.<br /> xuất các chất thứ cấp hay các dược phẩm sinh<br /> Vector chuyển gen thực vật pK7WG2D [6]<br /> học tái tổ hợp được chúng tôi quan tâm<br /> Tổng hợp đoạn trình tự tín hiệu<br /> nghiên cứu.<br /> Calreticulin<br /> Với mục đích tạo cơ sở cho việc sản xuất<br /> vaccine A/H5N1 ăn được, chúng tôi đã tiến<br /> Dựa trên trình tự gen Calreticulin trên<br /> hành nghiên cứu thiết kế vector mang gen<br /> GenBank (mã số Z71395.1), chúng tôi đã tổng<br /> HA1 biểu hiện kháng nguyên HA của H5N1<br /> hợp nhân tạo đoạn trình tự nucleotide mã hóa<br /> và bước đầu tạo dòng rễ tơ chuyển gen ở cây<br /> đoạn peptide tín hiệu Calreticulin (81<br /> thuốc lá. Đây sẽ là nguồn nguyên liệu cơ sở<br /> nucleotide) và thêm trình tự gắn mồi của attB1<br /> để biến nạp và biểu hiện kháng nguyên của<br /> và attB2 ở đầu 5’ và 3’ tương ứng (bảng 1).<br /> virus trong cây trồng.<br /> Bảng 1. Các cặp mồi và trình tự nucleotide sử dụng trong nghiên cứu<br /> Tên<br /> <br /> Trình tự DNA<br /> 5’<br /> GGGGAGCTCGATCAGATCTGCATTGGAT<br /> HA1_SacI_F<br /> 3’<br /> HA1_HindIII_R<br /> 5’<br /> GGAAGCTTTTACCTTCTTTCTCTCTGTGG<br /> 3’<br /> <br /> Chú thích<br /> Cặp mồi nhân đoạn gen<br /> HA1, thêm trình tự cắt<br /> enzyme hạn chế SacI vào<br /> mồi xuôi và HindIII vào<br /> mồi ngược<br /> <br /> Đoạn tín hiệu Calreticulin<br /> 5’ AAGAAGGAGATATATACCATGGCTACT<br /> (Cal - 81 bp) được tổng hợp<br /> CAACGAAGGGCAAACCCTAGCTCTCTCC<br /> nhân tạo, thêm trình tự gắn<br /> Calreticulin ATCTAATTACTGTATTCTCTCTGCTCGTCG<br /> mồi của attB1 ở đầu 5’ và<br /> CTGTCGTCTCCGCTGAGCTCTCTAGAAAG<br /> trình tự gắn mồi của attB2 ở<br /> CTT 3’<br /> đầu 3’<br /> Cặp mồi nhân đoạn<br /> Calreticulin đồng thời tạo vị<br /> 5’GGGGACAAGTTTGTACAAAAAAGCAGG<br /> trí tái tổ hợp attB, đoạn gen<br /> CTCATTTAACTTTAAGAAGGAGATATATA<br /> attB1_SP<br /> này sử dụng để ghép nối<br /> CC<br /> attB2_SP_MCS<br /> vào vector pDONRTM221<br /> GGGGACCACTTTGTACAAGAAAGCTGGG<br /> bằng kỹ thuật Gateway<br /> TCAAGCTTTCTAGAGAGCTC 3’<br /> MCS mang trình tự cắt<br /> SacI, XbaI, HindIII<br /> Trình tự các đoạn nucleotide được tổng hợp tại công ty MWG, CHLB Đức và công ty Epoch<br /> Biolabs, Hoa Kỳ.<br /> 148<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> http://www.lrc-tnu.edu.vn<br /> <br /> Nguyễn Huy Hoàng và Đtg<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> Dòng hóa đoạn trình tự tín hiệu Cal vào<br /> pDONRTM221 bằng kỹ thuật Gateway<br /> Kỹ thuật Gateway là một kỹ thuật dòng hóa<br /> phổ biến, dựa vào điểm đặc hiệu trong hệ<br /> thống tái tổ hợp của phage I. Kỹ thuật<br /> Gateway cho phép chuyển đoạn DNA giữa<br /> các vector tách dòng khác nhau trong khi vẫn<br /> duy trì định hướng chính và cấu trúc đọc. Kỹ<br /> thuật này là một phương pháp có hiệu quả cao<br /> cho việc tách dòng có định hướng của các sản<br /> phẩm PCR. Kỹ thuật này gồm có hai loại<br /> phản ứng LR và BP (Invitrogen). Trong<br /> nghiên cứu này sử dụng cặp mồi attB1_SP và<br /> attB2_S_MCS để nhân đoạn trình tự tín hiệu<br /> Cal tạo mang trình tự tái tổ hợp attB1&2.<br /> Phản ứng BP được thực hiện giữa sản phẩm<br /> PCR trên và vector pDONRTM221 mang<br /> dưới sự xúc tác bởi hỗn hợp enzym BP<br /> ClonaseTM, kết quả tạo vector tiếp nhận<br /> pENTR 221/cal. Phản ứng được thực hiện<br /> theo hướng dẫn của bộ kit Gateway® Cloning<br /> (Invitrogen) có cải tiến cho phù hợp với điều<br /> kiện phòng thí nghiệm.<br /> Ghép nối đoạn gen HA1 vào vector tiếp<br /> nhận pENTR221/cal<br /> Đoạn gen HA1 được nhân lên bằng PCR từ<br /> plasmid pUC18/HAop với cặp mồi đặc hiệu<br /> HA1_Sacl_F và HA1_HindIII_R theo chu<br /> trình: 95oC - 3 phút, 30 chu kì ( 95oC - 30<br /> giây, 570C - 30 giây,72oC - 1 phút 30 giây),<br /> 72oC - 10 phút và phản ứng kết thúc sau khi<br /> mẫu được làm lạnh đến 10oC.<br /> Sản phẩm tổng hợp gen trên và<br /> pENTR221/cal được cắt tạo đầu sole bằng 2<br /> enzyme giới hạn (SacI & HindIII), nối ghép<br /> tạo pENTR221/cal/HA1 và biến nạp vào tế<br /> bào khả biến E.coli DH5α. Vector tái tổ hợp<br /> pENTR221/cal/HA1 được kiểm tra bằng<br /> phương pháp colony-PCR và cắt kiểm tra<br /> bằng enzyme hạn chế SacI & HindIII. Xác<br /> định trình tự gen HA1 bằng máy phân tích<br /> trình tự tự động ABI PRISM 3100 Avant<br /> Genetic Analyzer theo nguyên lí của Sanger<br /> với bộ kit BigDye Terminator v. 3.2 Cycle<br /> Sequencing.<br /> <br /> 89(01/2): 147 - 151<br /> <br /> Thiết kế vector chuyển gen thực vật bằng<br /> kỹ thuật Gateway<br /> Phản ứng LR được thực hiện giữa vector tiếp<br /> nhận pENTR221/cal mang trình tự tái tổ hợp<br /> attL1&2 và vector đích pK7WG2D mang trình<br /> tự tái tổ hợp attR1&2 dưới sự xúc tác bởi hỗn<br /> hợp enzym LR ClonaseTM II theo hướng dẫn<br /> của bộ kit Gateway® Cloning (Invitrogen).<br /> Vector chuyển gen pK7WG2D/cal/HA1 (hình<br /> 1) được kiểm tra bằng phương pháp PCR và cắt<br /> enzyme giới hạn.<br /> KẾT QUẢ VÀ THẢO LUẬN<br /> Kết quả dòng hóa đoạn trình tự tín hiệu<br /> Cal vào pDONRTM221 bằng kỹ thuật<br /> Gateway<br /> Với mục đích “dẫn” protein tái tổ hợp tiết ra<br /> môi trường nuôi cấy lỏng rễ tơ ở cây thuốc lá,<br /> chúng tôi thiết kế đoạn trình tự tín hiệu tiết<br /> calreticulin nối với gen HA1 ở đầu 5’. Đoạn<br /> trình tự tín hiệu này được phân lập từ<br /> Nicotiana plumbaginifolia họ hàng gần với<br /> thuốc lá (Nicotiana tabacum) - cây nhận gen<br /> chuyển, điều này nhiều khả năng làm tăng hiệu<br /> quả của quá trình tiết protein tái tổ hợp [2].<br /> Để tạo điều kiện cho thiết kế vector chuyển<br /> gen ở thực vật bằng kỹ thuật Gateway ở các<br /> thí nghiệm tiếp theo, đoạn trình tự tín hiệu<br /> Cal được tạo vị trí tái tổ hợp attB bằng<br /> phương pháp PCR sử dụng cặp mồi attB1_SP<br /> và attB2_SP_MCS (Bảng 1). Đoạn trình tự<br /> trên được ghép nối vào vector pDONRTM221<br /> bằng kỹ thuật Gateway theo nguyên lý và<br /> phương pháp như đã miêu tả ở phần phương<br /> pháp nghiên cứu. Kết quả của quá trình ghép<br /> nối đoạn gen Cal vào pDONRTM221 được xác<br /> định bằng biến nạp sản phẩm nối ghép gen<br /> vào tế bào E.Coli. Sau đó, chọn các khuẩn lạc<br /> để kiểm tra bằng phương pháp colony-PCR<br /> với cặp mồi M13. Nếu vector mang gen ngoại<br /> lai, kiểm tra sản phẩm PCR sẽ nhận được<br /> băng DNA có kích thước khoảng 0,4bp. Kết<br /> quả kiểm tra sản phẩm PCR đã khẳng định<br /> đoạn trình tự Cal đã được ghép nối vào<br /> pDONRTM221 tạo vector tiếp nhận<br /> pENTR221/cal.<br /> 149<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> http://www.lrc-tnu.edu.vn<br /> <br /> Nguyễn Huy Hoàng và Đtg<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> Thiết kế vector pENTR221/cal/HA1<br /> HA1 là một trong ba tiểu phần cấu tạo nên<br /> protein HA, cho phép nhận biết tế bào đích<br /> của động vật có xương sống và hoàn thành<br /> quá trình nhận biết bằng cách gắn kết với thụ<br /> thể chứa sialic acid của những tế bào này [4,<br /> 7]. Đoạn gen HA1 được nhân lên từ<br /> pUC18/HAop bằng phương pháp PCR với<br /> cặp mồi đặc hiệu HA1_SacI_F và<br /> HA1_HindIII_R. Kết quả điện di thu được<br /> đoạn DNA đặc hiệu, rõ, có kích thước khoảng<br /> 1000 bp đúng theo tính toán lý thuyết (978<br /> bp) khi thiết kế mồi (hình 1A).<br /> Để tạo điều kiện ghép nối gen HA1 trực tiếp<br /> vào pENTR221/cal, sản phẩm PCR trên được<br /> tinh sạch để loại bỏ các thành phần không<br /> mong muốn trước khi cắt bằng cặp enzyme<br /> hạn chế SacI và HindIII. Đoạn gen HA1 này<br /> được nối ghép vào vector pENTR221/cal đã<br /> tiền xử lý với cùng cặp enzyme trên và nhân<br /> dòng trong tế bào E.coli DH5α. Kết quả của<br /> quá trình biến nạp được kiểm tra bằng<br /> phương pháp tách chiết plasmid để cắt kiểm<br /> tra (hình 1B). Kết quả trên điện di đồ cho thấy<br /> 2 băng DNA có kích thước khoảng 978bp và<br /> 2544 bp, tương ứng với kích thước của gen<br /> HA1 và vector đúng như tính toán lý thuyết.<br /> Bên cạnh đó, kết quả giải trình tự gen cho thấy,<br /> dòng gen lựa chọn có mang chính xác trình tự<br /> đoạn tín hiệu Cal nối với trình tự gen HA.<br /> Thiết kế vector chuyển gen<br /> Cấu trúc gen chứa HA1 và trình tự tín hiệu<br /> Cal được chuyển vào vector pK7WG2D [6]<br /> <br /> 89(01/2): 147 - 151<br /> <br /> bằng kỹ thuật Gateway theo mô tả ở phần<br /> phương pháp và vật liệu nghiên cứu.<br /> Kết quả kiểm tra vector tái tổ hợp bằng PCR<br /> và cắt enzyme hạn chế SacI/HindIII cho thấy<br /> sản phẩm PCR với cặp mồi đăc hiệu<br /> HA1_SacI_F/HA1_HindIII_R có kích thước<br /> khoảng 978 bp (hình 2A), sản phẩm cắt<br /> vector pK7WG2D/cal/HA1 bằng SacI/HindIII<br /> thu được 4 đoạn gen kích thước khoảng<br /> 434bp, 978 bp, 1201bp và 11159 bp kích<br /> thước này phù hợp với tính toán theo lý<br /> thuyết (Hình2B). Như vậy, cấu trúc gen HA1<br /> đã được thiết kế thành công vào vector<br /> chuyển gen thực vật pK7WG2D. Dòng<br /> plasmid số 1 đã được lựa chọn cho biến nạp<br /> vào Agrobacterium rhizogenes ATCC15834<br /> để tạo dòng rễ tơ chuyển gen.<br /> <br /> M<br /> <br /> 1<br /> <br /> M<br /> <br /> 2<br /> <br /> 2,5bp<br /> 1kb<br /> <br /> A<br /> <br /> B<br /> <br /> Hình 1. Kết quả nhân đoạn gen HA1 bằng PCR (A)<br /> và kiểm tra cấu trúc vector ENTR221/cal/HA1 (B).<br /> M: thang DNA chuẩn 1kb; 1: sản phẩm PCR của<br /> HA1; 2: sản phẩm cắt bằng enzyme SacI/HindIII<br /> <br /> 10 kb<br /> 1 kb<br /> 1 kb<br /> <br /> 0,5 kb<br /> <br /> bp<br /> A<br /> <br /> B<br /> <br /> Hình 2. Điện di kiểm tra vector tái tổ hợp pK7WG2D/cal/HA1 bằng PCR (A) và cắt bởi enzyme cắt hạn<br /> chế SacI/HindIII (B). M: thang chuẩn 1kb; giếng 1 - 10: mẫu vector tái tổ hợp tách từ các dòng khuẩn lạc<br /> <br /> 150<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> http://www.lrc-tnu.edu.vn<br /> <br /> Nguyễn Huy Hoàng và Đtg<br /> <br /> Tạp chí KHOA HỌC & CÔNG NGHỆ<br /> <br /> KẾT LUẬN<br /> Đã thiết kế thành công vector chuyển gen<br /> thực vật pK7WG2D/cal/HA1 mang cấu trúc<br /> gen HA1 nối với trình tự tín hiệu Cal để dẫn<br /> HA1 tái tổ hợp tiết ra môi trường nuôi cấy rễ<br /> tơ cây thuốc lá chuyển gen. Vector chuyển<br /> gen đã được biến nạp vào A.rhizogenes ATCC<br /> 15834 để tạo rễ tơ cây thuốc lá chuyển gen.<br /> TÀI LIỆU THAM KHẢO<br /> [1]. Alexander, D.J. (2007), Summary of avian<br /> influenza activity in Europe, Asia, Africa, and<br /> Australasia, 2002-2006. Avian Dis, 51(1 Suppl):<br /> p. 161-6.<br /> [2]. Borisjuk NV, Borisjuk LG, et al. (1999).<br /> "Production of recombinant proteins in plant root<br /> exudates." Nat. Biotechnol. 17(5): 466-469.<br /> <br /> 89(01/2): 147 - 151<br /> <br /> [3]. Bosch, F., M. Orlich, H. Klenk, and R. Root<br /> (1979), The structure of the hemagglutinin: a<br /> determinant for the pathgencity of Influenza virus,<br /> Virology, 95: p. 197-207.<br /> [4]. Chen, L., C. Davis, H. Zhou, N. Cox, and R.<br /> Donis (2008), Genetic compatibility and virulence<br /> of reassortants derived from contemporary avian<br /> H5N1 and human H3N2 influenza A viruses.<br /> PLoS Pathog, 4(5): p. e1000072.<br /> [5]. Doran, P.M. (2000), Foreign protein<br /> production in plant tissue cultures. Curr Opin<br /> Biotechnol, 11(2): p. 199-204.<br /> [6]. Karimi M, Inze D, et al. (2002). "Gateway<br /> vectors for Agrobacterium-mediated plant<br /> transformation." Trends Plant Sci. 7(5): 193-195.<br /> [7]. Zhao, Z., K. Shortridge, M.G. M, Y. Guan,<br /> and X. Wan (2008), Genotypic diversity of H5N1<br /> highly pathogenic avian influenza viruses. J Gen<br /> Virol, 89(9): p. 2182-2193.<br /> <br /> SUMMARY<br /> CONSTRUCTION OF BINARY VECTOR CARRYING HA1 OF H5N1 VIRUS<br /> USING IN PLANT TRANSFORMATION VIA A.RHIZOGENES<br /> Nguyen Huy Hoang*, Vu Thi Nhu Trang<br /> College of Medicine and Pharmacy - TNU<br /> <br /> H5N1 is a sulotyspe of influenza A, commonly called avian flu or bird flu. To prevent the viral<br /> infection, the most common method is vaccination. Currently, there have been many flu A<br /> vaccines available. However, plant-based oral vaccine is targeted by many researchers around the<br /> world because this subunit vaccine can be eaten, easy to administer and more effiective than other<br /> injection vaccines. In this study, we aimed establish a method to transfer HA1 gene encoded<br /> antigens HA from H5N1 into tobacco plant as a very first stage of develop an plant-based<br /> oral vaccine.<br /> With the aim of creating facilities for the production of H5N1 vaccine, creating materials to<br /> produce transgenic plants likeness of virus antigens in the crop. We have studied gene transfer<br /> vector design HA1 expression of surface antigen HA H5N1 virus carrying the signal sequence<br /> may help the HA1 protein secreted outside the culture medium Gateway hybrid technique.<br /> Keywords: H5N1, gene expression, plant vaccine, HA, hairy root.<br /> <br /> *<br /> <br /> Tel: 0984.434.797; Email: huyhoangytn@gmail.com<br /> <br /> 151<br /> <br /> Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên<br /> <br /> http://www.lrc-tnu.edu.vn<br /> <br />
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2