ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells Bimei Jiang1, Kangkai Wang1, Pengfei Liang2, Weimin Xiao1, Haiyun Wang1 and Xianzhong Xiao1
1 Department of Pathophysiology, Xiangya School of Medicine, Central South University, Changsha, Hunan, China 2 Department of Burns and plastic surgery, Xiangya Hospital, Central South University, Changsha, Hunan, China
Keywords apoptosis; heat shock protein 70; hydrogen peroxide; mitochondria; Smac
Correspondence X. Xiao, Department of Pathophysiology, Xiangya School of Medicine, Central South University, Changsha, Hunan 410008, China Fax ⁄ Tel: +86 731 2355019 E-mail: xianzhongxiao@126.com
(Received 8 December 2008, revised 14 February 2009, accepted 2 March 2009)
doi:10.1111/j.1742-4658.2009.06989.x
Hydrogen peroxide (H2O2) is a well known oxidative stress inducer causing apoptosis of many cells. Previously, we have shown that heat shock pre- treatment blocked the release of the second mitochondria-derived activator of caspase (Smac) to the cytosol and inhibited apoptosis of C2C12 myo- blast cells in response to H2O2. The present study aimed to elucidate the underlying mechanism by over-expressing a major stress-inducible protein, heat shock protein (HSP) 70, and characterizing the resulting cellular changes. We demonstrate that HSP70 over-expression markedly inhibited the release of Smac and prevented the activation of caspases-9 and -3 and apoptosis in C2C12 cells under H2O2 treatment. However, no direct inter- action between HSP70 and Smac was observed by co-immunoprecipitation. Mutational analysis demonstrated that the ATP-binding domain of HSP70, rather than the peptide-binding domain, was essential for these observed HSP functions. Taken together, our results provide evidence supporting the role of HSP70 in the protection of C2C12 cells from H2O2-induced and Smac-promoted apoptosis by preventing the release of Smac from mito- chondria, thereby inhibiting activation of caspases-9 and -3. This mecha- nism of HSP70 action is dependent on its ATP-binding domain but independent of its interaction with Smac protein.
Caspases, a family of cysteine proteases, are key components in mammalian apoptosis. They are present in cells as inactive precursors and are activated by proteolytic cleavage [7]. In mammals, mitochondrial damage induced by diverse extracellular stress causes the release of cytochrome c from the mitochondria into the cytoplasm [8]. In the cytosol, cytochrome c associates with apoptosis protease-activating factor-1 (Apaf-1) and then binds to and activates caspase-9 in the presence of dATP ⁄ ATP [9]. This leads to proteo- lytic activation of a common set of downstream prote- ases, including caspases-3 and -7, and subsequent cell recently been shown that a novel death.
It has
Apoptosis is characterized by specific morphological including cell shrinkage, and biochemical hallmarks, membrane blebbing, nuclear breakdown and DNA fragmentation. As a form of programmed cell death, it is indispensable for many normal cellular functions, such as embryo development, tissue homeostasis and regulation of the immune system [1]. Malfunctions of apoptosis have been implicated in human diseases, including myocardial infarction, neurodegenerative dis- eases, cancer and ischemic stroke [2–4]. Several factors, including ATP depletion, calcium fluxes and reactive oxygen species, have been proposed to cause apoptosis and ⁄ or cytochrome c release in myocytes [5,6].
Abbreviations AIF, apoptosis-inducing factor; Apaf-1, apoptotic protease activating factor-1; FITC, fluorescein isothiocyanate; HSP, heat shock protein; IAP, inhibitor of apoptosis protein; JNK, Jun kinase; PI, pyridine iodination; Smac, second mitochondria-derived activator of caspase.
FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS
2615
B. Jiang et al.
ATP-binding domain of HSP70 inhibits Smac release
analysis were
selected
for
levels of HSP70 proteins by showing different immunoblot further study (Fig. 1A). The levels of HSP70 expression in both C2C12 lines were similar or even below the elevated endogenous HSP70 expression induced by heat stress (Fig. 1A).
second mitochondria-derived mitochondrial protein, activator of caspase (Smac, also known as DIABLO), is released into the cytosol in response to apoptotic stimuli, such as UVB irradiation, etoposide and gluco- corticoids [10,11]. Smac promotes caspase activation by eliminating inhibition of caspases by inhibitor of apoptosis protein (IAP) and is known to be a new and important regulator of apoptosis in a variety of cancer cells. The evidence obtained in our previous study also revealed a vital role for Smac in the apoptosis of myo- cytes induced by oxidative stress [12,13].
transgenic
animals
injury
in
The levels of Smac in the soluble cytoplasm and mitochondria were analyzed by western blot before and after exposure to 0.5 mm H2O2 for 2 h. In the nontransfected control cells before heat shock, Smac was detected in the motichondrial fraction but not in the cytosolic fraction, consistent with its known subcel- lular location. After exposure of cells to H2O2 for 2 h, Smac accumulated in the cytosol and the protein level dramatically increased by (cid:2) 30-fold compared to the control, as estimated by densitometry (Fig. 1B), indi- cating the release of Smac from mitochondria into the cytoplasm. Concordantly, the protein level in the mito- chondria was significantly decreased. In the transfected cells, HSP70 over-expression inhibited the release of Smac from mitochondria into the cytosol in a dose- dependent manner. Under the same conditions, the absence of another mitochondrial marker cytochrome oxidase subunit II in the cytosolic fractions indicated that mitochondrial integrity was preserved and translo- cation of Smac from mitochondria to the cytosol was not due to mitochondrial breakdown.
As a major stress-inducible heat shock protein, heat shock protein (HSP) 70 has been shown to protect cells from a number of apoptotic stimuli, including heat shock, tumor necrosis factor, growth factor with- drawal, oxidative stress and radiation [14,15]. Over- expression of HSP70, which is known to comprise a major self-preservation protein in the heart, has been reported to enhance myocardial tolerance to ischemia– reperfusion [16]. Furthermore, HSP70 has been shown to exert its anti- apoptotic function downstream of cytochrome c release but upstream of caspase-3 activation along the stress- induced apoptosis pathway [17]. It prevents caspase-3 and stress-activated protein kinase ⁄ Jun kinase (JNK) activation [18] and mitochondrial depolarization [19], blocks apoptosome formation and activation of caspase-9 [20], and inhibits the release of apoptosis- inducing factor (AIF) from mitochondria [21].
Over-expression of HSP70 inhibits oxidative stress-induced apoptosis in C2C12 myogenic cells
In our previous study using mouse myogenic C2C12 cells, heat shock pretreatment also prevented apoptosis induced by oxidative stress [13]. However, whether the protective effects of HSP70 are mediated by a mecha- nism involving the release of Smac from mitochondria remains to be elucidated. To this end, in the present study, we over-expressed HSP70 and characterized the subsequent cellular changes using C2C12 as an in vitro system.
Results
Over-expression of HSP70 inhibits oxidative stress-induced release of Smac from mitochondria in C2C12 myogenic cells
We next examined the effects of HSP70 over-expres- sion on oxidative stress-induced apoptosis in C2C12 myogenic cells. As shown in Fig. 2, after treatment with H2O2 (0.5 mm) for different times, the vector- transfected control cells underwent apoptosis, as indi- cated by an apoptotic cell population in the flow cytometry analysis. The percentages of apoptotic cells were decreased in both of the HSP70 over-expressed lines, indicating that HSP70 over-expression protected cells from H2O2-induced cytotoxicity. The protective effects of HSP70 were correlated with the level of HSP70 expression because the clone with higher HSP70 expression demonstrated a more significant reduction of the apoptotic cell population (Fig. 2B). Furthermore, over-expression of HSP70 displayed an inhibitory effect on the activation of caspases-9 and -3 induced by H2O2, and such inhibition was also corre- lated with the level of HSP70 expression (Fig. 2A). The protective effect of HSP70 against H2O2-induced apoptosis was further verified by the decrease in DNA laddering in HSP70 over-expressed cells after H2O2 treatment (Fig. 2C).
To explore the effect of the change in HSP70 protein (H2O2)-induced expression on hydrogen peroxide apoptosis, C2C12 myogenic cells were transfected with an expression vector with cDNA encoding the full- length HSP70 protein or the empty vector. After stably-transfected C2C12 cell selection with G418, lines that constitutively expressed human HSP70 were isolated. Two clones, termed HSP70-1 and HSP70-2,
FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS
2616
B. Jiang et al.
ATP-binding domain of HSP70 inhibits Smac release
pcDNA3.1
HSP70-1 HSP70-2 HS
A
No direct interaction between HSP70 and Smac
HSP70
GAPDH
14
#
#
12
10
8
6
H D P A G o t 0 7 P S H
Because HSP70 inhibited the release of Smac and apoptosis induced by H2O2 in C2C12 myogenic cells, we tested whether HSP70 inhibited the release of Smac through direct interaction. As shown in Fig. 3, no interaction between HSP70 and Smac was direct detected in cell-free extracts prepared either from untreated control cells or H2O2-treated (0.5 mm for 2 h) cells, indicating that interaction with Smac is not required with respect to the role of HSP70 in the inhi- bition of the release of Smac and apoptosis.
*
4
f o o i t a R
2
0
pcDNA3.1
HSP70-1
HSP70-2
HS
The role of the ATP-binding domain of HSP70 in the prevention of the release of Smac and apoptosis after exposure to H2O2
B
pcDNA3.1
HSP70-2
pcDNA3.1
H2O2 HSP70-1
Cyto
Mit
Cyto Mit
Cyto
Mit
Cyto Mit
Smac
expressing
transfected with
COXII
Loading control
60
50
40
pcDNA3.1 pcDNA3.1 + H2O2 HSP70-1 + H2O2 HSP70-2 + H2O2
*
#
30
l o r t n o c
20
#
g n i d a o l o t c a m S f o o i t a R
10
0
Cyto
Mit
To determine which region of HSP70 is responsible for its anti-apoptotic effects, C2C12 myogenic cells were transiently plasmids pcDNA3.1-HSP70WT, and pcDNA3.1-HSP70DATP-BD or pcDNA3.1-HSP70DPBD. First, correct protein expression from all cell lysates was confirmed by western blot analysis with HSP70 antibody, showing immunoreactive bands of the expected sizes (Fig. 4B). Next, whether the protective potency of HSP70 would be annulled by deletion of the ATP-binding domain or the peptide-binding domain was investigated. As shown in Fig. 5, over-expression of both mutant HSP70DPDB and full-length HSP70WT similarly inhib- ited the release of Smac from mitochondria, but mutant HSP70DATP-BD lost its ability to inhibit the release of Smac. These results suggest that the ATP- the binding domain is required for prevention of release of Smac from mitochondria.
(A) Cell
Similarly, over-expression of HSP70DPDB behaved similarly to full-length HSP70 (HSP70WT) in other functional assays, including the inhibition of the acti- vation of caspases-9 and -3 (Fig. 6A) after exposure to H2O2 for 8 h, as well as the inhibition of H2O2- induced apoptosis as assessed by the percentage of apoptotic cells (P < 0.05) (Fig. 6B) and cell viability (Fig. 6C). By contrast, in these experiments conducted under the same treatment conditions, HSP70DATP-BD over-expression abolished the function of full-length HSP70 (P < 0.05). No toxic effects were observed after transfection with the vectors described above.
Discussion
Fig. 1. Over-expression of HSP70 inhibited H2O2-induced Smac release in C2C12 cells. lysates from C2C12 clones over-expressing HSP70 or vector control plasmid (pcDNA3.1) were immunoblotted with monoclonal anti-HSP70 serum. Immunoblot analysis of b-actin was used as the loading control. A representative experiment is shown. Hybridization signals were quantified and nor- malized to GAPDH signals and are presented as the fold increase over the respective controls. HS, Heat stress. (B) Vector control (pcDNA3.1) and HSP70-over-expressing (HSP70-1, HSP70-2) C2C12 cells were either kept untreated or treated with 0.5 mM of H2O2 for 2 h, then harvested, lysed under conditions that kept mitochondria intact, and centrifuged to obtain a supernatant (Cyto) and a pellet fraction (Mit) as described in the Experimental procedures. The presence of Smac in the different fractions was determined by immunoblot analysis. Mitochondrial protein cytochrome oxidase subunit II was used as a marker of mitochondrial protein and Ponceau S staining was used as the loading control. Hybridization signals were quantified and normalized to GAPDH signals and are presented as the fold increase over the respective controls. *Signifi- cant difference (P < 0.05) compared to the pcDNA3.1 control group.
Our previous study demonstrated that heat shock pre- treatment led to the up-regulation of HSP70 expression and the inhibition of H2O2-mediated Smac release and
FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS
2617
B. Jiang et al.
ATP-binding domain of HSP70 inhibits Smac release
C
A
0.5mM H2O2
3.5
*
HSP70
l
3
*
HSP70 2 1
MpcDNA3.1 1
2 pcDNA3.1
2.5
#
#
2
#
#
1.5
1
pcDNA3.1 HSP70-1 HSP70-2 pcDNA3.1 + H2O2 HSP70-1 + H2O2 HSP70-2 + H2O2
0.5
) s d o f ( y t i v i t c a s e s a p s a C
0
Caspase-9
Caspase-3
pcDNA3.1
HSP70-1
HSP70-2
B
4 0 1
500 bp
3 0 1
300 bp
Q1 Q2
Q1 Q2
Q1 Q2
100 bp
2 0 1
Q4
Q3
Q4
Q3
Q4
Q3
1 0 1
pcDNA3.1 + H2O2
HSP70-1 + H2O2
HSP70-2 + H2O2
I P
4 0 1
3 0 1
Q1 Q2
Q1 Q2
Q1 Q2
2 0 1
Q4
Q3
Q4
Q4
Q3
Q3
1 0 1
100
101
102
103
104
100
101
102
103
104
100
101
102
103
104
Annexin V-FITC
*
#
#
s l l e c c i t o t p o p A %
45 40 35 30 25 20 15 10 5 0
O 2
O 2
O 2
H SP70-1
pcD N A 3.1
H SP70-1 + H 2
H SP70-2 + H 2
H SP70-2 pcD N A 3.1 + H 2
Fig. 2. Over-expression of HSP70 inhibited H2O2-induced apoptosis in C2C12 cells. (A) Cells over-expressing HSP70 and its deletion mutants were treated with or without 0.5 mM of H2O2 for 8 h. Cells were harvested and cell lysates were assayed for protease activity of caspases-9 or -3 using caspase fluorescent assay kits, and apoptotic cells were identified by elevated activation of caspases-9 and -3. The experiment was repeated three times, with similar results being obtained in each case. Data are the mean ± SEM of triplicate samples. (B) Cells were exposed to 0.5 mM H2O2 for 24 h. Cells were then processed for annexin V-FITC and pyridine iodination (PI) co-staining and ana- lyzed by flow cytometry. Q3 cells were regarded as control cells, whereas Q4 cells were considered as a measure of early apoptosis, Q2 cells were considered as cells at late apoptosis and Q1 cells were considered as being under necrosis. Next, quantitation of apoptotic cells was determined. Results are representative of three independent experiments. Data are the mean ± SEM of triplicate samples. *Significant difference (P < 0.05) compared to the pcDNA3.1 control group; #Significant difference (P < 0.05) compared to the group (*) that was signifi- cantly different from the pcDNA3.1 control group. (C) Cytosolic DNA was extracted from control and H2O2-exposed (24 h) C2C12 cells. DNA samples (4 lg) were electrophoresed on agarose gels to visualize DNA laddering. M, DNA marker.
tal with respect to our investigation of the role of HSP70. The results demonstrate that H2O2 treatment induced C2C12 cell apoptosis; however, HSP70 over- expression significantly prevented such stress-induced apoptosis. Because these effects were similar to those of our previous observations for the same cells under- going heat-shock, HSP70 is most likely to be the key
apoptosis in C2C12 myogenic cells [12], although the correlation between the two events remains unknown. In the present follow-up study, we engineered two C2C12 cell lines with constitutive HSP70 expression at the endogenous proteins a level similar to that of induced by heat shock. This system mimics the anti- apoptotic effects of heat shock and is very instrumen-
FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS
2618
B. Jiang et al.
ATP-binding domain of HSP70 inhibits Smac release
HSP70
H2O2 2 h
IP
IP
HSP70 + H2O2 IP
pcDNA3.1 HSP70WT
IgG
Serum Lysate HSP70 Smac HSP70 Smac
HSP70ΔATP-BD Cyto Mit Cyto Mit Cyto Mit
HSP70ΔPBD Cyto Mit
Smac
IB: HSP70
COX II
IB: Smac
Loading control
Fig. 3. No interaction was found between HSP70 and Smac. Vec- tor control (C2C12-C) and HSP70-over-expressing (C2C12-HSP70) cells were either kept untreated or treated with 0.5 mM of H2O2 for 2 h. Cells were harvested and lysed. Next, whole-cell lysates were immunoprecipitated with polyclonal anti-HSP70 or polyclonal anti- Smac sera. Immunoprecipitations were further analyzed by immu- noblots probed with Smac antibody or polyclonal HSP70 antibody, respectively.
A
1
383
542 646
HSP70WT
EEVD
ATP-BD
C
PBD
N
ATP-BD
HSP70ΔAPBD
N
EEVD
C
Fig. 5. The ATP-binding domain of HSP70 is the essential region for inhibition of Smac release. Cells over-expressing HSP70 or its deletion mutants were treated with 0.5 mM of H2O2 for 2 h, har- vested, lysed under conditions that kept mitochondria intact, and then centrifuged to obtain a supernatant (Cyto) and a pellet fraction (Mit) as described in the Experimental procedures. Protein protein contents were determined by the Bradford assay (Bio-Rad, Hercules, CA, USA), and equal amounts of proteins (10–20 lg) were loaded in each lane and separated by SDS-PAGE. Levels of Smac in the different fractions were determined by immunoblot analysis. Cytochrome oxidase subunit II (COX II) was used as a marker of mitochondrial protein and Ponceau S staining was used to visulize equal protein loadings.
N
HSP70ΔATP-BD
C
EEVD
PBD
HSP70WT
HSP70’ΔPBD HSP70’ΔATP-BD
B
70 kDa
IB: Hsp70
52 kDa
28 kDa
IB: Actin
subsequent
Fig. 4. Deletion mutants of HSP70 were constructed and transf- ected. A schematic drawing is shown of the HSP70 deletion mutants employed in the present study. (A) Deleted amino acids are indicated by the dotted lines. ATP-BD, 1-383AA, 42 kDa; PBD, 384-542AA, 18 kDa. (B) Western blot analysis demonstrated the levels of expression of the HSP70 proteins after deletion mutants of HSP70 were transfected.
type HSP70 inhibited not only H2O2-mediated Smac release, but also H2O2-induced apoptosis in transfected C2C12 cells. Furthermore, there was no direct interac- tion between HSP70 and Smac proteins, and the ATP-binding domain of HSP70, rather than the pep- tide-binding domain, was essential for this specific function of the protein. Recent studies have revealed that HSP70-mediated protection is essential for cells aiming to combat stress and avoid cell death [14,22]. As three key modulators responsible for apoptosis, cytochrome c, AIF and Smac are released into the cytosol during stress, where they activate the caspase cascade and subsequently cause cell death. HSP70 can the release of cytochrome c and AIF from inhibit cell death mitochondria and prevent [21,23]. In the present study, we demonstrated that HSP70 inhibited Smac release and the activation of caspases-9 and -3, thereby preventing DNA fragmenta- tion and apoptosis in cells under H2O2-induced oxida- tive stress. This is similar to the protective effects of another heat-shock protein, HSP27, against apoptosis, as previously reported [24].
apoptotic-associated
factors. For
The molecular chaperone HSP70 has been shown stress-induced apoptosis by interacting to inhibit with example, HSP70 directly interacts with JNK, resulting in the suppression of JNK-mediated apoptosis [25]. HSP70 physically interacts with Apaf-1, blocking Apaf-1 ⁄ cytochrome c-mediated caspase activation [20]. HSP70 also binds to and antagonizes AIF, thereby inhibiting
player mediating the anti-apoptotic effects, which is consistent with the general functional role of the chap- erone protein. Our previous studies demonstrated that H2O2 at 0.5 mmolÆL)1 induced apoptosis significantly, but only affected a minimal number of cells (approxi- mately 10%). In the present study, we demonstrated that the levels of HSP70 protein expression in C2C12 myogenic cells stably transfected with the gene for HSP70 were as high as those in cells pretreated with heat shock, and that the ectopic expression of wild-
FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS
2619
B. Jiang et al.
ATP-binding domain of HSP70 inhibits Smac release
3A
*
l
2.5
*
2
#
#
#
#
1.5
1
pcDNA3.1 pcDNA3.1 + H2O2 HSP70 + H2O2 HSP70ΔATP-BD + H2O2 HSP70ΔPBD + H2O2
0.5
) s d o f ( y t i v i t c a s e s a p s a C
0
Caspase-9
Caspase-3
pcDNA3.1
B
a
pcDNA3.1 + H2O2 b
HSP70ΔATP-BD + H2O2 HSP70ΔPBD + H2O2
HSP70 + H2O2 c
d
e
*Significant
samples.
triplicate
Fig. 6. ATP-binding domain of HSP70 is essential for the inhibition of H2O2-induced activation of caspases-9 and -3 and apoptosis. (A) The effects of HSP70 and its deletion mutant proteins on the acti- vation of caspases-9 and -3 were analyzed. Cells over-expressing HSP70 and its deletion mutants were treated with or without 0.5 mM of H2O2 for 8 h. Cells were harvested and cell lysates were assayed for protease activity of caspases-9 or -3 using caspase fluorescent assay kits. Data of caspase fluorescent assay were obtained from four independent experiments. *Significant differ- ence (P < 0.05) compared to the pcDNA3.1 control group; #Signifi- cant difference (P < 0.05) compared to the group (*) that was significantly different from the pcDNA3.1 control group (n = 8). (B) Measurement of percentages of apoptotic cells. Twenty-four hours after transfer, cells were treated with 0.5 mM H2O2 for 12 or 24 h, and then stained with Hoechst 33258. Under a fluorescence micro- scope, apoptotic cells, which contained condensed chromatin frag- ments, were scored and expressed as a percentage of the total cell number counted. Data are the mean ± SEM. *Significant differ- ence (P < 0.05) compared to the pcDNA3.1 control group; #Signifi- cant difference (P < 0.05) compared to the group (*) that was significantly different from the pcDNA3.1 control group (n = 5). (a–f) Cells incubated with H2O2 for 24 h. (C) Determination of cell viability. Approximately 2000 cells were plated in each well of 96-well plates. After 24 h of incubation, 0.5 mM of H2O2 was added and cell viability was measured by an 3-(4,5-dimethylthiazol-2-yl)- 2,5-diphenyl-tetrazolium bromide assay after exposure to H2O2 for 24 h. The experiment was repeated three times, with essentially the same results being obtained in each case. Data are the mean ± SEM of difference (P < 0.05) compared to the pcDNA3.1 control group; #Significant difference (P < 0.05) compared to the group (*) that was signifi- cantly different from the pcDNA3.1 control group (n = 5).
[23]. However,
70
60
s
l l
*
50
e c c i t
40
*
t
#
30
#
#
caspase-independent apoptosis the results obtained in the present study suggest that the inhibitory effect of HSP70 on the release of Smac and H2O2-mediated and Smac-promoted apoptosis is not attributable to a direct physical interaction between HSP70 and Smac.
#
20
pcDNA3.1 pcDNA3.1 + H2O2 HSP70 + H2O2 HSP70ΔATP-BD + H2O2 HSP70ΔPBD + H2O2
o p o p A %
10
0
12 h
24 h
Time (h)
#
C 1.2 1
#
0.8
y t i l i
i
0.6
b a v l l
*
0.4
e C
0.2
0
2
2
2
2
O
O
O
O
Δ P B D + H 2
pc D N A 3.1 pc D N A 3.1 + H 2
H sp70
H sp70 + H 2 Δ AT P-B D + H 2 H sp70
HSP70 contains three functional regions: the ATP- binding domain, the peptide-binding domain, and the EEVD motif. Although the EEVD motif is considered to be involved in the chaperone function of HSP70, and was assumed to mediate cytoprotection by restor- ing damaged or unfolded proteins under stress, the roles of other domains of HSP70 in anti-apoptosis remain highly controversial. Some studies have pro- posed that the ATP-binding domain of human HSP70 is not required in HSP70-mediated JNK suppression, inhibition of cytochrome c release and caspase activa- tion, and protection of cells from injury [26]. By con- trast, other studies have shown that the ATP-binding domain of HSP70 is essential for its anti-apoptotic role. For example, deletional analysis demonstrated that the ATP-binding domain is essential for inhibiting the release of cytochrome c from mitochondria [27].
FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS
2620
B. Jiang et al.
ATP-binding domain of HSP70 inhibits Smac release
remains to be determined how these findings are connected with the known functions of many other cellular molecules.
Experimental procedures
Cell culture and treatment
important The ATP-binding domain of HSP70 is for the interaction of HSP70 with apoptosis signal- regulating kinase 1 (ASK1) and the inhibition of ASK1-induced apoptosis in vitro [28]. Furthermore, the ATP-binding domain of HSP70 is critical for sequester- ing AIF in the cytosol [29]. In the present study, we demonstrated that the ATP-binding domain of HSP70 was indispensable for inhibition of Smac release from mitochondria as well as apoptotic events in C2C12 myogenic cells.
Heat shock treatment
C2C12 myogenic cells were cultured in DMEM supple- mented with 10% heat-inactivated fetal bovine serum at 37 (cid:2)C in the presence of 5% CO2 under a humidified atmo- sphere. H2O2 diluted in NaCl ⁄ Pi (137 mm NaCl, 2.68 mm KCl, 10 mm Na2HPO4, 1.76 mm KH2PO4, pH = 7.4) was used in the medium at a final concentration of 0.5 mm.
Construction of HSP70 and its truncated mutants
level
The molecular mechanism by which HSP70 and HSP70DPBD interfere with Smac release and apoptosis induced by oxidative-stress is still not fully understood. The mitochondrial pathway of cell death is controlled by Bcl-2 family proteins, a group of anti-apoptotic and pro-apoptotic proteins that regulate the passage of small molecules such as cytochrome c, Smac ⁄ DIABLO and apoptosis-inducing factor (which activate caspase cascades) through the mitochondrial transition pore [30]. Bcl-2 is the prototype of the bcl-2 family of proteins and is distributed in the mitochondria, endoplasmic reticulum and nuclear envelope. With a well-established role with respect to protecting cells against a variety of apoptotic stimuli, it mainly acts at the mitochondrial [31]. A previous study [32] demonstrated that HSP70 inhibits heat-induced apop- tosis by preventing Bax translocation. Furthermore, over-expression of HSP70 was associated with reduced apoptotic cell death and an increased expression of the anti-apoptotic protein, Bcl-2 [33]. On the basis of the available evidence, HSP70 and HSP70DPBD may also suppress Smac release and apoptosis by regulating the expression of these pro-apoptotic or anti-apoptotic bcl-2 family proteins.
Subconfluent cultured cells in 50-mm dishes were subjected to hyperthermia of 42 ± 0.3 (cid:2)C for 1 h in a water bath before being allowed to recover for 12 h at 37 (cid:2)C in a humidified atmosphere containing 5% CO2. As a control, cells were cultured under normal conditions without hyper- thermia.
In summary, using the H2O2-induced oxidative stress model, the present study has revealed an important anti-apoptotic role of HSP70, which comprises a mechanism that involves the inhibition of Smac release from mitochondria, and the suppression of caspase activation. Such a mechanism is independent of the interaction of HSP70 with Smac but requires the it ATP-binding domain of
the protein. However,
Table 1. Sequences of primers used to construct pcDNA3.1-HSP70WT, pcDNA3.1-HSP70DATP-BD or pcDNA3.1-HSP70DPBD plasmids.
Primers
Sequence (5¢- to 3¢)
AAAAGGATCCAAATGGCCAAAGCCGCGGCG TCGGGTACCGGATCTACCTCCTCAATGGTG CTGATGGGGGACTCCTACGCCTTCAACATGAAGAGC GAAGGCGTAGGAGTCCCCCATCAGGATGGCCGCCTG AAAAGGATCCAAAGTCCGAGAACTGGCAGGAC TCGGGTACCGGATCTACCTCCTCAATGGTG
Sense of pcDNA3.1-HSP70WT Antisense of pcDNA3.1-HSP70WT Sense of pcDNA3.1-HSP70DPBD Antisense of pcDNA3.1-HSP70DPBD Sense of pcDNA3.1-HSP70DATP-BD Antisense of pcDNA3.1-HSP70DATP-BD
FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS
2621
Full-length human HSP70 cDNA was obtained as a gener- ous gift from I. Benjemin (University of Utah Health Sciences Center, Salt Lake City, UT, USA) It was direc- tionally cloned between KpnI and BamHI sites into the mammalian expression vector pcDNA3.1(-)-His-myc. At the same time, this cDNA was used as the template for PCR amplification of two HSP70 truncated mutants with deletion of the ATP-binding domain (HSP70DATP-BD) or the peptide-binding domain (HSP70DPBD) using primer pairs (Table 1). All DNA digested fragments were purified using a gel purification kit (Invitrogen, Carlsbad, CA, USA), and subsequently ligated into pcDNA3.1(-)-His-myc vector overnight at 4 (cid:2)C with T4 DNA polymerase (Pro- mega, Madison, WI, USA). The correct insets were verified by sequencing and digestion. The final constructs were named pcDNA3.1-HSP70WT, pcDNA3.1-HSP70DATP-BD or pcDNA3.1-HSP70DPBD (Fig. 4A).
B. Jiang et al.
ATP-binding domain of HSP70 inhibits Smac release
Lipofectamine-mediated gene transfection
Preparation of mitochondrial and cytosolic fractions
C2C12 myogenic cells were cultured to sub-confluence and transfected with each of the expression plasmids manufac- tured as described in the above steps, or the empty vector without the cDNA (control) with a Lipofectamine-mediated method (Lipofectamine 2000, Invitrogen), as described previously [13].
of lysis buffer [10 mm Tris–HCl (pH 8.0), 10 mm EDTA, 0.5% Triton X-100 and 0.1 mgÆmL)1 RNase A] and incu- bated at 37 (cid:2)C for 1 h. Cell lysates were then treated with protease K (0.2 mgÆmL)1) at 54 (cid:2)C for 30 min. The genomic DNA was isolated by two with two rounds of phenol–chlo- roform extraction followed by an additional chloroform extraction. DNA pellet was then washed in 70% ethanol and resuspended in 1 mm EDTA and 10 mm Tris–HCl (pH 8.0) at a final concentration of 20 lgÆmL)1. Aliquots were electrophoresed on a 1.5% agarose gel containing ethi- dium bromide, and photographed under UV illumination. A GeneRuler 100 bp DNA ladder (MBI Fermentas, Hanover, MD, USA) was utilized as DNA size marker.
Co-immunoprecipitation assay
Western blot analysis
The subcellular fractions of C2C12 myogenic cells treated with or without H2O2 were isolated as described previously [13].
Caspase activity assay
Western blotting with anti-HSP70 and anti-Smac sera was performed as described previously [34].
Flow cytometric analysis
Caspase activation was determined according to the method described previously [13].
Hoechst 33258 staining
Cell viability assay
Both adherent and floating cells were collected after treat- ment, washed with ice-cold NaCl ⁄ Pi, and stained with (FITC)-conjugated annexin V fluorescein isothiocyanate (BD Biosciences, Franklin Lakes, NJ, USA) and pyridine iodination (PI) for 20 min at room temperature in the dark. The stained cells were then analyzed by a flow cytometer (Beckman Coulter, Fullerton, CA, USA). FITC-conjugated annexin V binds to phosphatidylserine molecules present only at the surface of apoptotic cells but not non-apoptotic cells due to the loss of plasma membrane asymmetry early in apoptosis. Cells were simultaneously stained with PI to discriminate membrane-permeable necrotic cells from FITC- labeled apoptotic cells. Apoptotic cells were identified as those with positive staining only to annexin V-FITC and not to PI, and the results were expressed as the proportion of these cells among the total number of cells analyzed. For co-immunoprecipitation, transiently transfected C2C12 cells were lyzed with pre-cold RIPA buffer (150 mmolÆL)1 NaCl, 1% NP40, 0.5% deoxycholic acid sodium salt, 0.1% SDS, 50 mmolÆL)1 Tris pH 8.0, 1 mm phenylmethanesulfo- nyl fluoride and complete protease inhibitor tablet) at 4 (cid:2)C for 5 min. To reduce nonspecific combination, lysates con- taining 500 lg of total protein were pre-immunized with 25 lL of a slurry of protein A ⁄ G coupled to agarose beads (Invitrogen) overnight at 4 (cid:2)C on a rotating wheel. Aliquots of the pre-cleared supernatants were then each incubated with 2 lg of appropriate mouse monoclonal anti-HSP70 serum, polyclonal rabbit anti-Smac serum (R&D Systems, Minneapolis, MN, USA), normal mouse immunoglobu- lin G (control for anti-HSP70) or normal rabbit serum (control for anti-Smac) added into 25 lL of protein A ⁄ G slurry coupled to agarose beads (Invitrogen) for 5 h at 4 (cid:2)C on a rotating wheel. Protein A ⁄ G beads were collected by centrifugation at 4 (cid:2)C followed by a total of four additional washes lysis buffer containing 200 mm NaCl. Immune com- plexes were eluted by twice by sample buffer (2% SDS, 2 m 2-mercaptoethanol) after boiling at 100 (cid:2)C for 10 min. Proteins were separated by electrophoresis on SDS-PAGE followed by immunoblotting with polyclonal anti-HSP70 and anti-Smac sera, as described previously [24]. As the controls of total antigens in the lysates before co-immuno- precipitation, portions of lysates (1 : 20) were also resolved on SDS-PAGE and immunoblotted with anti-HSP70 or anti-Smac sera.
Detection of DNA fragmentation
Hoechst 33258 staining was performed as described previ- ously [12,13]. suspension (1 · 106 cellsÆmL)1
FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS
2622
To determine cell viability, 3-(4,5-dimethylthiazol-2-yl)-2,5- (0.5 mg) was added to diphenyl-tetrazolium bromide in 24-well 1 mL of cell plates). After 4 h of incubation, cells were washed three (pH 7.4). The insoluble formazan times with NaCl ⁄ Pi product was dissolved in dimethylsulfoxide and D490 of each culture well was then measured using a microplate (Titertek Multiskan Plus, Flow Laboratories, reader Floating and adherent cells (5 · 107) were combined and pelleted by centrifugation at 400 g for 5 min, and washed twice with NaCl ⁄ Pi. Cell pellets were resuspended in 200 lL
B. Jiang et al.
ATP-binding domain of HSP70 inhibits Smac release
attenuance of 8 Sun XM, MacFarlane M, Zhuang J, Wolf BB, Green formazan McClean, VA, USA). The formed in control cells was considered as 100% viability.
Statistical analysis
DR & Cohen GM (1999) Distinct caspase cascades are initiated in receptor-mediated and chemical-induced apoptosis. J Biol Chem 274, 5053–5060. 9 Li P, Nijhawan D, Budihardjo I, Srinivasula SM,
Ahmad M, Alnemri ES & Wang X (1997) Cytochrome c and dATP-dependent formation of Apaf-1 ⁄ caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479–489.
Data are expressed as the mean ± SEM of the indicated number of separate experiments. Differences between two groups were analyzed using an unpaired Student’s t-test. Differences among three or more groups were analyzed by one-way analysis of variance followed by the Student–New- man–Keuls post-hoc test. P < 0.05 was considered statisti- cally significant. 10 Du C, Fang M, Li Y, Li L & Wang X (2000) Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell 102, 33–42.
Acknowledgements
Basic Research
This study was supported by the grants from the National Program of China (2007CB512007), the National Natural Science Foun- dation of China (30700290) and Special Funds for PhD Training from the Ministry of Education of China (20060533009).
11 Verhagen AM, Ekert PG, Pakusch M, Silke J, Connolly LM, Reid GE, Moritz RL, Simpson RJ & Vaux DL (2000) Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102, 43–53.
12 Jiang B, Xiao W, Shi Y, Liu M & Xiao X (2005) Role of Smac ⁄ DIABLO in hydrogen peroxide-induced apop- tosis in C2C12 myogenic cells. Free Radic Biol Med 39, 658–667.
References
1 Steller H (1995) Mechanisms and genes of cellular suicide. Science 267, 1445–1449. 2 Shishido T, Woo CH, Ding B, McClain C, Molina CA,
13 Jiang B, Xiao W, Shi Y, Liu M & Xiao X (2005) Heat shock pretreatment inhibited the release of Smac ⁄ DIA- BLO from mitochondria and apoptosis induced by hydrogen peroxide in cardiomyocytes and C2C12 myogenic cells. Cell Stress Chaperones 10, 252–262. 14 Lui JC & Kong SK (2007) Heat shock protein 70 inhib- its the nuclear import of apoptosis-inducing factor to avoid DNA fragmentation in TF-1 cells during erythro- poiesis. FEBS Lett 581, 109–117.
Yan C, Yang J & Abe J (2008) Effects of MEK5 ⁄ ERK5 association on small ubiquitin-related modification of ERK5: implications for diabetic ventric- ular dysfunction after myocardial infarction. Circ Res 102, 1416–1425.
15 Zhao Y, Wang W & Qian L (2007) Hsp70 may protect cardiomyocytes from stress-induced injury by inhibiting Fas-mediated apoptosis. Cell Stress Chaperones 12, 83– 95. 3 Burke RE (2008) Programmed cell death and new dis- coveries in the genetics of parkinsonism. J Neurochem 104, 875–890. 4 Engel T, Kannenberg F, Fobker M, Nofer JR, Bode
16 Jayakumar J, Suzuki K, Khan M, Smolenski RT, Farrell A, Latif N, Raisky O, Abunasra H, Sammut IA, Mur- tuza B et al. (2000) Gene therapy for myocardial protec- tion: transfection of donor hearts with heat shock protein 70 gene protects cardiac function against ischemia-reper- fusion injury. Circulation 102, III302–III306. G, Lueken A, Assmann G & Seedorf U (2007) Expression of ATP binding cassette-transporter ABCG1 prevents cell death by transporting cytotoxic 7beta-hydroxycholesterol. FEBS Lett 581, 1673–1680. 17 Li CY, Lee JS, Ko YG, Kim JI & Seo JS (2000) Heat
shock protein 70 inhibits apoptosis downstream of cyto- chrome c release and upstream of caspase-3 activation. J Biol Chem 275, 25665–25671.
5 Yaglom JA, Ekhterae D, Gabai VL & Sherman MY (2003) Regulation of necrosis of H9c2 myogenic cells upon transient energy deprivation. Rapid deenergization of mitochondria precedes necrosis and is controlled by reactive oxygen species, stress kinase JNK, HSP72 and ARC. J Biol Chem 278, 50483–50496.
18 Lee JS, Lee JJ & Seo JS (2005) HSP70 deficiency results in activation of c-Jun N-terminal kinase, extracellular signal-regulated kinase, and caspase-3 in hyperosmolarity-induced apoptosis. J Biol Chem 280, 6634–6641. 19 Creagh EM, Carmody RJ & Cotter TG (2000) Heat
FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS
2623
6 Dougherty CJ, Kubasiak LA, Frazier DP, Li H, Xiong WC, Bishopric NH & Webster KA (2004) Mitochon- drial signals initiate the activation of c-Jun N-terminal kinase (JNK) by hypoxia-reoxygenation. FASEB J 18, 1060–1070. 7 Thornberry NA & Lazebnik Y (1998) Caspases: shock protein 70 inhibits caspase-dependent and -inde- pendent apoptosis in Jurkat T cells. Exp Cell Res 257, 58–66. enemies within. Science 281, 1312–1316.
B. Jiang et al.
ATP-binding domain of HSP70 inhibits Smac release
20 Saleh A, Srinivasula SM, Balkir L, Robbins PD & 28 Park HS, Cho SG, Kim CK, Hwang HS, Noh KT,
Alnemri ES (2000) Negative regulation of the Apaf-1 apoptosome by Hsp70. Nat Cell Biol 2, 476–483.
Kim MS, Huh SH, Kim MJ, Ryoo K, Kim EK et al. (2002) Heat shock protein hsp72 is a negative regulator of apoptosis signal-regulating kinase 1. Mol Cell Biol 22, 7721–7730.
29 Ruchalski K, Mao H, Li Z, Wang Z, Gillers S, Wang Y, Mosser DD, Gabai V, Schwartz JH & Borkan SC (2006) Distinct hsp70 domains mediate apoptosis-induc- ing factor release and nuclear accumulation. J Biol Chem 281, 7873–7880. 21 Ravagnan L, Gurbuxani S, Susin SA, Maisse C, Daugas E, Zamzami N, Mak T, Ja¨ a¨ ttela¨ M, Penninger JM, Garri- do C et al. (2001) Heat-shock protein 70 antagonizes apoptosis-inducing factor. Nat Cell Biol 3, 839–843. 22 Feng X, Bonni S & Riabowol K (2006) HSP70 induc- tion by ING proteins sensitizes cells to tumor necrosis factor alpha receptor-mediated apoptosis. Mol Cell Biol 26, 9244–9255.
30 Kim R (2005) Recent advances in understanding the cell death pathways activated by anticancer therapy. Cancer 103, 1551–1560.
23 Didelot C, Schmitt E, Brunet M, Maingret L, Parcellier A & Garrido C (2006) Heat shock proteins: endogenous modulators of apoptotic cell death. Handb. Exp. Phar- macol. 26, 171–198.
31 Scorrano L & Korsmeyer SJ (2003) Mechanisms of cytochrome c release by proapoptotic BCL-2 family members. Biochem Biophys Res Commun 304, 437– 444.
24 Chauhan D, Li G, Hideshima T, Podar K, Mitsiades C, Mitsiades N, Catley L, Tai YT, Hayashi T, Shringarpure R et al. (2003) Hsp27 inhibits release of mitochondrial protein Smac in multiple myeloma cells and confers dexa- methasone resistance. Blood 102, 3379–3386. 25 Park HS, Lee JS, Huh SH, Seo JS & Choi EJ (2001) 32 Stankiewicz AR, Lachapelle G, Foo CP, Radicioni SM & Mosser DD (2005) Hsp70 inhibits heat-induced apop- tosis upstream of mitochondria by preventing Bax translocation. J Biol Chem 280, 38729–38739.
Hsp72 functions as a natural inhibitory protein of c-Jun N-terminal kinase. EMBO J 20, 446–456.
33 Yenari MA, Liu J, Zheng Z, Vexler ZS, Lee JE & Giff- ard RG (2005) Antiapoptotic and anti-inflammatory mechanisms of heat-shock protein protection. Ann N Y Acad Sci 1053, 74–83. 34 Liang P, Jiang B, Yang X, Xiao X, Huang X, Long J, 26 Mayer MP & Bukau B (2005) Hsp70 chaperones: cellu- lar functions and molecular mechanism. Cell Mol Life Sci 62, 670–684. 27 Mosser DD, Caron AW, Bourget L, Meriin AB, Sher-
FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS
2624
Zhang P, Zhang M, Xiao M, Xie T et al. (2008) The role of peroxisome proliferator-activated receptor- beta ⁄ delta in epidermal growth factor-induced HaCaT cell proliferation. Exp Cell Res 314, 3142–3151. man MY, Morimoto RI & Massie B (2000) The chaper- one function of hsp70 is required for protection against stress-induced apoptosis. Mol Cell Biol 20, 7146–7159.
