
Vi khuẩn gram âm mang gen New Delhi-Metallo-Beta-Lactamase (NDM-1) kháng Carbapenem phân lập trong môi trường bệnh viện

Chia sẻ: Thôi Kệ | Ngày: | Loại File: PDF | Số trang:7

lượt xem

Vi khuẩn gram âm mang gen New Delhi-Metallo-Beta-Lactamase (NDM-1) kháng Carbapenem phân lập trong môi trường bệnh viện

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Hiện nay, vi khuẩn gram âm mang gen NDM-1 kháng carbapenem là vấn đề quan trọng tác động đến sức khỏe toàn cầu. Ở Việt Nam, vi khuẩn mang gen NDM - 1 không chỉ phát hiện được trên các bệnh nhân bị nhiễm khuẩn bệnh viện mà còn được phát hiện trong môi trường. Trong nghiên cứu này, 200 mẫu xét nghiệm tại các khoa Phẫu thuật tiết niệu, Phẫu thuật gan mật và Phẫu thuật tiêu hóa được thu thập để phát hiện vi khuẩn mang gen NDM - 1 bằng kỹ thuật PCR.

Chủ đề:

Nội dung Text: Vi khuẩn gram âm mang gen New Delhi-Metallo-Beta-Lactamase (NDM-1) kháng Carbapenem phân lập trong môi trường bệnh viện

TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> <br /> VI KHUẨN GRAM ÂM MANG GEN NEW DELHI-METALLO-BETA-<br /> LACTAMASE (NDM - 1) KHÁNG CARBAPENEM PHÂN LẬP<br /> TRONG MÔI TRƯỜNG BỆNH VIỆN<br /> Trần Huy Hoàng1, Heiman Wertheim2, Trần Như Dương1, Nguyễn Bình Minh1,<br /> Trần Vân Phương1, Trịnh Hồng Sơn3, Đặng Đức Anh1<br /> 1<br /> Viện Vệ sinh Dịch tễ Trung ương, Hà Nội<br /> 2<br /> Đơn vị nghiên cứu lâm sàng Đại học Oxford, Hà Nội, Việt Nam<br /> 3<br /> Bệnh viện Hữu nghị Việt Đức, Hà Nội<br /> <br /> Hiện nay, vi khuẩn gram âm mang gen NDM - 1 kháng carbapenem là v ấn đề quan trọng tác động đến<br /> sức khỏe toàn cầu. Ở Việt Nam, vi khuẩn mang gen NDM - 1 không chỉ phát hiện được trên các bệnh nhân<br /> bị nhiễm khuẩn bệnh viện mà còn được phát hiện trong môi trường. Trong nghiên cứu này, 200 mẫu xét<br /> nghiệm (tay nhân viên điều dưỡng, xe đẩy y tế, sàn nhà, ga trải giường bệnh và nắp toa lét) tại các khoa<br /> Phẫu thuật tiết niệu, Phẫu thuật gan mật và Phẫu thuật tiêu hóa được thu thập để phát hiện vi khuẩn mang<br /> gen NDM - 1 bằng kỹ thuật PCR. Các chủng NDM - 1 dương tính sẽ được định danh bằng thanh API - 20E<br /> và đánh giá mức độ nhạy cảm kháng sinh. Nghiên cứu phát hiện được 5/200 (2,5%) mẫu dương tính với gen<br /> NDM - 1, trong đó 3 mẫu được phát hiện trên ga trải giường bệnh, 1 mẫu ở thùng rác thải y tế và 1 mẫu phát<br /> hiện trên nắp toa lét nhà vệ sinh tại hai khoa phẫu thuật tiết niệu và Gan mật. Tất cả các chủng dương tính<br /> với NDM - 1 đều kháng lại kháng sinh được thử nghiêm ở mức độ cao, nhưng vẫn còn nhạy cảm với colistin.<br /> <br /> Từ khóa: Vi khuẩn gram âm, gen NDM-1, kháng carbappenem, môi trường bệnh viện<br /> <br /> <br /> <br /> I. ĐẶT VẤN ĐỀ<br /> trên các bệnh phẩm lâm sàng mà còn phát<br /> Vi khuẩn Gram âm mang gen New Delhi hiện được trong cả môi trường ngoại cảnh ở<br /> Metallo - Beta - Lactamase 1 (NDM - 1) sinh Ấn Độ nơi có dịch NDM - 1 lưu hành. Đây là<br /> men kháng lại carbapenem (thuộc nhóm lựa một nguy cơ quan trọng tác động đến sức<br /> chọn cuối cùng) hiện đang là một trong những khỏe con người và làm tăng nguy cơ lan<br /> vấn đề mang tính toàn cầu. NDM - 1 lần đầu truyền của vi khuẩn mang gen NDM - 1 ở<br /> tiên được ghi nhận trên chủng K. pneumoniae trong cộng đồng [3]. Sự xuất hiện của các vi<br /> phân lập được trên bệnh nhân người Thụy khuẩn mang gen kháng thuốc này báo hiệu sự<br /> Điển có tiền sử du lịch tại Ấn Độ [1]. Hiện nay mở đầu của một giai đoạn mới về tình trạng vi<br /> đã có rất nhiều báo cáo công bố nhiều loại vi khuẩn kháng lại kháng sinh trên Thế giới.<br /> khuẩn Gram âm mang gen NDM-1 như Kleb- Ở Việt Nam, bệnh truyền nhiễm vẫn chiếm<br /> siella, E. coli, Acinetobacter và Citrobacter ở một tỷ lệ lớn trong mô hình bệnh tật nên việc<br /> nhiều quốc gia trên thế giới [2]. Các vi khuẩn sử dụng kháng sinh một cách hiệu quả đóng<br /> mang gen NDM - 1 không chỉ được phát hiện một vai trò quan trọng trong việc giảm tỷ lệ<br /> mắc và tử vong do các bệnh nhiễm khuẩn.<br /> Địa chỉ liên hệ: Trần Huy Hoàng - Viện Vệ sinh Dịch tễ Tuy nhiên, sự gia tăng tình trạng kháng kháng<br /> Trung ương, số 1 Yersin, Hà Nội<br /> sinh của vi khuẩn sẽ ảnh hưởng nghiêm trọng<br /> Email:<br /> Ngày nhận: 05/8/2013 đến sức khỏe của nhân dân cũng như tổn thất<br /> Ngày được chấp thuận: 30/10/2013 về kinh tế. Imipenem là kháng sinh thuộc<br /> <br /> <br /> TCNCYH 85 (5) - 2013 1<br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> <br /> nhóm carbapenem, được đưa vào thị trường 2. Địa điểm nghiên cứu<br /> vào đầu những năm 2000, cũng đã giảm tác Chúng tôi lựa chọn 3 khoa bao gồm khoa<br /> dụng với các vi khuẩn gram âm. Hai căn Phẫu thuật Tiết niệu, Phẫu thuật Gan mật và<br /> nguyên gây nhiễm khuẩn bệnh viện thường Khoa Phẫu thuật Tiêu hóa của bệnh viện Việt<br /> gặp là P. aeruginosa và A. baumannii được Đức để tiến hành thu thập các mẫu xét<br /> đánh giá mức độ kháng carbapenem ở 6 bệnh nghiệm cho nghiên cứu.<br /> viện năm 2008. 20% các chủng P. aeruginosa<br /> 3. Đối tượng và cỡ mẫu nghiên cứu<br /> và gần 50% các chủng A. baumannii kháng<br /> carbapenem [4]. Tổng số 200 mẫu được thu thập bằng tăm<br /> bông vô trùng tại 3 khoa của bệnh viện Việt<br /> Ngay từ tháng 8/2010 nhóm nghiên cứu<br /> Đức. Các loại mẫu được thu thập bao gồm từ<br /> của chúng tôi đã tiến hành nghiên cứu và đưa<br /> tay nhân viên điều dưỡng (28), xe đẩy y tế<br /> ra bằng chứng về sự có mặt của vi khuẩn<br /> (12), máy hút đờm (20), tủ cá nhân của nhân<br /> mang gen NDM - 1 tại Việt Nam [5; 6]. Thêm<br /> viên y tế và bệnh nhân (18), mặt bàn, bề mặt<br /> vào đó sự có mặt của K. pneumoniae mang<br /> sàn buồng bệnh (29), ga trải giường bệnh<br /> gen NDM - 1 phân lập được trong môi trường<br /> (46), khu nhà vệ sinh, chậu rửa tay tại buồng<br /> ngoại cảnh cũng được báo cáo tại Việt Nam<br /> bệnh (16), rác thải y tế (12) và các vị trí lấy<br /> [7]. Bệnh viện Việt Đức là bệnh viện ngoại<br /> mẫu khác là 19 mẫu (tay cầm điện thoại, bàn<br /> khoa đầu ngành và là trung tâm phẫu thuật<br /> văn phòng...)<br /> lớn nhất Việt Nam với qui mô 500 giường<br /> 4. Tiến hành<br /> bệnh, mỗi năm tiến hành khoảng 28.000 ca<br /> phẫu thuật thuộc nhiều chuyên khoa sâu khác 4.1. Thu thập mẫu<br /> nhau. Do vậy, bệnh viện luôn luôn trong tình<br /> Dùng tăm bông vô trùng quét lên bề mặt<br /> trạng quá tải, công suất sử dụng giường bệnh<br /> của các vị trí cần lấy mẫu trong nghiên cứu,<br /> vượt quá 100%, gây nhiều khó khăn cho công<br /> cho tăm bông vào các ống thu thập mẫu có<br /> tác phòng chống nhiễm khuẩn. Đây là nguy cơ chứa 5 ml canh thang LB chứa imipenem<br /> quan trọng làm lây lan vi khuẩn mang gen 2ml/ml và mang về phòng thí nghiệm.<br /> NDM - 1 giữa các bệnh nhân cũng như ra<br /> 4.2. Phân lập và định danh vi khuẩn<br /> ngoài môi trường bệnh viện và phát tán ra<br /> ngoài cộng đồng. Do vậy, chúng tôi tiến hành Ủ các ống canh thang chứa tăm bông ở<br /> 0<br /> nghiên cứu nhằm phát hiện sự có mặt của vi 37 C trong 6 - 8 giờ (giai đoạn tăng sinh trong<br /> khuẩn gram âm mang gen NDM-1 kháng car- môi trường kháng sinh) ưu tiên các vi khuẩn<br /> bapenem phân lập tại môi trường bệnh viện kháng carbapenem phát triển. Cấy chuyển từ<br /> năm 2011. Đây sẽ là một bằng chứng quan môi trường canh thang LB sang đĩa thạch Mac<br /> Conkey có nồng độ kháng sinh imipenem<br /> trọng, làm cơ sở cho các cơ quan chức năng<br /> 2ml/ml. Ủ 370C trong 18 - 24 giờ. Chọn 5 - 7<br /> đưa ra các giải pháp phù hợp để phòng chống<br /> khuẩn lạc mọc trên môi trường Mac Conkey<br /> sự lây lan của vi khuẩn này ở trong bệnh viện<br /> có chứa 2 mg/ml imipenem sau khi ủ ấm qua<br /> và cộng đồng.<br /> đêm cấy trên đĩa thạch LB (Luria - Bertani) ở<br /> II. ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP nhiệt độ 370C qua đêm. Sử dụng vi khuẩn<br /> thuần mọc trên thạch LB để tách triết DNA làm<br /> 1. Thiết kế: mô tả cắt ngang. khuôn mẫu cho phản ứng PCR phát hiện gen<br /> <br /> <br /> 2 TCNCYH 85 (5) - 2013<br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> <br /> NDM - 1 (phần 3) và định danh vi khuẩn bằng phương pháp pha loãng kháng sinh trong<br /> thanh định danh API - 20E (Bio-Merieux, Pháp). thạch Mueller - Hinton và kết quả sẽ được tính<br /> 4.3. Kỹ thuật PCR phát hiện gen NDM-1 toán dựa theo tiêu chuẩn của CLSI 2010 [9].<br /> và các gen kháng kháng sinh khác 4.5. Phân tích và xử lý số liệu: Các gen<br /> Lấy 3 - 4 khuẩn lạc trên đĩa thạch LB hòa chứng dương NDM - 1, được sử dụng để đánh<br /> vào 200µl nước cất vô trùng, đun cách thủy giá kết quả PCR của mẫu thử nghiệm, số liệu<br /> trong vòng 3 phút và ly tâm lấy nước nổi để được quản lý bằng phần mềm exel. Kết quả<br /> làm khuôn mẫu DNA. được trình bày dưới dạng hình và bảng biểu.<br /> Các đoạn mồi đặc hiệu: NDM1 - F (5’ -<br /> III. KẾT QUẢ<br /> atgcacccggtcgcgaagctgag - 3’) và NDM1 - R<br /> (5’-ttcgacccagccattggcggcga - 3’) được thiết Trong tổng số 200 mẫu xét nghiệm thu<br /> kế dựa trên trình tự gen chuẩn trong ngân thập tại các vị trí khác nhau tại bệnh viện Việt<br /> hàng gen (Mã số: FN396876.1) được sử dụng Đức chúng tôi phát hiện được 5 mẫu xét<br /> cho kỹ thuật PCR để phát hiện gen NDM - 1 nghiệm có vi khuẩn gram âm mang gen NDM<br /> của các chủng vi khuẩn phân lập được trong - 1 chiếm tỷ lệ 2,5%.<br /> nghiên cứu [1; 5; 6]. Chứng dương là ADN Các chủng có kết quả PCR dương tính với<br /> khuôn mẫu tách chiết từ chủng E. coli mang gen NDM - 1 được tiến hành định danh bằng<br /> gen NDM - 1 phân lập tại Nhật Bản do TS. thanh định danh API - 20E kết quả cho thấy có<br /> Shibayama, viện Quốc gia các bệnh Truyền 3 loại vi khuẩn mang gen NDM - 1 được phát<br /> nhiễm Nhật Bản cung cấp [8]. Thành phần hiện bao gồm 1 chủng A. baumannii, 2 chủng<br /> tham gia phản ứng PCR bao gồm: 25 µl Go E. aerogenes và 2 chủng Acinetobacter spp<br /> Taq Master Mix (Promega); 1µl hỗn hợp mồi; (bảng 1).<br /> 5µl khuôn mẫu DNA và 19µl nước cất. Chu<br /> Có ba loại mẫu được phát hiện có vi<br /> trình nhiệt: 940C trong 5 phút; 30 chu kỳ bao<br /> khuẩn mang gen NDM - 1 bao gồm ga trải<br /> gồm: 940C trong 36 giây, 600C trong 36 giây,<br /> giường bệnh nhân (3), nắp thùng rác y tế (1)<br /> 720C trong 1 phút; và 720C trong 5 phút. Sản<br /> và nắp toa lét nhà vệ sinh (1). Các vị trí xét<br /> phẩm PCR sẽ được điện di trên thạch 1,5%<br /> nghiệm khác như sàn giường bệnh, tủ cá<br /> trong dung dịch đệm TAE 1X, nhuộm thạch và<br /> nhân, xe đẩy y tế và tay nhân viên… đều cho<br /> chụp ảnh gel dưới ánh sáng tia UV [5; 6].<br /> kết quả âm tính.<br /> 4.4. Kỹ thuật ức chế nồng độ kháng<br /> Các mẫu dương tính đều được phát hiện ở<br /> sinh tối thiểu (MIC)<br /> hai khoa là phẫu thuật Tiết niệu và Gan mật là<br /> Năm loại kháng sinh bao gồm imipenem khoa đã được phát hiện có các bệnh nhân<br /> (IMP), meropenem (MEM), ceftazidime (CAZ), nhiễm khuẩn với các vi khuẩn mang gen NDM<br /> ciprofloxacin (CIP) và colistin (CS) (SIGMA) - 1 trước đó trong nghiên cứu của chúng tôi [5;<br /> được sử dụng để xác định nồng độ kháng 6]. Đặc biệt là tất cả các mẫu tại khoa phẫu<br /> sinh tối thiểu có khả năng ức chế vi khuẩn của thuật Tiêu hóa (không có bệnh nhân nhiễm vi<br /> các chủng vi khuẩn mang gen NDM - 1 bằng khuẩn NDM - 1) đều cho kết quả âm tính.<br /> <br /> <br /> <br /> <br /> TCNCYH 85 (5) - 2013 3<br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> <br /> <br /> <br /> <br /> Hình 1. Kết quả đại diện phát hiện gen NDM - 1 kháng carbapenem của<br /> các chủng vi khuẩn gram âm mang gen NDM - 1 phân lập tại môi trường bệnh viện<br /> Việt Đức năm 2011<br /> Giếng 1 - 6: Tay nhân viên điều dưỡng; 7 - 11: Ga giường bệnh nhân; 12 - 16: Nắp bệ xí; 17 -<br /> 21: Tủ đầu giường bệnh nhân; M: Thang chuẩn AND 100bp N: chứng âm và P: chứng dương.<br /> <br /> Bảng 1. Một số đặc điểm của 5 mẫu bệnh phẩm phát hiện có vi khuẩn<br /> mang gen NDM - 1 kháng carbapenem<br /> <br /> Có bệnh nhân<br /> Vị trí lấy mẫu<br /> Vi khuẩn Loại bệnh phẩm dương tính với<br /> (Khoa phòng)<br /> NDM - 1<br /> A. baumannii Ga giường bệnh Phẫu thuật gan mật Có<br /> E.aerogenes Nắp thùng rác y tế Phẫu thuật gan mật Có<br /> Acinetobacter spp Ga giường bệnh Phẫu thuật tiết niệu Có<br /> E.aerogenes Nắp toa lét Phẫu thuật tiết niệu Có<br /> Acinetobacter spp Ga giường bệnh Phẫu thuật tiết niệu Có<br /> <br /> <br /> Bảng 2. Kết quả kháng sinh đồ của các chủng vi khuẩn mang gen NDM - 1<br /> <br /> <br /> Đặc tính kháng MIC (mg/L) Gen<br /> Vi khuẩn<br /> IMP MEM CIP CAZ CS NDM - 1<br /> <br /> A. baumannii 256 (R) 128(R) 0.06(S) > 512 (R) 0,5 (S) +<br /> E.aerogenes 4 (R) 2 (I) 2 (I) > 512 (R) 0,5 (S) +<br /> Acinetobacter spp 128 (R) 64 (R) 2 (I) > 512 (R) 0,5 (S) +<br /> E.aerogenes 8 (R) 8 (R) 256 (R) > 512 (R) 0,5 (S) +<br /> Acinetobacter spp 128 (R) 64 (R) 2 (I) > 512 (R) 0,5 (S) +<br /> <br /> <br /> 4 TCNCYH 85 (5) - 2013<br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> <br /> Ghi chú: S: Nhạy cảm; I: đề kháng trung gian; R: kháng.<br /> <br /> Chúng tôi tiến hành thử nghiệm mức độ thuật Tiết niệu và Gan Mật trước đó đã phát<br /> nhạy cảm của các vi khuẩn mang gen NDM - hiện có bệnh nhân dương tính với vi khuẩn<br /> 1 phân lập được trong nghiên cứu với 5 loại mang gen NDM - 1 (khoa nguy cơ cao) và<br /> kháng sinh bao gồm imipenem và mero- khoa phẫu thuật Tiêu hóa chưa phát hiện có<br /> penem, đại diện cho nhóm carbapenem; bệnh nhân dương tính với vi khuẩn mang gen<br /> ceftazidime cho nhóm kháng sinh cepha- NDM - 1 (nguy cơ thấp hơn) để lấy mẫu xét<br /> losporin; ciprofloxacin cho nhóm fluoroqui- nghiệm. Các vị trí lấy mẫu cũng được lựa<br /> nolone là các thuốc đầu tay điều trị tại bệnh chọn các vị trí là có khả năng có vi khuẩn<br /> viện hiện nay và colistin là kháng sinh được mang gen NDM - 1 như ga trải giường bệnh,<br /> khuyến cáo trong trường hợp vi khuẩn mang nắp toa lét, sàn nhà, tay điều dưỡng viện hay<br /> gen NDM - 1 kháng lại với tất cả các loại các dụng cụ y tế…<br /> kháng sinh. Kết quả cho thấy, cả năm chủng Kết quả đã được chứng minh ở nghiên<br /> đều kháng lại với imipenem (từ 4 - 256mg/L); cứu này với 2,5% số mẫu xét nghiệm dương<br /> 4 chủng kháng với meropenem (8 - 128mg/L), tính với vi khuẩn mang gen NDM - 1. Đây là<br /> 1 chủng E.aerogenes kháng meropenem ở một kết quả cao đáng báo động. Các mẫu<br /> mức độ trung gian (2mg/L). Một chủng dương tính đều được phát hiện tại hai khoa<br /> E.aerogenes kháng ciprofloxacine ở nồng độ đã có bệnh nhân dương tính với loại vi khuẩn<br /> 256mg/L; ba chủng bao gồm E. aerogenes này. Các mẫu xét nghiệm dương tính đều là<br /> (1), Acinetobacter spp (2) kháng ciproflox- các mẫu có nguy cơ cao như ga trải giường<br /> acine ở mức độ trung gian 2mg/L và chủng A. bệnh nhân, nắp toa lét nhà vệ sinh (các dịch<br /> baumannii vẫn còn nhạy cảm với ciproflox- như nước tiểu, vết mổ… của bệnh nhân bị<br /> acin. Tất các các chủng vi khuẩn mang gen nhiễm với vi khuẩn mang gen NDM - 1 có thể<br /> NDM - 1 đều kháng với ceftazidim (512mg/L) dính vào) hay nắp thùng rác y tế có chứa các<br /> và vẫn còn nhạy cảm với colistin (bảng 2). bông băng hay dịch từ các bệnh nhân dương<br /> tính. Một số mẫu xét nghiệm khác cũng có<br /> IV. BÀN LUẬN<br /> nguy cơ cao như tay nhân viên điều dưỡng<br /> Bệnh viện Việt Đức là bệnh viện đầu tiên ở (tiếp xúc trực tiếp và thường xuyên hơn với<br /> Việt Nam công bố sự có mặt của vi khuẩn bệnh nhân), sàn buồng bệnh (dịch nhiễm<br /> gram âm mang gen NDM - 1 kháng carbap- khuẩn chảy ra)… đều cho kết quả âm tính.<br /> enem phân lập trên các bệnh nhân nhiễm Điều này có thể giải thích như sau. Các nhân<br /> khuẩn bệnh viện [5;6]. Như đã trình bày ở viên điều dưỡng sau khi chăm sóc bệnh nhân<br /> trên, đây là bệnh viện ngoại khoa đầu ngành, đều đeo găng tay, sàn buồng bệnh đều được<br /> hàng năm thực hiện nhiều ca phẫu thuật và lau 2 lần/ ngày với các dung dịch khử khuẩn<br /> luôn trong tình trạng quá tải, do vậy giả thuyết và các vị trí xét nghiệm khác như bàn và tủ<br /> nghiên cứu của chúng tôi là khi đã có các ca cá nhân không tiếp xúc thường xuyên so với<br /> bệnh nhiễm khuẩn mang gen NDM - 1 thì khả các mẫu xét nghiệm dương tính nên chúng<br /> năng có mặt của vi khuẩn mang gen NDM - 1 tôi không phát hiện được. Các chủng vi khuẩn<br /> trong môi trường bệnh viện là rất cao. Nghiên mang gen NDM - 1 trong nghiên cứu đã kháng<br /> cứu này chúng tôi lựa chọn hai khoa phẫu lại kháng sinh được thử nghiệm như<br /> <br /> <br /> TCNCYH 85 (5) - 2013 5<br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> <br /> imipenem, meropenem và ceftazidime, tuy enem trong môi trường bệnh viện Việt Đức -<br /> nhiên một chủng A. baumannii vẫn còn nhạy Hà Nội với tỷ lệ 2,5% (5/200 mẫu xét nghiệm),<br /> cảm hoàn toàn với ciprofloxacin. Cả năm đây là bệnh viện đã xác định được có các<br /> chủng đều nhạy cảm với colistin. Điều này cho bệnh nhân nhiễm khuẩn bệnh viện do các vi<br /> thấy cần phải thử nghiệm tính nhạy cảm khuẩn mang gen NDM - 1.<br /> kháng sinh để lựa chọn kháng sinh phù hợp<br /> Lời cám ơn<br /> để điều trị cũng như theo dõi sự thay đổi<br /> tính nhạy cảm với kháng sinh của các vi Nghiên cứu này sử dụng kinh phí của Well-<br /> khuẩn mang gen NDM - 1 trong bệnh viện và come Trust, UK và the Global Antibiotic Resis-<br /> cộng đồng. tance Partnership, USA, chủ nhiệm đề tài: TS.<br /> Ở trong môi trường bệnh viện có rất nhiều Trần Như Dương.<br /> loại vi khuẩn khác nhau bao gồm cả các vi<br /> TÀI LIỆU THAM KHẢO<br /> khuẩn kháng carbapenem, do vậy để nâng<br /> cao khả năng phát hiện, chúng tôi sử dụng 1. Yong D, Toleman MA, Walsh TR<br /> các môi trường tăng sinh và chọn lọc có chứa (2009). Characterization of a new metallo-<br /> impenem để ức chế và ưu tiên cho các vi beta-lactamase gene, bla (NDM-1), and a<br /> khuẩn kháng carbapenem phát triển và lựa novel erythromycin esterase gene carried on a<br /> chọn nhiều khuẩn lạc khác nhau trong một unique genetic structure in Klebsiella pneumo-<br /> mẫu xét nghiệm sẽ tăng khả năng phát hiện, niae sequence type 14 from India, Antimicrob<br /> đây là một phương pháp tốt cần được áp Agents Chemother, 53(12), 5046 - 5054.<br /> dụng để giám sát và phát hiện vi khuẩn mang 2. Kumarasamy KK, Toleman MA, Walsh<br /> gen NDM - 1 trong môi trường. TR (2010). Emergence of a new antibiotic<br /> Việc phát hiện ra các chủng vi khuẩn mang resistance mechanism in India, Pakistan,<br /> gen NDM - 1 trong môi trường bệnh viện Việt and the UK: a molecular, biological, and epi-<br /> Đức của nghiên cứu này là một vấn đề quan demiological study, Lancet Infect Dis. 10(9),<br /> trọng, nó cho thấy nguy cơ lây nhiễm các vi 597 - 602.<br /> khuẩn này không chỉ trong phạm vi bệnh viện 3. Walsh TR, Weeks J, Toleman MA<br /> mà có khả năng phát tán ra ngoài cộng đồng, (2011). Dissemination of NDM - 1 positive<br /> điều này đã được chứng minh bằng nghiên bacteria in the New Delhi environment and its<br /> cứu của Isozumi và cộng sự về sự có mặt của implications for human health: an environ-<br /> vi khuẩn mang gen NDM - 1 trong môi trường mental point prevalence study. Lancet Infect<br /> ngoại cảnh tại Hà Nội [7]. Do vậy, cần phải Dis, 11, 355 - 362.<br /> nâng cao công tác phòng chống nhiễm khuẩn 4. Global Antibiotic Resistance Partner-<br /> bệnh viện, và giám sát chặt chẽ vi khuẩn ship (GARP) Working Group Vietnam<br /> mang gen NDM - 1 trên các bệnh nhân nhiễm (2010). Situation Analysis on Antibiotic Use<br /> khuẩn bệnh viện trong môi trường và ở ngoài and Resistance in Vietnam. GARP report<br /> cộng đồng. Vietnam.<br /> 5. Trần Huy Hoàng, Nguyễn Hoài Thu,<br /> V. KẾT LUẬN Nguyễn Bình Minh và cộng sự (2012). Citro-<br /> Đã phát hiện được sự có mặt của vi khuẩn bacter freundii mang gen New Delhi-Metallo-<br /> gram âm mang gen NDM - 1 kháng carbap- Beta-Lactamase (NDM - 1) kháng carbap-<br /> <br /> <br /> 6 TCNCYH 85 (5) - 2013<br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> <br /> enem phân lập tại bệnh viện năm 2010 - 2011, Emerging Infectious Diseases lett, 18 (8),<br /> Tạp chí Y học Dự phòng, 6(133), 23 - 30. 1383 - 1385.<br /> <br /> 6. Tran Huy Hoang, Heiman Wertheim, 8. Shingo Chihara, Katsuko Okuzumi,<br /> Nguyen Binh Minh et al (2013). Carbap- and Akira Hishinuma (2011). First Case of<br /> enem-Resistant Escherichia coli and Kleb- New Delhi Metallo-b-Lactamase 1 Producing<br /> siella pneumoniae Strains Containing New Escherichia coli Infection in Japan. Clinical<br /> Delhi Metallo-Beta-Lactamase Isolated from Infectious Diseases, 52,153 - 154.<br /> Two Patients in Vietnam. J. Clin. Microbiol. 51 9. Clinical and Laboratory Standards<br /> (1), 373 - 374. Institute (2010). Performance standards for<br /> 7. Isozumi R, Yoshimatsu K, Yamashiro antimicrobial susceptibility testing; Twentieth<br /> T et al (2012). blaNDM-1 – positive Klebsiella informational supplement. Clinical and Labora-<br /> pneumoniae from Environment, Vietnam. tory Standards Institure, 30. Wayne, PA.<br /> <br /> Summary<br /> GRAM NEGATIVE BACTERIA CARRYING NEW<br /> DELHI - METALLO - BETA - LACTAMASE (NDM - 1)<br /> GENE ISOLATED IN THE HOSPITAL ENVIRONMENT<br /> <br /> Gram-negative bacteria resistance to carbapenems due to the expression of the New Delhi<br /> metallo-beta-lactamase 1 (NDM - 1) gene are one of the major global health problems. Previ-<br /> ously, NDM-1 positive bacteria have been reported in bacteria isolated from both clinical and<br /> environmental samples in Vietnam. To investigate whether NDM - 1 positive bacteria contamina-<br /> tion exits in the Viet Duc Hospital, we collected 200 samples from 8 major sites often directly in<br /> contact with patients such as the nurse hands, medical trolleys, floor surfaces, patient bed sheets,<br /> toilet covers, and medical equipment, plus other minor sites such office table tops and telephone<br /> in three surgical departments (urology, gastro-enterology and hepato-biliary surgery). Samples<br /> were transported to the microbiology laboratory and tested for carabapenem resistance and the<br /> presence of the NDM - 1 gene by PCR. NDM - 1 positive bacteria were further identified by<br /> biochemical testing (API-20E strip, Biomerieux) and susceptibility testing. The results shown:<br /> 5/200 (2.5%) samples positive with the NDM - 1 gene, three samples were patient bed sheet, one<br /> was from cover of medical bin-wash disposal, and one in toilet cover in Urology and Hepato-<br /> biliary Surgery departments. All of positive NDM - 1 were extensively drug resistant, but remained<br /> susceptible to colistin.<br /> <br /> Keywords: Gram-negative bacteria, NDM-1 gene, carbapenem resistant, hospital<br /> environment<br /> <br /> <br /> <br /> <br /> TCNCYH 85 (5) - 2013 7<br />



Đồng bộ tài khoản