intTypePromotion=1

Xây dựng quy trình khuếch đại và giải trình tự gen APC

Chia sẻ: Trần Thị Hạnh | Ngày: | Loại File: PDF | Số trang:7

0
31
lượt xem
2
download

Xây dựng quy trình khuếch đại và giải trình tự gen APC

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Nghiên cứu được thực hiện với mục tiêu nhằm xây dựng quy trình khuếch đại toàn bộ 15 exon của gen APC bằng phản ứng PCR và giải trình tự gen APC. DNA được tách chiết từ máu ngoại vi của 15 người khỏe mạnh. Các exon của gen được khuếch đại bằng 29 cặp mồi, sản phẩm PCR sau đó được giải trình tự bằng máy tự động. Kết quả được phân tích bằng phần mềm chuyên dụng.

Chủ đề:
Lưu

Nội dung Text: Xây dựng quy trình khuếch đại và giải trình tự gen APC

Nghiên cứu Y học <br /> <br /> Y Học TP. Hồ Chí Minh * Tập 18 * Số 4 * 2014<br /> <br /> XÂY DỰNG QUY TRÌNH KHUẾCH ĐẠI VÀ GIẢI TRÌNH TỰ GEN APC <br /> Đoàn Nam Khánh*, Nguyễn Ngọc Minh**, Lê Minh Khôi**, Nguyễn Trung Tín**, Đỗ Thị Thanh Thủy**, <br /> Lê Thị Hương Lan***, Nguyễn Thị Băng Sương** <br /> <br /> TÓM TẮT <br /> Giới thiệu: Gen APC (adenomatous polyposis coli gene) là một gen ức chế khối u gồm 15 exon nằm tại vị <br /> trí 5q21‐q22, sản phẩm dịch mã của gen là protein APC dài 2843 acid amin. Protein APC với vai trò chính là cô <br /> lập các hiệu ứng kích thích tăng trưởng của Beta‐catenin nhằm thúc đẩy sự chết theo chương trình của tế bào. <br /> Người mang gen APC bị đột biến sẽ dẫn đến một số bệnh liên quan như bệnh đa polyp đại trực tràng, bệnh ung <br /> thư hệ tiêu hóa, các tuyến, các cơ quan (não, gan, tuyến thượng thận, tuyến tụy, tuyến giáp,…) và một số bệnh <br /> bẩm sinh khác. <br /> Mục tiêu: Xây dựng quy trình khuếch đại toàn bộ 15 exon của gen APC bằng phản ứng PCR và giải trình <br /> tự gen APC.  <br /> Đối tượng và phương pháp: DNA được tách chiết từ máu ngoại vi của 15 người khỏe mạnh. Các exon của <br /> gen được khuếch đại bằng 29 cặp mồi, sản phẩm PCR sau đó được giải trình tự bằng máy tự động. Kết quả <br /> được phân tích bằng phần mềm chuyên dụng.  <br /> Kết quả: Xây dựng thành công quy trình PCR khuếch đại 15 exon của gen APC với nhiệt độ bắt cặp tối ưu <br /> là 59 C, độ nhạy của quy trình là 1 ng/ μL. Sản phẩm giải trình tự cho kết quả tương đồng với trình tự gen APC <br /> chuẩn trên NCBI. <br /> o<br /> <br /> Kết luận: Xây dựng thành công quy trình khuếch đại và giải trình tự toàn bộ gen APC.  <br /> Từ khóa: gen APC, khuếch đại gen, quy trình giải trình tự. <br /> <br /> ABSTRACT <br /> ESTABLISH PROTOCOL FOR AMPLIFICATION AND SEQUENCING APC GENE <br /> Doan Nam Khanh, Nguyen Ngoc Minh, Le Minh Khoi, Nguyen Trung Tin, Do Thi Thanh Thuy,  <br /> Le Thi Huong Lan, Nguyen Thi Bang Suong * Y Hoc TP. Ho Chi Minh * Vol. 18 ‐ No 4 ‐ 2014: 100 ‐ 106 <br /> Introduction: APC (adenomatous polyposis coli) is a tumor suppressor gene. It contains 15 exons locating <br /> at  5q21‐q22.  The  2843  amino‐acid  APC  protein  plays  an  important  role  in  regulating  the  Beta‐catein  growth <br /> signal  factor  and  leads  cells  to  normal  apoptosis.  Mutations  in  APC  gene  cause  colorectal  polyposis  diseases, <br /> cancer diseases in digestive system, in Endocrine System (pancreas, thyroid, adrenal gland) and cancer in other <br /> organs (brain, liver,…). <br /> Aim: Establish protocol to amplify all 15 exons of APC gene by PCR method, then identify all sequences of <br /> APC gene. <br /> Objects and Methods: DNA was extracted from peripheral blood of 15 healthy people. 15 exons of APC <br /> gene were ampliflied by 29 pairs of primer, then sequenced by ABI system. Results were analysed by specialist <br /> software.  <br /> Results: PCR method for amplifying 15 exons of APC gene was optimized with annealing temperature at <br /> 59 C and protocol has sensitivity of 1 ng /μL. Sequencing products are identical to standard sequence database of <br /> APC gene from NCBI genbank.  <br /> o<br /> <br /> * Khoa Sinh học, Đại học Quốc gia TP. Hồ Chí Minh, <br />  ** Đại học Y Dược TP.Hồ Chí Minh, <br /> *** Khoa Hóa sinh, Bệnh viện Đa khoa Trung ương Thái Nguyên <br /> Tác giả liên lạc: TS. BS. Nguyễn Thị Băng Sương,   ĐT: 0913281386, Email: suongnguyenmd@gmail.com <br /> <br /> 100<br /> <br /> Y Học TP. Hồ Chí Minh * Tập 18 * Số 4 * 2014<br /> <br /> Nghiên cứu Y học<br /> <br /> Conclusion: We have successfully established the protocol for amplifying and identifying all sequences of <br /> APC gene.  <br /> Key words: APC gene, amplify gene, sequencing protocol. <br /> việc chẩn đoán sớm đột biến gene APC sẽ giúp <br /> ĐẶT VẤN ĐỀ <br /> người  bệnh,  đặc  biệt  là  người  thân  của  bệnh <br /> Gen APC (adenomatous polyposis coli gene) <br /> nhân <br /> có  thể  chủ  động  trong  việc  thăm  khám <br /> là  một  gen ức  chế  khối u  có  tổng  cộng  15  exon <br /> định kỳ các bệnh ung thư liên quan(2,5). Theo cơ <br /> nằm trên cánh dài của NST số 5. Trong đó exon <br /> sở dữ liệu về các đột biến gen APC được công bố <br /> 15 có kích thước lớn nhất, bao gồm 6574 bp (base <br /> hiện nay, có khoảng 96% các đột biến là đột biến <br /> pair),  chiếm  75%  trình  tự  mã  hóa  protein  của <br /> nhỏ nằm rải rác trên toàn bộ chiều dài gen, trong <br /> gen.  Gen  APC  tổng  hợp  protein  APC  dài  2843 <br /> đó có 38% là đột biến điểm. Với các đột biến nhỏ, <br /> acid  amin(2,3).  Protein  APC  tham  gia  vào  con <br /> xảy  ra  trên  1  exon,  phương  pháp  hiệu  quả  và <br /> đường  truyền  tín  hiệu  Wnt  điều  hòa  quá  trình <br /> chính  xác  nhật  để  xác  định  đột  biến  gen  là <br /> phân chia tế bào và đổi mới tổ chức mô. Sự kết <br /> phương  pháp  giải  trình  tự.  Bằng  cách  sử  dụng <br /> hợp giữa protein APC và beta‐catenin trong con <br /> phản ứng PCR khuếch đại 15 exon của gen APC <br /> đường tín hiệu này sẽ phân hủy, ức chế vai trò <br /> và  kỹ  thuật  giải  trình  tự  toàn  bộ  các  exon  này, <br /> của  beta‐catenin,  điều  hòa  quá  trình  phân  chia <br /> chúng tôi tiến hành chuẩn hóa các điều kiện cần <br /> và hướng tế bào đến sự chết theo chương trình(1). <br /> thiết  để  thực  hiện  đề  tài:  “Xây  dựng  quy  trình <br /> Việc mất chức năng của protein APC do đột biến <br /> khuếch đại và giải trình tự gen APC ”. <br /> dòng mầm trong gen làm tích tụ quá mức Beta‐<br /> catenin  trong  tế  bào,  kích  thích  sự  phát  triển, <br /> phân  chia  không  kiểm  soát  của  tế  bào  và  dẫn <br /> đến  sự  hình  thành  của  các  khối  u(2).  Đa  số  đột <br /> biến gen APC là đột biến vô nghĩa hoặc gây lệch <br /> khung dịch mã, điều này dẫn đến protein APC <br /> bị cắt ngắn, mất chức năng ức chế khối u(6). Do <br /> đó, người mang gen APC bị đột biến sẽ có nguy <br /> cơ cao mắc một số bệnh liên quan như bệnh đa <br /> polyp tuyến gia đình (FAP) với hàng trăm polyp <br /> trong  đại  trực  tràng  và  95‐100%  nguy  cơ  tiến <br /> triển  thành  ung  thư  đại  trực  tràng  dưới  40 <br /> tuổi(2,5). Ngoài ra, đột biến gen APC còn gây các <br /> bệnh như bệnh đa polyp tuyến thể nhẹ (AFAP) <br /> có số lượng polyp ít hơn trong khoảng 10 – 100 <br /> polyp(2); u xương lành tính; thêm, mất răng hoặc <br /> răng mọc ngầm dưới hàm; phì đại biểu mô sắc <br /> tố  võng  mạc  bẩm  sinh  (CHRPE)  và  nhiều  bệnh <br /> ung thư khác; cá biệt như ung thư gan ở trẻ em <br /> dưới 5 tuổi(2,5). <br /> Đột  biến  dòng  mầm  trong  gen  APC  là  đột <br /> biến trội nên chỉ cần có đột biến ở một trong hai <br /> allen  cũng  có  khả  năng  gây  bệnh,  nếu  không <br /> được phát hiện kịp thời thì bệnh sẽ chuyển sang <br /> các giai đoạn muộn, gây khó khăn cho quá trình <br /> điều trị, cũng như tỷ lệ sống sót thấp(1,3). Do đó, <br /> <br /> ĐỐI TƯỢNG ‐ PHƯƠNG PHÁP NGHIÊN CỨU <br /> Đối tượng nghiên cứu <br />  Mẫu  máu  của  15  người  khỏe  mạnh  không <br /> có họ hàng, không bị bệnh đường tiêu hóa. Gia <br /> đình không có tiền sử ung thư đại trực tràng. <br /> Phương pháp nghiên cứu <br /> <br /> Thiết kế và kiểm tra mồi <br /> Dùng  phần  mềm  LightScanner  Primer <br /> Design thiết kế các cặp mồi đặc hiệu khuếch đại <br /> 15  exon  của  gene  APC  và  quanh  vị  trí  splicing. <br /> Mồi sau khi thiết kế sẽ được kiểm tra bằng phần <br /> mềm  SNPCheck3  (kiểm  tra  sự  hiện  diện  của <br /> SNP trên mồi), dùng công cụ OligoAnalyzer 3.1 <br /> của IDT® để kiểm tra các giá trị ΔG của cấu trúc <br /> thứ  cấp.  Các  giá  trị  về  chiều  dài,  %  GC,  Tm, <br /> chiều dài của mồi đều được kiểm tra khi thiết kế <br /> mồi  trên  phần  mềm  LightScanner  Primer <br /> Design.  Tính  đặc  hiệu  của  mồi  được  kiểm  tra <br /> bằng công cụ Primer‐BLAST trên NCBI. <br /> Kỹ thuật tách chiết DNA từ máu ngoại vi <br />  Máu  ngoại  vi  khi  thu  nhận  được  giữ  trong <br /> ống chống đông bằng EDTA nắp xanh dương và <br /> được ly trích trong vòng 24 giờ. Sử dụng bộ kit <br /> <br /> 101<br /> <br /> Y Học TP. Hồ Chí Minh * Tập 18 * Số 4 * 2014<br /> <br /> Nghiên cứu Y học <br /> QiAamp DNA blood mini kit của hãng Qiagen – <br /> Đức  để  ly  trích  DNA.  Sản  phẩm  ly  trích  được <br /> tiến  hành  kiểm  tra  độ  nguyên  vẹn  của  mạch <br /> bằng phương pháp điện di trên gel agarose 3%, <br /> đo  nồng  độ  và  độ  tinh  sạch  bằng  máy <br /> NanoDrop 2000.  <br /> <br /> Kỹ thuật khuếch đại các exon của gen APC <br /> Dùng  phương  pháp  PCR  khuếch  đại  gen <br /> APC (máy Gene Amp PCR System 9700‐USA).  <br /> Thành  phần  của  phản  ứng  PCR  gồm  20  μl <br /> chứa  các  thành  phần:  DNA  khuôn;  0,2  mmol/L <br /> dNTP; 1,5 mmol/L Mg++; 0,1‐0,2 μmol/L primer <br /> và 1‐1,5 đơn vị Taq polymerase. <br /> Chu  trình  nhiệt  của  phản  ứng:  Biến  tính  ở <br /> 94°C trong 5 phút, tiếp theo là 35‐40 chu kỳ gồm <br /> biến  tính  ở  94°C  trong 30  giây;  gắn mồi  ở  60°C <br /> KẾT QUẢ NGHIÊN CỨU <br /> <br /> trong 30 giây và bước kéo dài 72°C trong 30 giây, <br /> cuối cùng là giai đoạn hoàn chỉnh ở 72°C trong 5 <br /> phút và bảo quản tạm thời ở 4°C. <br /> Kết quả PCR sau đó được kiểm chứng bằng <br /> phương pháp điện di trên gel agarose 1,5%. <br /> <br /> Kỹ thuật giải trình tự gen <br /> Thực  hiện  phản  ứng  cycle  sequencing  với <br /> BigDye  version  3.1  của  công  ty  Applied <br /> Biosystems,  theo  2  chiều  xuôi  và  ngược,  giải <br /> trình tự DNA (máy sequencer ABI 3500). <br /> Phân tích kết quả giải trình tự <br /> Kết  quả  giải  trình  tự  được  phân  tích  bằng <br /> phần  mềm CLC  Main Workbench 5  và  so  sánh <br /> với trình tự gen APC chuẩn có mã trình tự tham <br /> chiếu trên NCBI là NG_008481.4. <br /> <br /> Kết quả thiết kế mồi và kiểm tra mồi <br /> Bảng 1: Các cặp mồi thiết kế để khuếch đại 15 exon của gen APC và các thông số của mồi <br /> Exon<br /> 1<br /> 2<br /> 3<br /> 4<br /> 5<br /> 6<br /> 7<br /> 8<br /> 9<br /> 10<br /> 11<br /> 12<br /> 13<br /> <br /> 102<br /> <br /> Mồi<br /> <br /> Trình tự mồi<br /> <br /> Kích thước mồi<br /> <br /> Tm<br /> <br /> % gc<br /> <br /> Xuôi<br /> Ngược<br /> Xuôi<br /> Ngược<br /> Xuôi<br /> Ngược<br /> Xuôi<br /> Ngược<br /> Xuôi<br /> Ngược<br /> Xuôi<br /> Ngược<br /> Xuôi<br /> Ngược<br /> Xuôi<br /> Ngược<br /> Xuôi<br /> Ngược<br /> Xuôi<br /> Ngược<br /> Xuôi<br /> Ngược<br /> Xuôi<br /> Ngược<br /> Xuôi<br /> Ngược<br /> <br /> GAGTTTTGTTTCCTTTACCCCT<br /> GTGTCTTACCTCAAGTTTACAAGAG<br /> CGTGCTTTGAGAGTGATCTGA<br /> TGGATCTACACACCTAAAGATGAC<br /> TGTTTTCAGTCATGTATATTTGTGGT<br /> GCTCTAAGTGTAAGCTATCACCT<br /> CTGATGTAAGTATTGCTCTTCTGC<br /> ATTCACGCCTAAAGTTGGGTA<br /> TCCAGATTGAGTCTGACACCTA<br /> GGGGAAATGAATATGGTAAAGACAC<br /> GCTTTTAAGTGGTAGCCATAGTATG<br /> GAACATCTATATTTCAATGGTGTCACA<br /> GCCTTGGGCTAAGAAAGC<br /> TGGTTCTGAATGCTTCTGGAAA<br /> CAGACACTTCATTTGGAGTACCTTA<br /> CTGGGATTACAGGTGTGAGC<br /> CATCACTTAATTGGTTTTTGGCT<br /> CTCCTCTTAGTCATAAAGACAGC<br /> CTTAGTCAAGGGCAGATGAGT<br /> GCTGATAACAGAAGTTGGTGG<br /> GGGTGGAGAAACTGGCATAAA<br /> CGAATGTGAAGCACAGGTTT<br /> CCTGTTGCTTATCATTTCTCACC<br /> GCACAACTGCCCTCTAAG<br /> GATAGGATTACAGGCGTGAGTCA<br /> TCATGGCTAAAAGAAGGCAGC<br /> <br /> 22<br /> 25<br /> 21<br /> 24<br /> 26<br /> 23<br /> 24<br /> 21<br /> 22<br /> 25<br /> 25<br /> 27<br /> 18<br /> 22<br /> 25<br /> 20<br /> 23<br /> 23<br /> 21<br /> 21<br /> 21<br /> 20<br /> 23<br /> 18<br /> 23<br /> 21<br /> <br /> 60,1<br /> 59,9<br /> 60,7<br /> 60,4<br /> 60,4<br /> 60,6<br /> 60,1<br /> 60,4<br /> 60,0<br /> 60,5<br /> 60,4<br /> 60,5<br /> 59,9<br /> 61,2<br /> 60,4<br /> 61,3<br /> 60,8<br /> 60,2<br /> 60,5<br /> 60,4<br /> 60,9<br /> 60,9<br /> 60,3<br /> 60,1<br /> 60,8<br /> 61,2<br /> <br /> 40,9<br /> 40,0<br /> 47,6<br /> 41,7<br /> 30,8<br /> 43,5<br /> 41,7<br /> 42,9<br /> 45,5<br /> 40,0<br /> 40,0<br /> 33,3<br /> 55,6<br /> 40,9<br /> 40,0<br /> 55,0<br /> 34,8<br /> 43,5<br /> 47,6<br /> 47,6<br /> 47,6<br /> 45,0<br /> 43,5<br /> 55,6<br /> 47,8<br /> 47,6<br /> <br /> Chiều dài sản phẩm<br /> 320 bp<br /> 272 bp<br /> 444 bp<br /> 329 bp<br /> 503 bp<br /> 274 bp<br /> 307 bp<br /> 283 bp<br /> 557 bp<br /> 467 bp<br /> 507 bp<br /> 422 bp<br /> 335 bp<br /> <br /> Y Học TP. Hồ Chí Minh * Tập 18 * Số 4 * 2014<br /> Exon<br /> 14<br /> 15 – A<br /> 15 – B<br /> 15 – C<br /> 15 – D<br /> 15 – E<br /> 15 – F<br /> 15 – G<br /> 15 – H<br /> 15 – I<br /> 15 – J<br /> 15 – K<br /> 15 – L<br /> 15 – M<br /> 15 – N<br /> 15 – O<br /> <br /> Mồi<br /> <br /> Trình tự mồi<br /> <br /> Xuôi<br /> ATTTACCAGTGAGGGACGG<br /> Ngược<br /> GGGCTACACCTCTCAACTATAA<br /> Xuôi<br /> ATGCCTTTTGTCTTCTATCCTTT<br /> Ngược GCCAGTATTAAAATTGTCTGACCTAT<br /> Xuôi<br /> AAGCCCTAGAAGCAGAATTAGA<br /> Ngược<br /> ATTTGGCATAAGGCATAGAACA<br /> Xuôi<br /> TGGGTCTACCACTGAATTACATTG<br /> Ngược<br /> CCGTGACCTGTATGGAGAAACA<br /> Xuôi<br /> AATGAAAGATGGGCAAGACC<br /> Ngược<br /> AGGCTGACCACTTCTACT<br /> Xuôi<br /> ATCTGGACAAAGCAGTAAAACC<br /> Ngược<br /> GAACGACTCTCAAAACTATCAAGTG<br /> Xuôi<br /> CAAAGCTGTTGAATTTTCTTCAGG<br /> Ngược<br /> TTCTTTAGGCTGCTCTGATTCTG<br /> Xuôi<br /> GAGCCATTTATACAGAAAGATGTGG<br /> Ngược<br /> TTCAAATTCACCTGACTGTGC<br /> Xuôi<br /> GGGACACCTATAAACTTTTCCACA<br /> Ngược<br /> AGCAAAACTTCCTCTGACTCTA<br /> Xuôi<br /> CTTCACCAGTAAAACCTATACCACA<br /> Ngược<br /> AGAGAACTCAGAGAGGAATTATGAG<br /> Xuôi<br /> AAGACATACCAGACAGAGGG<br /> Ngược<br /> GGGAAAGGATGGAATCTGAATCA<br /> Xuôi<br /> GAACATGGTCTATCCCCTGATTC<br /> Ngược<br /> GGCTTAATTCTGATTTCACAGATGG<br /> Xuôi<br /> CCTCAAGTACAAGTCCTGTTTC<br /> Ngược<br /> CTGATCTATCAGATTCACTTCCAC<br /> Xuôi<br /> GGTTTATCCAAGAATGCCAGTAG<br /> Ngược<br /> CTTCTCCAAGTGCTTACTCG<br /> Xuôi<br /> CGGTCTCATTCTGAAAGTCCT<br /> Ngược<br /> GGAGATCAGGCGATTTTCC<br /> Xuôi<br /> CAGAAAAGGCAAATCCAAACAT<br /> Ngược CCCTCTAACAAGAATCAAACCTATTTAC<br /> <br /> Nhận  xét:  Các  mồi  có  chiều  dài  20  ‐  30  bp. <br /> Nhiệt độ biến tính (Tm) không chênh lệch nhiều <br /> (59.9  oC ‐ 61.2  oC), thuận lợi cho việc chọn nhiệt <br /> độ bắt cặp chung cho cả 29 cặp mồi. Kích thước <br /> đoạn khuếch đại từ 272 – 600 bp. Đa số các mồi <br /> có tỷ lệ GC cao trên 40%, một số ít trên 30%. Các <br /> giá trị ΔG đều đạt yêu cầu. Kết quả kiểm tra SNP <br /> trên mồi cho thấy tất cả các mồi đều không chứa <br /> SNP  ở  đầu  3’  do  đó  sẽ  không  làm  ảnh  hưởng <br /> đến hoạt động của enzyme polymerase. Kết quả <br /> primerBlast trên NCBI ở các mồi đều có độ đặc <br /> hiệu cao.  <br /> <br /> Nghiên cứu Y học<br /> Kích thước mồi<br /> <br /> Tm<br /> <br /> % gc<br /> <br /> 19<br /> 22<br /> 23<br /> 26<br /> 22<br /> 22<br /> 24<br /> 22<br /> 20<br /> 18<br /> 22<br /> 25<br /> 24<br /> 23<br /> 25<br /> 21<br /> 24<br /> 22<br /> 25<br /> 25<br /> 20<br /> 23<br /> 23<br /> 25<br /> 22<br /> 24<br /> 23<br /> 20<br /> 21<br /> 19<br /> 22<br /> 28<br /> <br /> 60,9<br /> 60,1<br /> 60,1<br /> 60,8<br /> 60,7<br /> 60,2<br /> 60,9<br /> 60,8<br /> 60,3<br /> 60,0<br /> 59,9<br /> 60,0<br /> 60,0<br /> 60,7<br /> 61,0<br /> 60,1<br /> 60,4<br /> 60,8<br /> 60,4<br /> 60,8<br /> 60,2<br /> 60,1<br /> 61,2<br /> 61,1<br /> 61,0<br /> 60,6<br /> 60,6<br /> 60,7<br /> 60,9<br /> 59,9<br /> 60,9<br /> 60,3<br /> <br /> 52,6<br /> 45,5<br /> 34,8<br /> 34,6<br /> 40,9<br /> 36,4<br /> 41,7<br /> 50,0<br /> 45,0<br /> 50,0<br /> 40,9<br /> 40,0<br /> 37,5<br /> 43,5<br /> 40,0<br /> 42,9<br /> 41,7<br /> 40,9<br /> 40,0<br /> 40,0<br /> 50,0<br /> 43,5<br /> 47,8<br /> 40,0<br /> 45,5<br /> 41,7<br /> 43,5<br /> 50,0<br /> 47,6<br /> 52,6<br /> 36,4<br /> 35,7<br /> <br /> Chiều dài sản phẩm<br /> 577 bp<br /> 578 bp<br /> 588 bp<br /> 598 bp<br /> 594 bp<br /> 597 bp<br /> 586 bp<br /> 519 bp<br /> 582 bp<br /> 598 bp<br /> 600 bp<br /> 586 bp<br /> 579 bp<br /> 551 bp<br /> 585 bp<br /> 598 bp<br /> <br /> Kết quả chuẩn hóa phản ứng PCR <br /> <br /> Nhiệt độ bắt cặp mồi <br /> Nhiệt  độ  bắt  cặp  mồi  được  khảo  sát  nằm <br /> trong  khoảng  55oC  ‐  61oC.  Khảo  sát  nhằm  xác <br /> định nhiệt độ tối ưu cho mồi bắt cặp đặc hiệu lên <br /> DNA mạch khuôn. Các mức nhiệt độ cách nhau <br /> 2oC  để  đảm  bảo  ý  nghĩa  của  các  nghiệm  thức <br /> khảo sát. Khảo sát được tiến hành lặp lại 3 lần ở <br /> tất cả các cặp mồi. Do kết quả khảo sát ở tất cả <br /> các cặp mồi đều khá tương đồng nên chúng tôi <br /> chỉ đưa ra kết quả của cặp mồi khuếch đại exon <br /> 15‐A trong khảo sát.  <br /> Cả  4  mức  nhiệt  độ  gắn  mồi  khảo  sát  đều <br /> cho  vạch  điện  di  có  kích  thước  đúng  với  kích <br /> <br /> 103<br /> <br /> Y Học TP. Hồ Chí Minh * Tập 18 * Số 4 * 2014<br /> <br /> Nghiên cứu Y học <br /> thước được khuếch đại của cặp mồi exon 15‐A <br /> và phản ứng PCR không có sản phẩm phụ cho <br /> thấy các mồi đạt độ đặc hiệu cao ở cả bốn nhiệt <br /> độ (Hình 1).  <br /> <br /> 55oC;(2) Sản phẩm PCR ở nhiệt độ bắt cặp 57oC;(3) <br /> Sản phẩm PCR ở nhiệt độ bắt cặp 59 oC;(4) Sản phẩm <br /> PCR ở nhiệt độ bắt cặp 61 oC;(‐) Chứng âm. <br /> <br /> Độ nhạy của quy trình <br /> Độ  nhạy  của  quy  trình  được  xác  định  với <br /> nồng  độ  DNA  giảm  dần  từ  50ng/μl  đến  0,1 <br /> ng/μl. Phản ứng PCR thực hiện ở nhiệt độ 59oC. <br /> Tất cả các thí nghiệm đều được lặp lại ba lần. <br /> Theo  kết  quả  điện  di,  bắt  đầu  từ  nồng  độ <br /> DNA khuôn 5 ng/μL trở xuống, sản phẩm PCR <br /> cho  vạch  điện  di  mờ  dần.  Ở  nồng  độ  DNA  0,5 <br /> ng/μL và 0,1 ng/μL không thấy vạch điện di của <br /> sản phẩm PCR. Kết quả cho thấy quy trình có độ <br /> nhạy đạt 1 ng/μl. <br />  <br /> <br />  <br /> Hình 1: Kết quả khảo sát nhiệt độ bắt cặp của mồi <br /> exon 15‐A ở các mức nhiệt độ khác nhau. (T) Thang <br /> chuẩn 1kb plus;(1) Sản phẩm PCR ở nhiệt độ bắt cặp <br /> <br /> A<br /> <br /> B<br /> <br />  <br /> Hình 2: Kết quả khảo sát độ nhạy của quy trình PCR khuếch đại gen exon 15‐A ở các nồng độ DNA khác nhau. <br /> Hình A: (1) 0,1 ng/μL; (2) 0,5 ng/μL; (3) 1 ng/μL; (4) 2 ng/μL; (5) 3 ng/μL. Hình B: (1) 1 ng/μL; (2) 2 ng/μL; <br /> (3) 3 ng/μL; (4) 4 ng/μL; (5) 5 ng/μL; (6) 10 ng/μL; (7) 15 ng/μL; (8) 20 ng/μL; (9) 30 ng/μL; (10) 40 ng/μL; <br /> (11) 50 ng/μL. (T) Thang chuẩn; (‐) Chứng âm. <br /> ng/  μL.  Nhiệt  độ  bắt  cặp  dùng  cho  phản  ứng <br /> Kết quả chạy điện di sản phẩm bằng phản ứng <br /> oC.  <br /> PCR là 59<br /> PCR đã chuẩn hóa. <br /> Tiến hành khuếch đại toàn bộ các exon bằng <br /> phản ứng PCR với nồng độ DNA sử dụng là 50 <br /> <br /> 104<br /> A<br /> <br /> Phương  pháp  PCR  đã  được  chuẩn  hóa  và <br /> cho  kết  quả  khuếch  đại  tốt,  sản  phẩm  PCR  khi <br /> điện di đậm, sáng rõ, đúng kích thước và không <br /> có sản phẩm phụ. <br /> <br />
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2