Chitin oligosaccharide binding to a family GH19 chitinase from the moss Bryum coronatum Takayuki Ohnuma1, Morten Sørlie2, Tatsuya Fukuda1, Noriko Kawamoto1, Toki Taira3 and Tamo Fukamizo1
1 Department of Advanced Bioscience, Kinki University, Nara, Japan 2 Department of Chemistry, Biotechnology and Food Science, Norwegian University of Life Sciences, A˚ s, Norway 3 Department of Bioscience and Biotechnology, Faculty of Agriculture, University of the Ryukyus, Okinawa, Japan
Keywords binding subsite; family GH19 chitinase; isothermal titration calorimetry; oligosaccharides; thermodynamics
Correspondence T. Fukamizo, Department of Advanced Bioscience, Kinki University, 3327-204 Nakamachi, Nara 631-8505, Japan Fax: +81 742 73 8976 Tel: +81 742 73 8237 E-mail: fukamizo@nara.kindfai.ac.jp M. Sørlie, Department of Chemistry, Biotechnology and Food Science, Norwegian University of Life Sciences, PO Box 5003, N-1432 A˚ s, Norway Fax: +47 64 96 59 01 Tel: +47 64 96 59 02 E-mail: morten.sorlie@umb.no
(Received 26 May 2011, revised 27 July 2011, accepted 9 August 2011)
doi:10.1111/j.1742-4658.2011.08301.x
Substrate binding of a family GH19 chitinase from a moss species, Bryum coronatum (BcChi-A, 22 kDa), which is smaller than the 26 kDa family GH19 barley chitinase due to the lack of several loop regions (‘loop- less’), was investigated by oligosaccharide digestion, thermal unfolding experiments and isothermal titration calorimetry (ITC). Chitin oligosaccha- rides [b-1,4-linked oligosaccharides of N-acetylglucosamine with a polymer- ization degree of n, (GlcNAc)n, n = 3–6] were hydrolyzed by BcChi-A at rates in the order (GlcNAc)6 > (GlcNAc)5 > (GlcNAc)4 >> (GlcNAc)3. From thermal unfolding experiments using the inactive BcChi-A mutant (BcChi-A-E61A), in which the catalytic residue Glu61 is mutated to Ala, we found that the transition temperature (Tm) was elevated upon addition of (GlcNAc)n (n = 2–6) and that the elevation (DTm) was almost propor- tional to the degree of polymerization of (GlcNAc)n. ITC experiments pro- vided the thermodynamic parameters for binding of (GlcNAc)n (n = 3–6) to BcChi-A-E61A, and revealed that the binding was driven by favorable enthalpy changes with unfavorable entropy changes. The change in heat capacity (DCp(cid:2)) for (GlcNAc)6 binding was found to be relatively small ()105 ± 8 calÆK)1Æmol)1). The binding free energy changes for (GlcNAc)6, (GlcNAc)5, (GlcNAc)4 and (GlcNAc)3 were determined to be )8.5, )7.9, )6.6 and )5.0 kcalÆmol)1, respectively. Taken together, the substrate bind- ing cleft of BcChi-A consists of at least six subsites, in contrast to the four-subsites binding cleft of the ‘loopless’ family 19 chitinase from Strep- tomyces coelicolor.
Database Chitinase, EC 3.2.1.14
Introduction
Chitin, a b-1,4-linked polysaccharide of N-acetylglu- is hydrolyzed by chitinases (EC cosamine (GlcNAc), 3.2.1.14) that are widely distributed in living organisms and are responsible for self-defense, growth, morpho- tolerance genesis, cuticle destabilization and stress
[1–5]. A number of chitinase and chitinase-like genes have been isolated from living organisms, and the gene products have been characterized. Although chitinases from plant origins were classified into at least five clas- ses (classes I–V) based on their deduced amino acid
FEBS Journal 278 (2011) 3991–4001 ª 2011 The Authors Journal compilation ª 2011 FEBS
3991
Abbreviations GlcNAc, N-acetylglucosamine; (GlcNAc)n, b-1,4-linked oligosaccharides of GlcNAc with a polymerization degree of n; ITC, isothermal titration calorimetry; LOGNAc, N-acetylglucosaminono-1,5-lactone (Z)-oxime; PUGNAc, N-acetylglucosaminono-1,5-lactone O-(phenylcarbamoyl)-(Z)- oxime; XOS, xylo-oligosaccharide.
T. Ohnuma et al. Oligosaccharide binding to a family GH19 chitinase
[6,7], nowadays a simple
experiments and thermodynamic analysis using isother- mal titration calorimetry (ITC).
Results
Chitin oligosaccharide hydrolysis
The time-courses of enzymatic hydrolysis of (GlcNAc)n (n = 3–6) by BcChi-A are shown in Fig. 1. From (GlcNAc)6, BcChi-A produced (GlcNAc)3, (GlcNAc)2 and a lesser amount of (GlcNAc)4. The product (Glc- NAc)4 appears to be hydrolyzed further to (GlcNAc)2 (Fig. 1A). The frequency of cleavage to (GlcNAc)2 + (GlcNAc)4 appears to be comparable with that of cleavage to (GlcNAc)3 + (GlcNAc)3. Equal amounts of (GlcNAc)2 + (GlcNAc)3 were produced from (Glc- from (GlcNAc)4 NAc)5 and only (GlcNAc)2 was (Fig. 1B,C). (GlcNAc)3 was hydrolyzed to GlcNAc and (GlcNAc)2 (Fig. 1D). In the early stage of (Glc- NAc)3 hydrolysis, the inverting BcChi-A enzyme exclu- sively produced the a-anomer of (GlcNAc)2 and b- anomer of GlcNAc, indicating that the reducing end residue of (GlcNAc)3 makes contact with amino acid residues forming subsite +1 and its b-form is selec- tively recognized by the subsite (Fig. 1E). BcChi-A hydrolyzed chitin oligosaccharides at rates in the order (GlcNAc)6 > (GlcNAc)5 > (GlcNAc)4 >> (GlcNAc)3, suggesting that the longer the chain length of the sub- strate, the higher the affinity of the oligosaccharides to the enzyme. No transglycosylation products were observed in any cases.
Unfolding curves of BcChi-A-E61A in the presence of (GlcNAc)n
classification sequences according to the CAZy database is more widely used for all chitinolytic enzymes [8]. The chitinases are classi- fied into families GH18 and GH19, both of which can be subdivided based on their domain arrangements and sequence deletions. The first three-dimensional structure of a plant chitinase was reported for 26 kDa family GH19 chitinase from barley seeds [9]. The barley enzyme is composed of two lobes, both of which are rich in a-helical structures, with the substrate binding cleft between the lobes. Several loops are found at both ends of the binding cleft (‘loopful’). The structure of the ‘loopful’ family GH19 chitinase from papaya in a com- plex with GlcNAc monomers has also been reported, and two GlcNAc molecules were found to bind sepa- rately to subsites )2 and +1, respectively, in the com- plex structure [10]. This structure has been used to build a plausible model of a complex with (GlcNAc)4. On the other hand, family 19 chitinases lacking the loops at the two ends of the binding cleft (‘loopless’ chitinase) have been isolated from two bacteria, Streptomyces griseus HUT6037 and Streptomyces coelicolor A3(2), and the evergreen conifer Norway spruce [11–13]. Based on the three-dimensional structures, it was suggested that the substrate binding clefts of the ‘loopless’ enzymes are shorter than those of ‘loopful’ enzymes [14,15]. The crystal structure of a ‘loopless’ family GH19 chitinase from S. coelicolor A3(2) and analysis of the products from chitooligosaccharide degradation by this enzyme revealed that the substrate binding cleft consists of four subsites [14]. However, no quantitative data for binding of (GlcNAc)n to the ‘loopless’ family GH19 chitinases have been reported to date. The subsite arrangement of the ‘loopless’ chitinase can be delineated not only from structural data but also from quantitative binding experiments.
designated
Recently, Taira et al. [16] have isolated and charac- terized a family GH19 enzyme from a moss species, Bryum coronatum, as BcChi-A. They showed that the molecular weight of BcChi-A is rela- tively small compared with those of ‘loopful’ GH19 chitinases due to the deletion of several loops. Thus, BcChi-A is a ‘loopless’ family GH19 chitinase like that from S. coelicolor A3(2) rather than a ‘loopful’ GH19 enzyme such as the GH19 chitinase from barley seeds. Interestingly, when the shorter oligosaccharide sub- strate (GlcNAc)4 was used as the substrate, BcChi-A exhibited a much higher hydrolytic activity (1000-fold) than the ‘loopful’ GH19 chitinase from rye seeds [17]. In this study, to gain insight into the mechanism of family GH19 (GlcNAc)n binding to the ‘loopless’ enzymes, (GlcNAc)n binding to BcChi-A was exam- ined by oligosaccharide digestion, thermal unfolding
BcChi-A-E61A was successfully produced and purified by the methods described previously [16]. The unfold- ing curves of BcChi-A-E61A were obtained by moni- toring CD at 222 nm in the absence or presence of (GlcNAc)n (n = 1–6), as shown in Fig. 2. Although some of the experimental data points deviated from the theoretical curves obtained by assuming a simple two-state transition (Fig. 2; the early stage of the tran- sition in the absence of the ligand), most data points for the individual unfolding experiments fitted well to the corresponding theoretical curves. Since the unfold- ing transitions were found to be irreversible, we could not determine the thermodynamic parameters and therefore evaluated the structural stability only from the transition temperatures (Tm) of the major transi- tion zones. As judged from elevation of Tm (DTm), the thermal stability increased when (GlcNAc)n (n = 2, 3, 4, 5 or 6) was added to BcChi-A-E61A solution, by
FEBS Journal 278 (2011) 3991–4001 ª 2011 The Authors Journal compilation ª 2011 FEBS
3992
T. Ohnuma et al. Oligosaccharide binding to a family GH19 chitinase
B
A
5
5
3
4
4
) M m
) M m
2
2
3
3
3
2
2
4
1
1
( n o i t a r t n e c n o C
( n o i t a r t n e c n o C
5
6
0
0
0
10
20
40
50
60
20
40
60
80
0
30 Reaction time (min)
Reaction time (min)
C
D
6
2
5
) M m
) M m
1
4
2
3
2
3
4
1
( n o i t a r t n e c n o C
( n o i t a r t n e c n o C
0
8 7 6 5 4 3 2 1 0
0
40
80
160
20
40
60
80
0
Reaction time (min)
120 Reaction time (min)
Standard 1 2 3 4
E
GlcNAc
(GlcNAc)2
β α
4 min
10 min
m n 0 2 2 t a e c n a b r o s b A
15 min
20 min
0
5
10
15
Retention time (min)
Fig. 1. Experimental time-courses of (GlcNAc)n (n = 3–6) digestion by BcChi-A. Enzyme and substrate concentrations were 0.04 lM and 4.67 mM, respectively, except for the reaction with (GlcNAc)3, in which the enzyme concentration was increased 10-fold. The enzyme reaction was con- ducted in 50 mM sodium acetate buffer pH 5.0 at 40 (cid:2)C. Symbols: open circle, (GlcNAc)1; square, (GlcNAc)2; triangle, (GlcNAc)3; diamond, (GlcNAc)4; cross, (GlcNAc)5; closed circle, (GlcNAc)6. Lines were obtained by roughly following the experimental data points. (A) Substrate (GlcNAc)6. (B) Substrate (GlcNAc)5. (C) Substrate (GlcNAc)4. (D) Substrate (GlcNAc)3. (E) HPLC analysis of size and anomeric configuration of products formed from (GlcNAc)3 by BcChi-A. Bold numbers 1–6 indicate (GlcNAc)1–6.
1.5, 2.7, 4.0, 5.3 or 6.2 (cid:2)C, respectively (Table 1). In the presence of GlcNAc, the Tm value was essentially unchanged. The elevation of Tm appears to be almost proportional to the polymerization degree of the (Glc- NAc)n added. The stabilization effects induced by the oligosaccharides should be derived from the specific binding of (GlcNAc)n (n = 2–6) to BcChi-A-E61A, suggesting again that the longer the chain length of the ligand, the stronger the ligand binding to the enzyme.
ITC analysis of (GlcNAc)n binding to BcChi-A-E61A
The binding of oligomeric substrates to BcChi-A was studied by ITC at 30 (cid:2)C and pH 7.0. Figure 3 shows
typical ITC thermograms and theoretical fits to the experimental data for (GlcNAc)6, (GlcNAc)5, (GlcNAc)4 and (GlcNAc)3 binding. Theoretical fits were obtained and compared with experimental data using a nonlin- ear least-squares algorithm (accompanied by the ITC system) by varying the binding affinity constant (Ka), the number of binding sites, i.e. the stoichiometry of the reaction (n), and the enthalpy change of ligand binding (DHr(cid:2)). For all chitin oligosaccharides, all fits yielded n between 0.9 and 1.1 indicating a one to one stoichiometry. At this temperature and pH, (GlcNAc)6 was found to bind to the enzyme with a Kd of 0.77 ± 0.06 lM (Table 2). The binding was clearly enthalpy driven (DHr(cid:2) = )9.5 ± 0.1 kcalÆmol)1) with a small entropy penalty ()TDSr(cid:2) = 1.0 ± 0.1 kcalÆmol)1 and
FEBS Journal 278 (2011) 3991–4001 ª 2011 The Authors Journal compilation ª 2011 FEBS
3993
1
T. Ohnuma et al. Oligosaccharide binding to a family GH19 chitinase
entropy of solvation is close to zero for proteins near 385 K, DCp can be related to the solvation entropy change (DSsolv(cid:2)) of the binding reaction at t = 30 (cid:2)C as described by
0.8
)
%
(cid:2)
(cid:3)
ð1Þ
DSsolv
(cid:2) ¼ DCp ln
0.6
303:15 K 385:15 K
0.4
( d e d l o f n u n o i t c a r F
0.2
and the
changes
Furthermore, the mixing entropy change (DSmix(cid:2)) of the reaction can be calculated as a ‘cratic’ term, a statistical correction that reflects mixing of solute and solvent molecules in transla- tional ⁄ rotational degrees of freedom:
(cid:2)
(cid:3)
0
ð2Þ
(cid:2) ¼ R ln
DSmix
1 55:5
60
65
70
75
80
85
90
95
Temperature (°C)
Finally, the reaction entropy change (DSr(cid:2)) can be viewed as the sum of DSsolv(cid:2), DSmix(cid:2) and the confor- mational entropy change (DSconf(cid:2)) (Eqn 3). DSconf(cid:2) details the change in side-chain and backbone confor- mational entropy associated with binding.
DSr(cid:2) can be parameterized into three terms as shown
(GlcNAc)1; square,
in Eqn (3) [18].
(cid:2)
(GlcNAc)3; diamond, (GlcNAc)4; cross, Fig. 2. Thermal unfolding curves of BcChi-A-E61A obtained in the absence and presence of (GlcNAc)n (n = 1–6). The transitions were followed by CD at 222 nm. The unfolding conditions are described in Experimental procedures. Solid lines indicate the theoretical curves obtained with the two-state transition model. Symbols: open circles, no ligand; upside-down triangle, (GlcNAc)2; triangle, (GlcNAc)5; closed circle, (GlcNAc)6.
ð3Þ
DSr
(cid:2) ¼ DSsolv
(cid:2) þ DSmix
(cid:2) þ DSconf
Table 1. The transition temperature Tm of thermal unfolding and Tm elevation DTm upon the addition of (GlcNAc)n (n = 1–6) for BcChi-A-E61A.
Protein Tm DTm
Thus, DSsolv(cid:2) may be derived from DCp,r(cid:2) [18–21] and DSmix represents a fixed known ‘cratic’ term [18], mean- ing that DSconf(cid:2) can be derived from DSr(cid:2). The results summarized in Table 4 show that at pH 7.0 DSsolv(cid:2) is to 25 ± 2 calÆK)1Æmol)1 ()TDSsolv(cid:2) = )7.6 ± equal 0.6 kcalÆmol)1), the loss of translational entropy DSmix(cid:2) = )8 calÆK)1Æmol)1 ()TDSmix(cid:2) = 2.4 kcalÆmol)1) and the entropic effect of conformational changes, DSconf(cid:2), is equal to )20 ± 2 calÆK)1Æmol)1 ()TDSconf(cid:2) = 6.1 ± 0.6 kcalÆmol)1).
76.8 76.5 78.3 79.5 80.9 82.1 83.0 – )0.3 1.5 2.7 4.0 5.3 6.2 BcChi-A-E61A +(GlcNAc)1 +(GlcNAc)2 +(GlcNAc)3 +(GlcNAc)4 +(GlcNAc)5 +(GlcNAc)6
Discussion
DSr(cid:2) = )3 ± 1 calÆK)1Æmol)1). An exception is (Glc- NAc)3 binding, where an increase in the enthalpic con- tribution compared with (GlcNAc)4 and a relatively higher unfavorable entropic contribution are observed (Table 2).
(GlcNAc)6 binding to BcChi-A-E61A was also ana- lyzed at pH 6.0 and 8.0. The results (Table 3) showed that the change in pH had insignificant effects on bind- ing, showing slight increases in the Kd values and little variation in the enthalpic and entropic terms.
Measurements of
the temperature dependence of DHr(cid:2) for (GlcNAc)6 binding to BcChi-A-E61A in the temperature range between 20 and 37 (cid:2)C yielded a straight line of slope )105 ± 8 calÆK)1Æmol)1 (DCp,r(cid:2)) at pH 7.0 (Table 4 and Fig. 4). By recognizing that the
Crystal structures of both ‘loopless’ and ‘loopful’ fam- ily GH19 chitinases from various plant species, includ- ing barley seeds, jack bean, mustard greens, papaya, Norway spruce and rice, have been solved by different research groups [10,15,22,23]. Nevertheless, no crystal structure of a family GH19 enzyme complexed with a GlcNAc oligosaccharide is available at present. The structure of a GH19 chitinase in a complexed state was obtained only for ‘loopful’ papaya chitinase with two separately bound GlcNAc monomers [10]. Fur- thermore, quantitative analysis of the substrate binding to GH19 chitinases has not been conducted yet, and the mechanism of substrate recognition has never been understood. In this study, we report the first quantita- tive data on the substrate binding to a ‘loopless’ family
FEBS Journal 278 (2011) 3991–4001 ª 2011 The Authors Journal compilation ª 2011 FEBS
3994
T. Ohnuma et al. Oligosaccharide binding to a family GH19 chitinase
Fig. 3. Thermograms (upper panels) and binding isotherms with theoretical fits (lower panels) obtained for the binding of (A) (GlcNAc)6, (B) (GlcNAc)5, (C) (GlcNAc)4 and (D) (GlcNAc)3 to BcChi-A-E61A.
GH19 chitinase, which were obtained by kinetic and thermodynamic strategies.
as Kd values increase with decreasing length of the oligomers. In comparison, (GlcNAc)6 binds 100-fold more strongly to BcChi-A than to human lysozyme (0.77 versus 73 lM).
the
and the
respectively
Furthermore, for (GlcNAc)6 binding at pH 7.0 and enthalpy change is 30 (cid:2)C, the driving force (DHr(cid:2) = )9.5 ± 0.1 kcalÆmol)1) solvation entropy change ()TDSsolv(cid:2) = )7.6 ± 0.6 kcalÆmol)1). is almost negated by an unfavorable The latter conformational entropy change ()TDSconf(cid:2) = 6.1 ± 0.6 kcalÆmol)1). Such thermodynamic signatures are
We compared the observed thermodynamic values with those of other carbohydrate binding systems such as glycoside hydrolases and lectins. First, the Kd value for (GlcNAc)6 binding to BcChi-A is approximately 3-fold and 6-fold higher than that observed for the GH18 chitinases Chit-42 from Tricho- derma harzianum and ChiB from Serratia marcescens. Moreover, all three chitinases demonstrate a clear pro- portionality between chain length and binding strength
FEBS Journal 278 (2011) 3991–4001 ª 2011 The Authors Journal compilation ª 2011 FEBS
3995
T. Ohnuma et al. Oligosaccharide binding to a family GH19 chitinase
Table 2. Thermodynamic parameters for binding of (GlcNAc)n (n = 3–6) to BcChi-A-E61A at 30 (cid:2)C and pH 7.0 as determined by ITC.
Substrate Kd (lm) DGr(cid:2) (kcalÆmol)1) DHr(cid:2) (kcalÆmol)1) )TDSr(cid:2) (kcalÆmol)1) DSr(cid:2) (calÆK)1Æmol)1)
)3 ± 1 )1 ± 1 )3 ± 1 )11 ± 2 0.77 ± 0.06 1.8 ± 0.3 16 ± 1 230 ± 20 )8.5 ± 0.1 )7.9 ± 0.1 )6.6 ± 0.1 )5.0 ± 0.1 )9.5 ± 0.1 )8.1 ± 0.4 )7.6 ± 0.3 )8.3 ± 0.6 1.0 ± 0.1 0.2 ± 0.4 1.0 ± 0.3 3.3 ± 0.6 (GlcNAc)6 (GlcNAc)5 (GlcNAc)4 (GlcNAc)3
Table 3. Thermodynamic parameters for binding of (GlcNAc)6 to BcChi-A-E61A at 30 (cid:2)C and at various pH values as determined by ITC.
pH DGr(cid:2) (kcalÆmol)1) DHr(cid:2) (kcalÆmol)1) )TDSr(cid:2) (kcalÆmol)1) DSr(cid:2) (calÆK)1Æmol)1) Kd (lm)
)1 ± 1 )3 ± 1 )4 ± 1 6.0 7.0 8.0 1.0 ± 0.1 0.77 ± 0.06 0.91 ± 0.05 )8.3 ± 0.1 )8.5 ± 0.1 )8.4 ± 0.1 )8.7 ± 0.1 )9.5 ± 0.1 )9.7 ± 0.2 0.4 ± 0.1 1.0 ± 0.1 1.3 ± 0.1
Table 4. Parameterization of the entropic term at 30 (cid:2)C and pH 7.0. Data for DCp,r(cid:2) are derived from the temperature dependence of DHr(cid:2).
DCp,r(cid:2) (calÆK)1Æmol)1) DSr(cid:2) (calÆK)1Æmol)1) DSmix(cid:2) (calÆK)1Æmol)1) DSsolv(cid:2) (calÆK)1Æmol)1) DSconf(cid:2) (calÆK)1Æmol)1)
)105 ± 8 )3 ± 1 )8 25 ± 2 )20 ± 2
facilitated by favorable
larger (DHr(cid:2) = 3.8 kcalÆmol)1) and the strong binding conformation changes is ()TDSconf(cid:2) = )11 kcalÆmol)1) and, to a smaller extent, desolvation ()TDSsolv(cid:2) = )5 kcalÆmol)1). These two examples appear to be anomalies in carbohydrate inter- actions with respect to having unfavorable enthalpic terms.
The binding of (GlcNAc)6 to BcChi-A was inde- pendent of pH. For interaction, this cannot only be due to the fact that there are no titratable groups on the ligands, but must also imply that the titratable groups remaining in the catalytic center of BcChi-A after mutating the catalytic Glu61 to a non-titratable Ala are not significantly titrated in the pH 6.0–8.0 range.
the Tm elevation (DTm)
also observed for methyl 3-O-(a-D-mannopyranosy1)-a- D-mannopyranoside binding to the lectin concanavalin A [24], xylo-oligosaccharides (XOS) to xylanases [25] and chitotriose to lysozyme [26]. The latter system devi- ates to a certain extent with a much more negative con- formational entropy change compared with the positive solvation entropy change ()TDSsolv(cid:2) = )8 kcalÆmol)1 versus )TDSconf(cid:2) = 14 kcalÆmol)1). When the binding of 18 inhibitors to the family GH1 b-glucosidase TmGH1 was studied, it was shown that, even though 11 had positive entropy changes, all 18 had negative enthalpy changes [27]. An interesting case is the binding of N-acetyl gluconolactam, N-acetylglucosaminono-1,5- lactone O-(phenylcarbamoyl)-(Z)-oxime (PUGNAc) and N-acetylglucosaminono-1,5-lactone (Z)-oxime (LO- GNAc) to a bacterial O-GlcNAcase homologue. The lactam and PUGNAc binding is clearly driven by favor- able enthalpy changes with little entropic contribution, but the LOGNAc binding is facilitated by an increase in entropy with no contribution by enthalpy [28]. For (GlcNAc)6 binding to a family 18 chitinase (chitinase B of S. marcescens), the thermodynamic signatures differ remarkably from the ones discussed. Here, binding is accompanied by an enthalpic penalty (DHr(cid:2) = 1.2 kcalÆmol)1) and it is desolvation ()TDSsolv(cid:2) = )13 kcalÆmol)1) that drives the binding with a non-contrib- uting conformational entropy change ()TDSconf(cid:2) = )0.1 kcalÆmol)1) [29]. For allosamidin binding to S. marcescens chitinase B, the enthalpic penalty is even
BcChi-A hydrolyzed chitin oligosaccharides at rates (GlcNAc)6 > (GlcNAc)5 > (GlcNAc)4 in the order >> (GlcNAc)3, suggesting that the longer the chain length of the substrate, the higher the affinity of the oligosaccharides to the enzyme (Fig. 1). A similar sug- gestion was obtained from the thermal unfolding experiments shown in Fig. 2. The transition tempera- ture of thermal unfolding (Tm) was elevated by the addition of (GlcNAc)n (n = 2, 3, 4, 5 and 6). The Tm elevations were found to be proportional to the poly- merization degree of the (GlcNAc)n added. It is clear is derived from an that increase in the number of interaction sites between BcChi-A and (GlcNAc)n (n = 2–6). The Tm data listed
FEBS Journal 278 (2011) 3991–4001 ª 2011 The Authors Journal compilation ª 2011 FEBS
3996
T. Ohnuma et al. Oligosaccharide binding to a family GH19 chitinase
least
favorable
Fig. 4. Temperature dependence of (GlcNAc)6 binding to BcChi-A- E61A at pH 7.0. The plots of DHr(cid:2) versus temperature yield the change in heat capacity (DCp(cid:2)) as the slope. The DCp(cid:2) value was calculated to be )105 ± 8 calÆK)1Æmol)1.
in Table 1 are also consistent with the substrate-size dependence of binding free energy change listed in Table 2. All of the idea that these data support BcChi-A has at least six subsites. In a previous paper [16]
it has been shown that (GlcNAc)6 productively binds to the enzyme through three types of productive binding modes, from )4 to +2, from )3 to +3, and from )2 to +4 subsites of BcChi-A. (GlcNAc)5 binds to subsites from )3 to +2 and from )2 to +3. From the oligosaccharide diges- tion experiments (Fig. 1C), (GlcNAc)4 was found to productively bind to )2 to +2 subsites. (GlcNAc)3 binds to )2 to +1 subsites to be split into (GlcNAc)2 and GlcNAc (Fig. 1E). The binding modes are summa- rized in Fig. 5 together with the binding free energy changes. Thus, the binding free energy change of subsite +2 is estimated to be )1.6 kcalÆmol)1 by sub- (GlcNAc)3 the free energy change of traction of ()5.0 kcalÆmol)1) ()6.6 from that of
(GlcNAc)4
Fig. 5. Binding modes and binding free energy changes of chitin ol- igosaccharides to a family GH19 chitinase from the moss Bryum Coronatum.
kcalÆmol)1). The difference between the binding free energy changes for (GlcNAc)4 and (GlcNAc)6 is calcu- lated to be )1.9 kcalÆmol)1, suggesting that there are at two more subsites that contribute with a DGr(cid:2) (cid:3) )0.9 kcalÆmol)1 each. These values correspond well with XOS binding to xylanase where the free energy change contribution from individual subsites is (cid:3) )0.7 kcalÆmol)1 [25]. Both (GlcNAc)n–chitinase and XOS–xylanase interactions experience a more negative DGr(cid:2) with respect to an increase in substrate length due to a decrease in DHr(cid:2), in spite of smaller magni- tudes for the chitinase, DHr(cid:2) (cid:3) )0.9 kcalÆmol)1 per unit outside the )2 to +2 subsites compared with DHr(cid:2) (cid:3) )3 kcalÆmol)1 per unit for the xylanase outside the )2 and )1 subsite [25]. The binding of (GlcNAc)3 deviates somewhat from the binding of the longer chi- tooligosaccharides in that the enthalpic contribution is 0.7 kcalÆmol)1 than (see Table 2) more observed for (GlcNA)4. This is not surprising as there are likely to be many favorable interactions between the sugars and BcChi-A in the )2 to +1 subsites to overcome the loss of free energy associated with the necessary distortion of the sugar bound in the )1 sub- site to allow for hydrolysis. Such thermodynamic sig- natures have been observed previously for various chitinases by both direct calorimetric measurements [30] and calculations of binding free energies from kinetic measurements [31,32] as discussed below. A subsite energy mapping has also been done for the (Glc- NAc)n–S. marcescens chitinase B interactions. In that work, DGr(cid:2) for each subsite–sugar unit interaction var- ies, with )2.7 kcalÆmol)1 for subsite +2, (cid:3) )1 kcalÆ- mol)1 for subsites +3 and +4, and )0.3 kcalÆmol)1 for subsite )3 [30]. In addition, binding to +2 and +3 is associated with favorable entropy gains and unfavorable enthalpy gains despite some enthalpically favorable stacking interactions with Trp and Phe residues. It is suggested that favorable conformational changes and unfavorable intermolecular bond breaks within the pro- tein are triggered by the binding of substrate to these subsites, which is responsible for the observed thermo- dynamic values [29]. Moreover, binding free energies have been estimated for individual sugar-binding sub- sites using a purely kinetic approach for (GlcNAc)n interactions with both a family GH18 chitinase [31] and a family GH19 chitinase [32]. The former yielded )3.8, +3.1, )2.5, )3.0, +0.8 and )1.8 kcalÆmol)1 for the )2 to +4 subsites, respectively, while the latter gave )0.4, )4.7, +3.4, )0.5, )2.3 and )1.0 kcalÆmol)1 for the )3 to +3 subsites, respectively. It is interesting to observe that the two subsites outside )2 to +2 of the latter (family GH19 enzyme) contribute with a free energy change upon binding of )1.4 kcalÆmol)1, which is close to the
FEBS Journal 278 (2011) 3991–4001 ª 2011 The Authors Journal compilation ª 2011 FEBS
3997
T. Ohnuma et al. Oligosaccharide binding to a family GH19 chitinase
Trp103 is involved in the substrate binding of BcChi-A in a similar manner to that of Trp62 of the lysozyme. To confirm this hypothesis and to obtain more insight into the substrate binding mechanism of BcChi-A, a crystal the BcChi-A–(GlcNAc)n structure determination of complex is currently in progress.
)1.9 kcalÆmol)1 observed in our work. Moreover, it is apparent that binding to the )1 subsite for both family GH19 and family GH18 chitinases is associated with a positive free energy change that is most probably due to the necessary distortion of the sugar bound in subsite )1.
Experimental procedures
Chemicals
binding
BcChi-A-E61A
(GlcNAc)n (n = 1–6) oligosaccharides were purchased from Seikagaku Biobusiness Co. (Tokyo, Japan). Other reagents were of analytical grade commercially available.
Protein expression and purification
Zolotnitsky et al. [25] demonstrated that the DCp val- ues can be used to evaluate the contribution of stacking- hydrophobic interactions to xylosaccharide binding to a family GH10 xylanase. They estimated that one aro- matic residue located in the catalytic cleft of the enzyme contributes about )100 to )150 calÆK)1Æmol)1 to DCp. The change in heat capacity (DCp = DDH ⁄ DT) for (GlcNAc)6 was to )105 ± 8 calÆK)1Æmol)1, possibly suggesting that an aromatic residue of BcChi-A contributes to binding through a hydrophobic interaction with (GlcNAc)6. In fact, as shown in Fig. 6, one tryptophan residue (Trp103) is found near the catalytic residue Glu61 and its side chain is surface exposed within the putative cata- lytic cleft of the modeled three-dimensional structure of BcChi-A. Our result is consistent with the participation of this residue in substrate binding. This tryptophan res- idue appears to be similar to Trp62 of hen egg white lysozyme in its localization (Fig. 6). Trp62 is involved in substrate binding of the lysozyme, and significantly con- tributes to the enzymatic activity [33]. It is likely that
Site-directed mutagenesis was done using the QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA). The primers used for the Glu61 fi Ala mutation were 5¢-CTT GGTAACATCAACCAGGCATCCGGAGGGTTGCAGT TTA-3¢ and 5¢-TAAACTGCAACCCTCCGGATGCCTG GTTGATGTTACCAAG-3¢ (the mutation site is underlined). The wild-type and mutated BcChi-A (BcChi-A-E61A) were successfully produced and purified by the methods described previously [16]. We confirmed that the profile of the CD spec- trum of BcChi-A-E61A is nearly identical to that of the wild- type and that BcChi-A-E61A is completely inactive toward any chitinase substrates. Protein concentration was deter- mined by reading absorbance at 280 nm, using an extinction coefficient of BcChi-A obtained from the equation proposed by Pace et al. [34].
HPLC-based determination of the reaction time-course
Glu35 Glu61
Trp62
Trp103
The reaction products from the chitinase-catalyzed hydroly- sis of (GlcNAc)n (n = 3, 4, 5 or 6) were quantitatively determined by gel filtration HPLC. The enzymatic reaction was performed in 50 mM sodium acetate buffer, pH 5.0, at 40 (cid:2)C. Enzyme and substrate concentrations were 0.04 and 4.75 mM, respectively, except for the reaction with (Glc- NAc)3 in which the enzyme concentration was increased 10-fold. To completely terminate the enzymatic reaction at a given incubation time, a portion of the reaction mixture was mixed with an equal volume of 0.1 M NaOH solution and immediately frozen in liquid nitrogen. The resultant solution was applied to a gel filtration column of TSK- GEL G2000PW (Tosoh, Tokyo, Japan) and eluted with distilled water at a flow rate of 0.3 mLÆmin)1. Oligosaccha- rides were detected by ultraviolet absorption at 220 nm. Peak areas obtained for individual oligosaccharides were converted to molar concentrations, which were then plotted against reaction time to obtain the reaction time-course.
FEBS Journal 278 (2011) 3991–4001 ª 2011 The Authors Journal compilation ª 2011 FEBS
3998
Fig. 6. The three-dimensional model of BcChi-A (light green) was superimposed on the crystal structure of hen egg white lysozyme (cyan) in complex with (GlcNAc)6 (grey) (PDB: 1sfb) [41] (using just the proton donor residues, Glu61 in BcChi-A and Glu35 in hen egg white lysozyme, as reference) with the Pair Fitting wizard of the molecular visualization program PYMOL.
T. Ohnuma et al. Oligosaccharide binding to a family GH19 chitinase
Table 5. Concentrations of the protein and the ligand solutions used for the ITC experiments.
HPLC analysis of anomers of the enzymatic products from (GlcNAc)3
Ligand Ligand concentrations BcChi-A-E61A (lM)
The anomeric form of the enzymatic products was deter- mined by HPLC. Enzymatic hydrolysis of (GlcNAc)3 was carried out in 50 mM sodium acetate buffer, pH 5.0, at 25 (cid:2)C. Concentrations of BcChi-A and (GlcNAc)3 were 0.4 lM and 4.75 mM, respectively. After 4, 10, 15 and 20 min of incubation, a portion of the reaction mixture was directly injected into a TSK-GEL Amide 80 column (Tos- oh), and the elution was performed with acetonitrile ⁄ H2O (7 : 3) at a flow rate of 0.7 mLÆmin)1. The substrate and enzymatic products were detected by ultraviolet absorption at 220 nm. The splitting mode of (GlcNAc)3 was qualita- tively estimated from the a ⁄ b ratio of each oligosaccharide product in the HPLC profiles [35].
250 lM 250 lM 1.2 mM 7 mM 15 15 55 55 (GlcNAc)6 (GlcNAc)5 (GlcNAc)4 (GlcNAc)3
Thermal unfolding experiments
concentration. For three of the four ligands ITC experi- ments could be optimized to give a c value in the range 10 < c < 1000. This ensures that Ka can be determined from the Wiseman binding isotherm. Titration of (Glc- NAc)3 and BcChi-A-E61A yielded a c value of 0.2. Binding thermodynamics can be obtained using ITC even when c is in the range 0.01 < c < 10 if a sufficient portion of the binding isotherm is used for analysis [37]. This is achieved by ensuring a high molar ratio of ligand to protein at the end of the titration, accurate knowledge of the concentra- tions of both ligand and receptor, an adequate level of sig- nal-to-noise in the data, and known stoichiometry. All of these conditions were satisfied, with the possible excep- tion of the stoichiometry issue. It is conceivable that two (GlcNAc)3 molecules could bind simultaneously. However, the two-site binding model did not provide a satisfactory fit between experimental and theoretical data, whereas the one-site binding model did (see below).
To obtain the thermal unfolding curve of the protein, the CD value at 222 nm was monitored using a Jasco J-720 spec- tropolarimeter (JASCO, Tokyo, Japan) (cell length 0.1 cm), while the solution temperature was raised at a rate of 1 (cid:2)CÆmin)1 using a temperature controller (PTC-423L, Jas- co). To facilitate comparison between unfolding curves, the experimental data were normalized as follows. The fraction of unfolded protein at each temperature was calculated from the CD value by linearly extrapolating the pre- and post- transition baselines into the transition zone, and was plotted against the temperature. Final concentrations of the enzyme and (GlcNAc)n were 8 lM and 8 mM, respectively.
Analysis of calorimetric data
ITC experiments
ITC data were collected automatically using the MICROCAL ORIGIN v.7.0 software accompanying the VP-ITC system [36]. Prior to further analysis, data were corrected for heat of dilution by subtracting the heat remaining after satura- tion of binding sites on the enzyme. These heat values had the same magnitudes as that for titrating ligand into buffer alone. Data were fitted using a nonlinear least-squares algo- rithm and a single-site binding model employed by the ORI- GIN software that accompanies the VP-ITC system. All data from the binding reactions fitted well with the single- site binding model yielding the stoichiometry (n), equilib- rium binding association constant (Ka) and the reaction enthalpy change (DHr(cid:2)) of the reaction. The value of n was found to be between 0.9 and 1.1 for all reactions. The reac- tion free energy change (DGr(cid:2)) and the reaction entropy change (DSr(cid:2)) were calculated from the relation
(cid:2)
ð5Þ
DGr
(cid:2) ¼ (cid:5)RT ln Ka ¼ DHr
(cid:2) (cid:5) TDSr
ITC experiments were performed with a VP-ITC system from Microcal Inc. (Northampton, MA, USA) [36]. Solu- tions were thoroughly degassed prior to experiments to avoid air bubbles in the calorimeter. Typically, the BcChi-A- E61A solution in 20 mM sodium phosphate buffer (pH 6.0, 7.0 and 8.0) at 30 (cid:2)C was placed in the reaction cell with a volume of 1.42 mL, and the ligand solutions in the identical buffers were placed in the ITC syringe. For examining the temperature dependence, ITC measurements were performed at pH 7.0, while the temperature was varied from 20 to 25, 30 and 37 (cid:2)C. Concentrations of the protein and the ligand solutions used for the ITC experiments are listed in Table 5. For all titrations, 8 lL aliquots were injected into the reac- tion cell at 200-s intervals with a stirring speed of 260 r.p.m. The titrations were completed after 38 injections. The shape of the ITC binding curve is determined by the so-called Wiseman c value [36], which can be expressed as
ð4Þ
c ¼ nKa½M(cid:4)t
Errors are reported as standard deviations of at least three experiments at each temperature. A description of how the entropic term is parameterized has been described in detail previously [38,39].
where n is the stoichiometry of the reaction, Ka is the equi- librium binding association constant and [M]t is the protein
FEBS Journal 278 (2011) 3991–4001 ª 2011 The Authors Journal compilation ª 2011 FEBS
3999
T. Ohnuma et al. Oligosaccharide binding to a family GH19 chitinase
Computer-aided modeling of the three-dimensional structure
10 Huet J, Rucktooa P, Clantin B, Azarkan M, Looze Y, Villeret V & Wintjens R (2008) X-ray structure of papaya chitinase reveals the substrate binding mode of glycosyl hydrolase family 19 chitinases. Biochemistry 47, 8283–8291.
11 Ohno T, Armand S, Hata T, Nikaidou N, Henrissat B, Mitsutomi M & Watanabe T (1996) A modular family 19 chitinase found in the prokaryotic organism Streptomyces griseus HUT 6037. J Bacteriol 178, 5065–5070.
SWISS MODEL, a knowledge-based protein modeling tool [40], was used to predict the tertiary structure of BcChi-A from the known X-ray structure of a bacterial family 19 chitinase from S. coelicolor A3(2) (Protein Data Bank entry 2CJL) [14]. After modeling, the entire structure was visual- ized using the program PYMOL (http://www.pymol.org/). To superimpose the modeled BcChi-A structure on the crystal structure of hen egg white lysozyme in complex with (Glc- NAc)6 (PDB entry, 1sfb) [41], the Pair Fitting wizard of the PYMOL software was used.
12 Saito A, Fujii T, Yoneyama T, Redenbach M, Ohno T, Watanabe T & Miyashita K (1999) High-multiplicity of chitinase genes in Streptomyces coelicolor A3(2). Biosci Biotechnol Biochem 63, 710–718.
13 Wiweger M, Farbos I, Ingouff M, Lagercrantz U &
Acknowledgements
Von Arnold S (2003) Expression of Chia4-Pa chitinase genes during somatic and zygotic embryo development in Norway spruce (Picea abies): similarities and differ- ences between gymnosperm and angiosperm class IV chitinases. J Exp Bot 393, 2691–2699.
We are grateful to Dr Karl J. Kramer, USDA-ARS Center for Grain and Animal Health Research, for his critical reading of the manuscript. Thanks are also due to Mr Mitsuru Kubota, Atsushi Urasaki and Takuya Nagata for their technical assistance. This research was supported by FY 2010 Researcher Exchange Program between JSPS and The Research Council of Norway.
14 Hoell IA, Dalhus B, Heggset EB, Aspmo SI & Eijsink VG (2006) Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes. FEBS J 273, 4889–4900.
15 Ubhayasekera W, Rawat R, Ho SW, Wiweger M, Von
References
1 Kasprzewska A (2003) Plant chitinases – regulation and
Arnold S, Chye ML & Mowbray SL (2009) The first crys- tal structures of a family 19 class IV chitinase: the enzyme from Norway spruce. Plant Mol Biol 71, 277–289.
function. Cell Mol Biol Lett 8, 809–824.
16 Taira T, Mahoe Y, Kawamoto N, Onaga S, Iwasaki H,
2 Duo-Chuan L (2006) Review of fungal chitinases.
Mycopathologia 161, 345–360.
3 Bhattacharya D, Nagpure A & Gupta RK (2007)
Ohnuma T & Fukamizo T (2011) Cloning and characterization of a small family 19 chitinase from moss (Bryum coronatum). Glycobiology 21, 644– 654.
Bacterial chitinases: properties and potential. Crit Rev Biotechnol 27, 21–28.
17 Ohnuma T, Yagi M, Yamagami T, Taira T, Aso Y &
4 Arakane Y & Muthukrishnan S (2010) Insect chitinase
and chitinase-like proteins. Cell Mol Life Sci 67, 201–216.
5 Donnelly LE & Barnes PJ (2004) Acidic mammalian
Ishiguro M (2002) Molecular cloning, functional expres- sion, and mutagenesis of cDNA encoding rye (Secale Cereale) seed chitinase-C. Biosci Biotechnol Biochem 66, 277–284.
chitinase – a potential target for asthma therapy. Trends Pharmacol Sci 25, 509–511.
18 Baker BM & Murphy KP (1997) Dissecting the energet- ics of a protein–protein interaction: the binding of ovomucoid third domain to elastase. J Mol Biol 268, 557–569.
6 Collinge DB, Kragh KM, Mikkelsen JD, Nielsen KK, Rasmussen U & Vad K (1993) Plant chitinases. Plant J 3, 31–40.
19 Baldwin RL (1986) Temperature dependence of the
hydrophobic interaction in protein folding. Proc Natl Acad Sci USA 83, 8069–8072.
20 Murphy KP, Privalov PL & Gill SJ (1990) Common
features of protein unfolding and dissolution of hydro- phobic compounds. Science 247, 559–561.
7 Melchers LS, Apotheker-De Groot M, Van Der Knaap JA, Ponstein AS, Sela-Buurlage MB, Bol JF, Cornelis- sen BJ, Van Den Elzen PJ & Linthorst HJ (1994) A new class of tobacco chitinases homologous to bacterial exo-chitinases displays antifungal activity. Plant J 5, 469–480.
8 Henrissat B & Davies G (1997) Structural and
21 Murphy KP (1994) Hydration and convergence temper- atures: on the use and interpretation of correlation plots. Biophys Chem 51, 311–326.
sequence-based classification of glycoside hydrolases. Curr Opin Struct Biol 7, 637–644.
9 Hart PJ, Monzingo AF, Ready MP, Ernst SR & Rober-
22 Hahn M, Hennig M, Schlesier B & Ho¨ hne W (2000) Structure of jack bean chitinase. Acta Cryst D56, 1096–1099.
tus JD (1993) Crystal structure of an endochitinase from Hordeum vulgare L. seeds. J Mol Biol 229, 189– 193.
FEBS Journal 278 (2011) 3991–4001 ª 2011 The Authors Journal compilation ª 2011 FEBS
4000
23 Kezuka Y, Kojima M, Mizuno R, Suzuki K, Watanabe T & Nonaka T (2010) Structure of full-length class I chitinase from rice revealed by X-ray crystallography and small-angle X-ray scattering. Proteins 78, 2295–2305.
32 Sasaki C, Itoh Y, Takehara H, Kuhara S & Fukamizo T (2003) Family 19 chitinase from rice (Oryza sativa L.): substrate-binding subsites demonstrated by kinetic and molecular modeling studies. Plant Mol Biol 52, 43–52.
24 Chervenak MC & Toone EJ (1995) Calorimetric
33 Maenaka K, Kawai G, Watanabe K, Sunada F &
analysis of the binding of lectins with overlapping carbohydrate-binding ligand specificities. Biochemistry 34, 5685–5695.
Kumagai I (1994) Functional and structural role of a tryptophan generally observed in protein–carbohydrate interaction. Trp-62 of hen egg white lysozyme. J Biol Chem 269, 7070–7075.
34 Pace CN, Vajdos F, Fee L, Grimsley G & Gray T
25 Zolotnitsky G, Cogan U, Adir N, Solomon V, Shoham G & Shoham Y (2004) Mapping glycoside hydrolase substrate subsites by isothermal titration calorimetry. Proc Natl Acad Sci USA 101, 11275–11280.
(1995) How to measure and predict the molar absorption coefficient of a protein. Protein Sci 4, 2411–2423.
35 Koga D, Yoshioka T & Arakane Y (1998) HPLC anal- ysis of anomeric formation and cleavage pattern by chitinolytic enzyme. Biosci Biotechnol Biochem 62, 1643–1646.
26 Garcia-Hernandez E, Zubillaga RA, Chavelas-Adame EA, Vazquez-Contreras E, Rojo-Dominguez A & Costas M (2003) Structural energetics of protein–carbo- hydrate interactions: insights derived from the study of lysozyme binding to its natural saccharide inhibitors. Protein Sci 12, 135–142.
36 Wiseman T, Williston S, Brandts JF & Lin LN (1989) Rapid measurement of binding constants and heats of binding using a new titration calorimeter. Anal Biochem 179, 131–137.
27 Gloster TM, Meloncelli P, Stick RV, Zechel D, Vasella A & Davies GJ (2007) Glycosidase inhibition: an assess- ment of the binding of 18 putative transition-state mim- ics. J Am Chem Soc 129, 2345–2354.
37 Turnbull WB & Daranas AH (2003) On the value of c: can low affinity systems be studied by isothermal titration calorimetry? J Am Chem Soc 125, 14859– 14866.
28 He Y, Bubb A, Stubbs K, Gloster T & Davies G (2011) Inhibition of a bacterial O-GlcNAcase homologue by lactone and lactam derivatives: structural, kinetic and thermodynamic analyses. Amino Acids, 40, 829–839.
29 Norberg AL, Eijsink VGH & Sørlie M (2010)
38 Cederkvist FH, Saua SF, Karlsen V, Sakuda S, Eijsink VGH & Sørlie M (2007) Thermodynamic analysis of allosamidin binding to a family 18 chitinase. Biochemis- try 46, 12347–12354.
Dissecting factors that contribute to ligand-binding energetics for family 18 chitinases. Thermochim Acta 511, 189–193.
39 Zakariassen H & Sørlie M (2007) Heat capacity changes in heme protein–ligand interactions. Thermochim Acta 464, 24–28.
40 Peitsch M (1995) Protein modeling by e-mail. Biotech-
nology 13, 658–660.
30 Norberg AL, Karlsen V, Hoell IA, Bakke I, Eijsink VGH & Sørlie M (2010) Determination of substrate binding energies in individual subsites of a family 18 chitinase. FEBS Lett 584, 4581–4585.
31 Fukamizo T, Sasaki C, Schelp E, Bortone K & Rober- tus JD (2001) Kinetic properties of chitinase-1 from the fungal pathogen Coccidioides immitis. Biochemistry 40, 2448–2454.
41 Von Dreele RB (2005) Binding of N-acetylglucosamine oligosaccharides to hen egg-white lysozyme: a powder diffraction study. Acta Crystallogr D: Biol Crystallogr 61, 22–32.
FEBS Journal 278 (2011) 3991–4001 ª 2011 The Authors Journal compilation ª 2011 FEBS
4001
T. Ohnuma et al. Oligosaccharide binding to a family GH19 chitinase
