Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist Mani D. Kalluri1,*, Praneel Datla2,*, Akshaya Bellary1,*, Khalander Basha1, Ashwani Sharma1, Anuradha Sharma1, Shiva Singh1, Shakti Upadhyay2 and Vikram Rajagopal1
1 Drug Discovery and Development Group, Reliance Life Sciences Pvt. Ltd, Navi Mumbai, India 2 EID Parry India Ltd, Chennai, India
Keywords inflammation; lipopolysaccharide; monocytes; NF-jB; TLR signalling; tumour necrosis factor-a
Correspondence V. Rajagopal, Drug Discovery and Development Group, Reliance Life Sciences Pvt. Ltd, Dhirubhai Ambani Life Sciences Center, Rabale, Navi Mumbai-400701, India Fax: +91 22 67678099 Tel: +91 22 67678854 E-mail: vikram_rajagopal@relbio.com
*These authors contributed equally to this work
(Received 9 December 2009, revised 16 January 2010, accepted 21 January 2010)
doi:10.1111/j.1742-4658.2010.07589.x
The regulation of cytokines and pro-inflammatory genes is an absolute essentiality to combat inflammatory diseases. The present study investigated the effects of 4-O-chloroacetyl-2,3-di-O-acetyl-6-O-levulinoyl-b-d-glucopyr- anosyl]-(1-3)-1-O-(p-methoxyphenyl)-2-deoxy-2-N-trichloroacetyl-4,6-O-ben- zylidene-a-d-glucopyranoside (RSCL-0409), a novel small molecule Toll-like receptor (TLR) signalling antagonist, and its mechanism of action in human monocytic (THP-1) cells stimulated with lipopolysaccharide (LPS). In THP-1 and RAW264.7 cells, RSCL-0409 suppressed LPS-induced production of tumour necrosis factor-a (TNF-a) with a 50% inhibitory concentration of 10.6 lm and mRNA expression of ICAM-1, Cox-2 and interleukin-8 with no evidence of cytotoxicity. RSCL-0409 also suppressed TNF-a production from LPS-stimulated human peripheral blood mononuclear cells. Similar results were obtained in vivo in a murine model of LPS-induced inflam- mation, where pretreatment with RSCL-0409 resulted in significant inhibi- tion of TNF-a. It is also noteworthy that RSCL-0409 suppressed the cytokine production induced by TLR2 and -4 ligands and not for any other TLR ligands. RSCL-0409 significantly inhibited p65 nuclear translocation induced by LPS. In conclusion, RSCL-0409, a novel small molecule, is the first of its kind in the category of carbohydrate-derived TLR signalling anta- gonists and could definitely be a promising therapeutic agent for inflam- matory diseases whose pathogenesis involves TLR2- or TLR4-mediated signalling processes.
Introduction
Humans have evolutionarily conserved immune recep- tors, Toll-like receptors (TLRs), which line up as our first defences against the invading foreign pathogens.
TLRs are able to elicit an immune response due to their ability to recognize the pathogen-associated molecular patterns of microbial pathogens, such as
Abbreviations IL, interleukin; IRAK, interleukin-1 receptor-associated kinase; LBP, lipopolysaccharide-binding protein; LPS, lipopolysaccharide; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; NF-jB, nuclear factor-jB; NO, nitric oxide; PBMC, peripheral blood mononuclear cell; RSCL-0409, [4-O-chloroacetyl-2,3-di-O-acetyl-6-O-levulinoyl-b-D-glucopyranosyl]-(1-3)-1-O-(p-methoxyphenyl)-2-deoxy-2-N-trichloroacetyl- 4,6-O-benzylidene-a-D-glucopyranoside; SEAP, secreted embryonic alkaline phosphatase; TIRAP, Toll receptor IL-1R domain-containing adapter protein; TLR, Toll-like receptor; TNF-a, tumour necrosis factor-a; TRAF, TNFR-associated factor 6.
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1639
M. D. Kalluri et al.
RSCL-0409 inhibits LPS-induced TLR signalling
lipoteichoic acid,
endogenous
as
duced during inflammation exhibiting the ability to induce maturation of dendritic cells through TLR4 [13,14]. Our goal was to use the available data to design novel selective carbohydrate-based, especially disaccharide-like molecules, that could serve either as agonists or antagonists of TLR signalling pathways. Working in that direction, we discovered a novel [4-O-chloroacetyl-2,3-di-O-acetyl- disaccharide derivative, 6-O-levulinoyl-b-d-glucopyranosyl]-(1-3)-1-O-(p-meth- oxyphenyl)-2-deoxy-2-N-trichloroacetyl-4,6-O-benzy- lidene-a-d-glucopyranoside (RSCL-0409), from the vast library of analogues synthesized, which selec- the TLR-mediated production of tively inhibits TNF-a and also mRNA expression of various pro- inflammatory genes that lead to NF-jB activation. The chemical structure of RSCL-0409 is shown in Fig. 1A. We have also delineated the mechanism responsible for the inhibitory effect.
Results
triggering inflammatory and bacteria and viruses, antiviral responses that destroy the invading patho- gens. So far, 11 TLRs have been described and for ligands have most of them, except TLR10, natural lipo- been identified. These include various proteins, peptides, lipopolysaccharides (LPS) and oligonucleotides (double-stranded RNA, single- stranded RNA and DNA) [1]. One of the prominent signalling mechanisms activated through TLRs is via LPS. LPS, the predominant structural component of the outer membrane of Gram-negative bacteria, acti- vates monocytes and macrophages, leading to the pro- duction of cytokines, such as tumour necrosis factor-a (TNF-a), interleukin-1 (IL-1) and IL-6, which in turn serve inflammatory mediators. Although TLR4 is primarily implicated as the TLR involved in LPS signalling, there are reports showing the involvement of TLR2 as the primary signal tran- ducing molecule in Gram-negative organisms, such as Porphyromonas gingivalis [2], which also have LPS as the cell component. Furthermore, studies have also shown TLR1 functioning as a coreceptor for TLR2 and its coexpression in transfected cells augmented response to Escherichia coli the TLR4-independent LPS [3].
RSCL-0409 inhibits the production of inflammatory cytokine TNF-a from LPS-stimulated THP-1, peripheral blood mononuclear cells (PBMCs) and RAW264.7 cells
(Mal). These
further
complete
such as
The cells become activated when the lipid A moiety of LPS attaches to the LPS-binding protein (LBP); this LPS ⁄ LBP complex binds to CD14, which is then trans- ferred to the TLR4–MD-2 complex [4,5]. Activation of mitogen-activated protein kinases and nuclear factor- jB (NF-jB) together with the release of inflammatory mediators [6] are the result of the signal transduction. The LPS signalling cascade involves a lot of adapter molecules, such as MyD88 [7] and Toll receptor IL-1R domain-containing adapter protein (TIRAP) ⁄ MyD88 adapter-like recruit kinases, IL-1R-associated kinase (IRAK)-1 and ⁄ or IRAK-2 [8], which in turn activate TNF receptor-associated factor 6-dependent signalling cascades, culminating in NF-jB activation [9] and the release of various inflammatory mediators. Prominent among them is TNF-a capable of exerting host-damaging effects seen in conditions such as sepsis, fever syndromes, cachexia and in auto- immune diseases rheumatic arthritis and inflammatory bowel disease [10,11].
carbohydrates or
role of pure
Human monocytic cells, THP-1, were stimulated with 250 ngÆmL)1 LPS in the presence and absence of vari- ous concentrations of RSCL-0409 (1–100 lm). TNF-a in the supernatants was measured by Duo-Set ELISA (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. RSCL-0409 inhibited the production of this pro-inflammatory mediator in a concentration-dependent manner (Fig. 2A); having a 50% inhibitory concentration value of 10.6 lm (calcu- lated using biodatafit software). We observed similar inhibition in both RAW264.7 cells and PBMCs stimu- lated with LPS (Fig. 2B, C). In addition, we checked its ability to inhibit TNF-a when stimulated with higher concentrations of LPS. As shown in Fig. 2E, RSCL-0409 at 10 lm showed an inhibition of TNF-a secretion even with 1000 ngÆmL)1 LPS stimulation and inhibition of TNF-a secretion a near observed at 100 lm, making it a potential candidate for use in clinical conditions such as septic shock where LPS concentrations are known to be very high. Cell viability as estimated by the 3-(4,5-dimethyl- thiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) method (Fig. 2D) did not show any cytotoxicity. These results clearly indicate that RSCL-0409 exerts an inhib- itory effect on the production of the pro-inflammatory mediator TNF-a from both mouse and human monocytes and macrophages stimulated with LPS.
Given the wide implications of TLR signalling, its regulation can alleviate the effects of pro-inflammatory mediators [12]. It is well documented that most known TLR ligands contain carbohydrate moieties. However, the potential its analogues as ligands for TLRs has unlimited scope of further investigation. Documented reports show low molecular mass hyaluronic acid oligosaccharides pro-
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1640
M. D. Kalluri et al.
RSCL-0409 inhibits LPS-induced TLR signalling
Chemical structure – RSCL-0409
A
B
Fig. 1. (A) Structure of RSCL-0409. (B) HPLC profile of RSCL-0409. RSCL-0409 was synthesized as mentioned in Materials and methods. The purified compound was subjected to HPLC to determine its purity. Peak 4 with a retention time (cid:2)3.6 min shows (cid:2)98.6% purity.
Inhibitory Effect on TLR1 ⁄ 2, -4 ligand-induced TNF-a
following stimulations with other ligands. In cells pre- treated with RSCL-0409, we observed inhibited TNF-a production from THP-1 cells stimulated with TLR1 ⁄ 2 and TLR4. We confirmed this selective inhibitory effect of RSCL-0409 on TLR-1 ⁄ 2- and TLR4-mediated TNF-a production in PBMCs (Fig. 3B) and a similar observation was also made in RAW264.7 cells (unpub- lished data). These results suggest that RSCL-0409 inhibits TNF-a production mediated by TLR1 ⁄ 2 and TLR4.
The activation of TLRs by specific ligands leads to the release of many inflammatory cytokines. Studies have shown that THP-1 cells are known to express all the TLRs. Therefore, we checked the effect of various TLR ligands on THP-1 monocytes in the presence and absence of RSCL-0409 (50 lm) and their ability to release TNF-a. As shown in Fig. 3A, we detected TNF-a secretion from cells stimulated with TLR1 ⁄ 2, TLR4 and TLR6. No detectable TNF-a was observed
To confirm the above observation, we checked for the ability of RSCL-0409 to inhibit nitric oxide (NO)
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1641
M. D. Kalluri et al.
RSCL-0409 inhibits LPS-induced TLR signalling
2500
3500
A
B
NS
3000
2000
2500
) l
1500
/
) l
***
/
2000
***
1000
m g p ( F N T
1500
m g p ( F N T
500
1000
***
***
500
0
L P S
0
C ontrol
L P S
C ontrol
R S C L-0409
R S C L-0409 + L P S
R S C L-0409 (50 µ M) + L P S R S C L-0409 (100 µ M) + L P S
R S C L-0409 (1, 10, 50, 100 µ M) R S C L-0409 (10 µ M) + L P S R S C L-0409 (1 µ M) + L P S
3000
C
125
D
NS
2500
100
) l
2000
*
/
y t i l i
75
1500
***
1000
m g p ( α - F N T
50
b a i v l l e C %
***
500
25
0
L P S
0
C ontrol
C ells
R S C L-0409 (1 µ M)
R S C L-0409 (10 µ M)
R S C L-0409 (50 µ M)
R S C L-0409 (100 µ M)
R S C L-0409 (100 µ M) + L P S R S C L-0409 (50 µ M) + L P S
R S C L-0409 (10 µ M) + L P S R S C L-0409 (1, 10, 50, 100 µ M) R S C L-0409 (1 µ M) + L P S
1600
E
1400
1200
250 ng·mL–1 500 ng·mL–1 1000 ng·mL–1
) l
1000
/
800
600
m g p ( F N T
400
200
0
L P S
1 µ M R S C L-0409 + L P S
10 µ M R S C L-0409 + L P S
50 µ M R S C L-0409 + L P S
100 µ M R S C L-0409 + L P S
Fig. 2. RSCL-0409 suppression of LPS-induced TNF-a in a dose-dependent manner and in different cell lines. Serum-starved human mono- cytic cells (THP-1; B), human PBMCs (B) and mouse macrophage cells (RAW264.7; C) were pretreated with the indicated concentrations of RSCL-0409 and then stimulated with LPS for 24 h. Culture supernatants were collected and assayed for TNF-a by ELISA. Data are expressed as means + standard error of three independent experiments. *P < 0.05, ***P < 0.001; LPS treated vs RSCL-0409 treated, NS, not significant. (D) Serum-starved THP-1 cells (2 · 105 cellsÆwell)1) were pretreated with RSCL-0409 in increasing concentrations (1, 10, 50 and 100 lM) 1 h before LPS stimulation. The viability of the cells was checked using MTT after 24 h incubation. The data represented are after the values have been normalized to the control. Error bars represent the standard error for three separate experiments. (E) Serum-starved THP-1 cells were stimulated with increasing concentrations of LPS (250–1000 ngÆmL)1) with and without pretreatment with RSCL-0409 (1–100 lM) for 24 h. The supernatant was then assayed for the ability of the cells to release TNF-a by ELISA. The data are a rep- resentation of two independent experiments.
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1642
M. D. Kalluri et al.
RSCL-0409 inhibits LPS-induced TLR signalling
Effect of RSCL-0409 on various TLR ligands in PBMCs
A
Effect of RSCL-0409 on various TLR ligands in THP-1 cells
B
1400
3000
1200
NS
2500
Ligands alone RSCL-0409
1000
Ligands alone RSCL-0409
) l
**
2000
) l
/
800
/
1500
600
**
m g p ( F N T
1000
m g p ( F N T
400
**
500
NS
200
***
0
0
35
C
24.0
NS
D
30
Ligands alone RSCL-0409
20.0
25
16.0
NS
*
20
12.0
NS
15
NS
) M µ ( e t i r t i
) M µ ( e t i r t i
N
N
8.0
***
10
*
***
4.0
5
***
***
0
0.0
L P S
L P S
R-848
M alp-2
C o ntrol
P oly(I:C)
C p G O D N 2395
C o ntrol P a m 3 C S K 4.3 H Cl
R S C L-0409 (5 µ M) + L P S
R S C L-0409 (10 µ M) + L P S
R S C L-0409 (2.5 µ M) + L P S
R S C L-0409 (1.25 µ M) + L P S
Fig. 3. RSCL-0409 inhibits TLR2, TLR4-induced TNF-a secretion in THP-1 monocytes and PBMCs. Serum-starved THP-1 cells (A) and PBMCs (B), 2 · 105 cellsÆwell)1, were pretreated with RSCL-0409 (50 lM) 1 h before TLR ligand treatment. The pretreated cells were stimu- lated with various TLR ligands at different concentrations (TLR1 ⁄ 2 75 ngÆmL)1, TLR3 75 lgÆmL)1, TLR4 750 ngÆmL)1, TLR5 75 ngÆmL)1, TLR6 75 ngÆmL)1, TLR7 ⁄ 8 7.5 lgÆmL)1 and TLR9 7.5 lgÆmL)1) for 24 h as per manufacturer’s instructions. The culture supernatant was then assayed for TNF-a secretion. Similar treatments were carried out on RAW 264.7 cells (C, D). We have used imidazoquinolines as TLR-7 ⁄ 8 for stimulation. Cells untreated with RSCL-0409 served as controls. Data are expressed as mean + standard error of two independent exper- iments. *P value < 0.05, **P value < 0.01, ***P value < 0.001; ligand-treated cells vs RSCL-0409-treated cells, NS, not significant.
this
induced by TLR ligands in RAW264.7 cells. RSCL- 0409 selectively inhibited TLR1 ⁄ 2- and LPS-induced NO production (Fig. 3C). RSCL-0409 had no signifi- cant effect on NO production induced by TLR3, shown in TLR6, TLR7 ⁄ 8 or TLR9 ligands. As Fig. 3D, RSCL-0409 inhibited LPS-stimulated NO production in a dose-dependent manner.
13- and six-fold increased expression after LPS stimu- lation, respectively. Furthermore, we wanted to deter- mine whether effect on mRNA inhibitory expression was seen on other pro-inflammatory genes, such as ICAM-1, Cox-2 and IL-8. We saw suppression of their mRNA expression levels at a concentration of 50 lm RSCL-0409 (Fig. 4C). It is also noteworthy that treatment of cells with RSCL-0409 did not show any effect in any of the genes at the mRNA level (Fig. 4C, lane 2).
Inhibitory effect on mRNA expression in THP-1 cells
RSCL-0409 blocks nuclear translocation of NF-jB and activation of NF-jB transcription factor
To determine whether the suppressive effect of RSCL- 0409 on cytokine production occurs at the mRNA expression level, we used quantitative real-time PCR to examine TNF-a and IL-6 mRNA expressions in THP- 1 cells stimulated with LPS. TNF-a (Fig. 4A) and IL-6 (Fig. 4B) mRNA expression was detected 1 h after LPS stimulation. The expression levels were similar to cell control in RSCL-0409 (50 lm) pretreated cells. On the other hand, TNF-a and IL-6 mRNA showed
LPS, together with a range of inflammatory stimuli, activates and induces nuclear translocation of NF-jB. NF-jB ⁄ IjB complexes are present in the cytoplasm under unstimulated conditions. Following stimulation with LPS, we see phosphorylation and subsequent deg- radation of IjB, allowing the free NF-jB to translo-
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1643
M. D. Kalluri et al.
RSCL-0409 inhibits LPS-induced TLR signalling
16.0
A
B
9.0
TNF-α
IL-6
14.0
8.0
7.0
12.0
6.0
10.0
5.0
8.0
l
4.0
l
e g n a h c d o F
6.0
e g n a h c d o F
3.0
NS
4.0
2.0
***
2.0
***
1.0
NS
0.0
0.0
Cell control
Cells + LPS
Cells + LPS
Cell control
Cells + RSCL- 0409 (50 µM)
Cells + RSCL- 0409 (50 µM) + LPS
Cells + RSCL- 0409 (50 µM)
Cells + RSCL- 0409 (50 µM) + LPS
C
RSCL-0409 + LPS
LPS
RSCL-0409
Control
Lanes
M
1
2
3
4
0
1
2
6
7
8
3
5
ICAM-1
4 Fold change
Time (min)
60
60
60
60
LPS
+
+
–
–
RSCL-0409 + LPS
+
RSCL-0409
–
+
–
LPS
ICAM-1
282 bp
RSCL-0409
Control
278 bp
Cox-2
0
1
4
5
6
2
Cox-2
3 Fold change
IL-8
221 bp
RSCL-0409 + LPS
LPS
β-actin
313 bp
RSCL-0409
Control
0
2
4
6
8
10
IL- 8
Fold change
Fig. 4. Inhibitory effect of RSCL-0409 on mRNA expression in THP-1 cells. (A, B) Total RNA was isolated from THP-1 cells 1 h after expo- sure to LPS (250 ngÆmL)1) with or without 50 lM RSCL-0409. The cDNA was used for real-time PCR with primers specific for human TNF-a, IL-6 and for the housekeeping gene b-actin. The fold change of TNF-a and IL-6 mRNA in treated cells over control was obtained after correc- tion for the amount of b-actin. Error bars represent the standard error for three separate experiments. ***P value < 0.001; LPS-treated cells vs RSCL-0409-treated cells, NS, not significant. (C) cDNA from an experiment similar to (A) was used to amplify inflammatory genes (ICAM-1, Cox-2 and IL-8) using specific primers (see Materials and methods) with b-actin serving as the internal control. The data are representative of three independent experiments.
cate into the nucleus to activate genes with NF-jB- binding regions. Therefore, we checked whether RSCL-0409 blocked any signals responsible for NF-jB
signalling leading to nuclear translocation. RSCL-0409 prevented IjB-a degradation and phosphorylation of the p65 subunit (data not shown), resulting in the
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1644
M. D. Kalluri et al.
RSCL-0409 inhibits LPS-induced TLR signalling
A
p65NF-kB
Tubulin
1
2
3
4
5
6
7
Lanes
inhibition of downstream signalling. Further down- stream, we saw partial translocation of NF-jB from the cytoplasm into the nucleus within 60 min, which was blocked when cells were pretreated with RSCL- 0409, as shown in Fig. 5A.
Time (min)
30
60
120
30
60
120
0
–
+
+
+
+
+
+
LPS
+
+
+
RSCL-0409
–
–
–
–
RSCL-0409+LPS-60
RSCL-0409+LPS-30
RSCL-0409+LPS-15
LPS-120
LPS-60
LPS-30
Control
0
1
2
3
4
5
6
7
8
9
Fold change
We confirmed the suppressive effect of RSCL-0409 on the NF-jB signalling pathway using an NF-jB reporter assay. In THP-1 blue CD14 cells containing stably transfected NF-jB reporter plasmids expressing the secreted embryonic alkaline phosphatase (SEAP) gene on stimulation with a TLR4 ligand, LPS released large amounts of SEAP into culture medium, which was blocked in a dose-dependent manner by pretreat- ment of cells with RSCL-0409 (Fig. 5B). These observations further confirm that RSCL-0409 inhibits LPS-induced TLR-mediated activation of NF-jB transcription factor.
120
.0
B
100.0
NS
80.0
Effect of RSCL-0409 on LPS-induced TNF-a production in vivo
**
60.0
***
40.0
n o i t e r c e s P A E S e v
i t a
l
NS
NS
NS
20.0
e R
0.0
L P S
C ell c o ntrol
C ells + R S C L-0409 (10 µ M) C ells + R S C L-0409 (50 µ M) C ells + R S C L-0409 (1 µ M) + L P S C ells + R S C L-0409 (10 µ M) + L P S C ells + R S C L-0409 (1 µ M) C ells + R S C L-0409 (50 µ M) + L P S
To follow-up on our in vitro observations, we tested the effect of RSCL-0409 pretreatment in a murine model of LPS-induced inflammation. Balb ⁄ C was trea- ted with RSCL-0409, 30 min before LPS injection. Blood samples were taken 1 h after LPS injection for TNF-a analysis. As shown in Fig. 6, we saw (cid:2) 53 and 64% inhibition of LPS-induced TNF-a production at 1 h at 10 and 20 mgÆkg)1 injected RSCL-0409, respec- tively.
Discussion
The release of multiple pro-inflammatory cytochemo- kines is a signature feature of the pathophysiology of inflammation induced by LPS. These processes, which involve a number of signalling molecules, bring along with them their share of complexities. Thus, a good anti-inflammatory agent targeting such a complex sig- nalling mechanism needs to modulate this pro-inflam- matory process, preferably at an early stage of signalling. Our research focuses on identifying such novel molecules and taking them forward as novel anti-inflammatory drugs.
Fig. 5. RSCL-0409 blocks nuclear translocation of NF-jB and NF-jB activation in reporter assays. (A) Serum-starved THP-1 cells were treated with 50 lM RSCL-0409. The nuclear fractions were obtained from LPS-stimulated THP-1 cells at the indicated times and processed for immunoblots as mentioned earlier using a NF-jB-specific antibody. The blot was stripped and reprobed with an anti-tubulin Ig to ensure equal loading. All the results shown are representative of three separate experiments. (B) THP-1 CD14 blue in cells (Invivogen) transfected with a SEAP reporter construct, which the reporter expression was regulated by the NF-jB pro- moter, were stimulated with LPS (250 ngÆmL)1) with or without RSCL-0409 for 24 h. The reporter activity was determined using the Quanti Blue kit. The data are plotted as the relative change in reporter activity. The data shown are the average from three inde- pendent experiments performed in duplicate. NS, not significant **P value < 0.01, ***P value < 0.001; cells vs RSCL-0409 treated; LPS treated vs RSCL-0409 followed by treated.
its potency is
that RSCL-0409 exerts similar inhibitory effects in both human monocytes and mouse macrophages, indi- cating that spread across different species.
With TLRs gaining prominence as drug targets, numerous agonists are currently being developed [15].
In our current study, we synthesized a library of novel small carbohydrate-derived analogues and identi- fied a novel gluco-disaccharide derivative, RSCL-0409, through our screening process that exhibits strong anti-inflammatory properties both in in vitro and in vivo. It inhibits LPS-induced signalling in cultured monocytes and reduces NF-jB-dependent expression of pro-inflammatory genes, ICAM-1, Cox-2 and IL-8, through a TLR-mediated process. It is of significance
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1645
M. D. Kalluri et al.
RSCL-0409 inhibits LPS-induced TLR signalling
2000
) l
PBMCs and RAW264.7 cells, indicating its effectiveness on immune cells of different origins.
/
1500
1000
***
***
500
m g p ( e s a e l e r F N T
0
C o ntrol
Place b o
L P S (225 µ g) R S C L-0409 (20 m g·k g–1) + L P S R S C L-0409 (10 m g·k g–1) + L P S R S C L-0409 (20 m g·k g–1) R S C L-0409 (10 m g·k g–1)
Signalling through LPS induces the expression of many cytochemokines and adhesion molecules apart from TNF-a [6], with NF-jB being the prominent transcription factor involved in their regulation. Our preliminary studies indicated that RSCL-0409 inhibited the mRNA expression of pro-inflammatory genes ICAM-1, Cox-2 and IL-8. Hence, we postulated that RSCL-0409 might suppress the activation of NF-jB, as the above are regulated through it. RSCL-0409 inhibited translocation into the nucleus and suppressed NF-jB-dependent reporter gene expression, indicating the inhibitory action of RSCL-0409 at the promoter level. On the basis of these results, it appeared that RSCL-0409 acted upstream of IKK phosphorylation. In order to delineate the probable site of action of RSCL-0409, we decided to check the upstream acces- sory and adaptor molecules.
Fig. 6. RSCL-0409 suppresses LPS-induced TNF-a release in Balb ⁄ c mice. Specific female Balb ⁄ c mice pathogen-free (5–6 weeks, five animals per group) weighing (cid:2)20–30 g were intra- peritoneally injected with LPS (225 lgÆmL)1) with and without pre- treatment of RSCL-0409 (10 and 20 mgÆkg)1). RSCL-0409 was injected intraperitoneally 30 min before LPS injection. One hour after LPS injection, blood was collected retro-orbitally under anaesthesia and serum analysed for TNF-a secretion. ***P value < 0.001; LPS treated vs RSCL-0409 treated. Control represents untreated animals.
signalling receptors unlike
LPS signalling through the activation of TLRs is very well established, with TLR4 largely implicated as the prominent mammalian LPS sensor [24]. Simulta- neously, studies have also implicated TLR2 mediating LPS signalling in cells [25,26]. Furthermore, Aderem & Ulevitch [27] postulated that in RAW cells, the oligo- merization of TLR receptors created functionally dis- tinct LPS-specific the existing conventionally accepted CD14–TLR4 pathway involved in the activation of NF-jB leading to TNF-a expression in RAW cells [28], where they showed TLR6 and TLR2 co-operating in the signalling pro- cess. In addition, there are documented reports that TLR2, -3, -4 and -9 recognize peptidoglycan, poly (I:C), LPS and CpG DNA, respectively [29–31].
The development of antagonists has gained impetus following concerns that agonists have not been effec- tive in specific targeting. Currently, TAK-242 [16] and E-5564 [17], apart from the few reported lipid A ana- logues as antagonists [18–20], are in the last phase of clinical developmental. Furthermore, reports of LPS- like molecules extracted from cyanobacterium Oscilla- toria Planktothrix [21], which blocks sustained TLR4 stimulation, have been documented. RSCL-0409, gluco-disaccharide derivative, is one such initiative capable of developing into a potential TLR antagonist. On the basis of our screening results, we short listed RSCL-0409 for further studies. With a 50% inhibitory concentration of 10.6 lm, RSCL-0409 inhibited LPS- stimulated TNF-a secretion from monocytic cells in a dose-dependent manner. LPS signalling is initiated by its binding to LBP, followed by subsequent binding to CD14, TLR4 and MD-2 complex on the cell surface [22]. However, depending on the LPS concentration, the pathway may occur in an LBP ⁄ CD14-dependent way or in an independent way [23]. Concentrations up to 100 ngÆmL)1 initiate LBP ⁄ CD14 complex-dependent binding and higher concentrations set up LBP ⁄ CD14- independent signalling. We have worked with varying concentration of LPS (250–1000 ngÆmL)1) and irrespec- tive of the LPS concentration, RSCL-0409 pretreated cells inhibited TNF-a secretion up to 1000 ngÆmL)1, making it a potential candidate for use in clinical condi- tions such as septic shock, where LPS concentrations are known to be very high. The effects were similar in
In order to identify and delineate the probable mecha- nism of action of RSCL-0409, we studied the ability of various TLR ligands for cytokine TNF-a production in the presence of RSCL-0409. We were able to detect TNF-a secretion in cells stimulated with TLR1 ⁄ 2, TLR4 and TLR6. TLR3, -7, -8 and -9 are known to predomi- nantly secrete interferon-a [1]. We speculate that it might be the reason for not having detectable levels of TNF-a following stimulation with these ligands in our system. Analysing our data, we observed RSCL-0409’s selectivity to suppress TLR1 ⁄ 2- and TLR4-mediated TNF-a production in THP-1-stimulated cells. Similar results were noted in human PBMCs. However, we did not see any inhibitory effects on TNF-a released due to TLR6 ligand stimulation. TLR1 ⁄ 2 ligand from the kit is Pam3CSK, a synthetic tripalymitoyl lipopeptide, which is known to potentially activate monocytes and macro- phages [32] and TLR6 is a macrophage-stimulating lipopeptide-2 [33] known to activate the cells when it
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1646
M. D. Kalluri et al.
RSCL-0409 inhibits LPS-induced TLR signalling
mechanisms of NF-jB- or TLR-mediated signalling inhibition.
heterodimerizes with TLR2. In addition, we have ruled out any likely contamination in TLR2 agonist by endo- toxin ⁄ LPS by thorough assessment using the Limulus amoebocyte lysate. Therefore, it is plausible that RSCL- 0409 inhibits cytokine TNF-a production induced by an additive process of TLR2 and TLR4. Corroborating these data are the results observed in RAW cells, when we evaluated the nitrite levels following stimulation with TLR ligands. Thus, the data suggest that RSCL-0409 suppresses the activation of cells by TLRs, probably an upstream event in TLR1 ⁄ 2-, TLR4-mediated signalling, and has the ability to recognize a lipopeptide.
On the basis of the current evidence, we set forth to test RSCL-0409’s efficacy in an in vivo model. TNF-a plays a pivotal role as a mediator of the host’s response to LPS infection. Therefore, blocking or antagonizing TNF-a in sepsis or a sepsis-like condition will definitely have immense therapeutic potential. Our studies in Balb ⁄ C in LPS-induced TNF-a secretion followed a pattern reported by many investigators, with TNF-a levels peaking around 60–90 min (unpublished data). However, pretreatment with RSCL-0409 at doses of 10 and 20 mgÆkg)1 significantly reduced TNF-a produc- tion, reconfirming our in vitro data. Furthermore, treat- ment with RSCL-0409 alone or placebo did not lead to any detectable levels of TNF-a, implicating the specific- ity of the TNF-a inhibition due to RSCL-0409. How- ever, we would also like to point out that the LPS dose (225 lg mice)1) is similar to that given for the septic shock model. Because we had observed that RSCL-0409 exhibited the ability to inhibit TNF-a secretion at LPS doses of 1 mgÆmL)1 we also looked at the effect of RSCL-0409 in preventing lethality induced by septic shock at two doses, 25 and 50 mgÆkg)1. We observed an (cid:2) 33 and 67% increase in survival ability in mice over a 30 h period (unpublished data) at respective doses. In this context, our result has tremendous clinical applica- tion potential in attenuating LPS-mediated TNF-a, a property useful in delaying the onset of sepsis.
In conclusion, we have clearly demonstrated that RSCL-0409 prevents the expression of NF-jB-regulated genes in monocytes through a TLR-dependent process. Preliminary data suggest that the inhibitory effect is exerted via the MyD88-dependent signalling cascade. Investigations are continuing to elucidate the specific target molecule for RSCL-0409. RSCL-0409 is definitely a good candidate and further studies evaluating its potential therapeutic applications are in progress.
Materials and methods
Materials
LPS signalling through TLRs involves four adaptor molecules, MyD88, TIRAP, TRIF and TRAM [34]. Furthermore, two signalling pathways, MyD88-depen- dent and MyD88-independent pathways, have been elu- cidated downstream of TLR2 and TLR4 [35–37]. The downstream signalling is quite complex and comprises IRAK1–IRAK4–TNFR-associated factor 6 (TRAF6), which transmits the signals to the TAK1 and IKK com- plex [1]. This activates the p65–p50 NF-jB heterodimer complex, which translocates signals into the nucleus and transcribes the NF-jB transcription factor, which initi- ates the transcription of inflammatory mediators [38]. We checked the mRNA expression of the genes involved in this signalling process following LPS stimulation with and without pretreatment of RSCL-0409. Preliminary data showed that RSCL-0409 downregulated TIRAP, IRAK1 and IRAK4 mRNA levels together with TIRAP and MyD88 protein levels (data not shown). TRAF6, which did not show any visible upregulation upon LPS stimulation, remained unaffected with RSCL-0409 pre- treatment. Documented evidence shows that recruit- ment of the adaptors involved in TLR signalling could lead to the activation of multiple intracellular cascades, including extracellular signal-regulated kinases, c-Jun N-terminal kinases, p38 and NF-jB, involving their phosphorylation [39,40]. Therefore, we determined the effect of RSCL-0409 on LPS-induced phosphorylation of mitogen-activated protein kinases, extracellular sig- nal-regulated kinase and p38. However, we did not observe any effect on their phosphorylation (unpub- lished data). There are reports of some antagonists, such as 6-shogaol, the most bioactive component of ginger [41], curcumin [42] and garlic extracts [43], inhibiting TLR-mediated signalling by inhibiting the dimerization of TLR4, a process that activates downstream signalling pathways. We are currently evaluating this possibility. In addition, we are also studying other possible targets, such as the TLR4 coreceptor MD2, which directly binds the disaccharide moiety of lipid A [44]. Because cell sig- nalling is a complex mechanism involving several inter- related processes, we are not ruling out other possible
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1647
RSCL-0409 (Fig. 1A) was synthesized at Reliance Life Sciences (Navi Mumbai, Maharashtra, India). The synthesis was carried out by coupling glycosyl donor 2, 3-di-O- acetyl-4-O-chloroacetyl-6-O-levulinoyl-b-d-glucopyranosyl trichloroacetimidate with glycosyl acceptor 1-O-(p-methoxy- phenyl)-2-deoxy-2-trichloroacetamido-4, 6-O-benzylidene-a- d-glucopyranose using Lewis acid. The crude product was purified using a silica gel column (40% ethyl acetate in hex- ane) to give disaccharide RSCL-0409 (91%) Rf 0.62 (50% ethyl acetate ⁄ hexane). The column-purified RSCL-0409 was
M. D. Kalluri et al.
RSCL-0409 inhibits LPS-induced TLR signalling
Treatment of the cells for quantification of TNF-a
(Poly TLR ligands TLR3
crystallized in ethyl acetate ⁄ hexane. HPLC analysis of the purified compound showed (cid:2) 98.5% purity (Fig. 1B). The compound was dissolved in dimethylsulfoxide at a stock con- centration of 10 mm, aliquoted and stored at )20 (cid:2)C. Indi- vidual aliquots were used for carrying out the in vitro and in vivo assays. All procedures were carried out using anhy- drous solvents purchased from commercial sources and used without further purification. Chromatographic separations were performed on silica gel using the solvent system indi- cated. All reactions were monitored by TLC using precoated silica gel plates (Merck, Whitehouse Station, NJ, USA). Purity and yields were checked by chromatography and spectroscopy.
according systems
Measurement of nitrite
THP-1 cells were plated at a density of 2 · 105 cells per well in 96-well culture plates and incubated overnight. The cells in freshly replenished serum-free RPMI media were [TLR1 ⁄ 2 various stimulated with 75 ngÆmL)1, I:C) (Pam3CSK4.3HCl) 75 lgÆmL)1, TLR4 (LPS from E. coli) 750 ngÆmL)1, TLR5 (purified flagellin) 75 ngÆmL)1, TLR6 (Malp-2) 75 ngÆmL)1, TLR7 ⁄ 8 [Poly(U) potassium salt] 7.5 lgÆmL)1 and TLR9 (CpG ODN 2395) 7.5 lgÆmL)1], LPS (250 ngÆmL)1) for 24 h in the presence or absence of RSCL-0409 (50 lm). Culture supernatants were collected by spinning down the cells and the medium collected and stored at )80 (cid:2)C until further use. The amount of secreted TNF-a in the super- natants was assayed using specific Duo-Set ELISA deve- lopment to the (R&D Systems) manufacturer’s instructions. For assays involving PBMCs and RAW264.7 cells, the 96-well plates were similarly seeded at a density of 2 · 105 cellsÆwell)1. A similar proto- col was followed for assaying TNF-a in these cells. For all experiments, RSCL-0409 was dissolved in dimethylsulfox- ide, diluted with appropriate medium and added to the cells 1 h before any stimulation.
Cells
LPS (from E. coli serotype O55: B5) was obtained from Sigma-Aldrich (St Louis, MO, USA). Penicillin, streptomy- cin, RPMI 1640 medium, sodium pyruvate and fetal bovine serum were obtained from Gibco (part of Invitrogen, Carls- bad, CA, USA). Tris, glycine, b-mercaptoethanol, glucose, sodium bicarbonate, NaCl, SDS, BSA, LPS and MTT were obtained from Sigma-Aldrich. Polyclonal antibody anti-p65 was obtained from Cell Signaling Technology (Beverly, MA, USA). Anti-rabbit secondary horseradish peroxidase was obtained from Jackson Immuno Research (West Grove, PA, USA). Trizol was obtained from Invitrogen (Carlsbad, CA, USA). Chemiluminescence ECL was pur- chased from Amersham (Arlington Heights, IL, USA). The TNF-a Duo-Set ELISA detection kit was obtained from R&D Systems; TLR ligands (1–9) were purchased from Apotech (Enzo Life Sciences, Geneva, Switzerland). Quanti Blue was purchased from Invivogen (San Diego, CA, USA). PCR kits were obtained from Abgene (Epsom, UK). The cDNA synthesis kit was obtained from ABI Systems (Weiterstadt, Germany). All other reagents and chemicals were purchased from Sigma, unless stated otherwise.
(I:C) poly for 75 lgÆmL)1
Cell viability assay
RAW264.7 cells provide an excellent model for evaluations of potential inhibitors on the pathway leading to the induc- tion of inducible nitric oxide synthase and NO production. NO production was determined in RAW264.7 cells from the National Center of Cell Science (NCCS, Pune, India) cultured in colour-free Dulbecco’s modified Eagle’s medium with standard supplements by measuring the amount of nitrite from the cell culture supernatant. RAW264.7 cells (5 · 104 per well) were stimulated for 24 h with RSCL-0409 and ligands alone for TLRs, 75 ngÆmL)1 Pam3CSK4 for TLR3, TLR2 ⁄ TLR1, 250 ngÆmL)1 LPS for TLR4, 75 ngÆmL)1 Malp-2 for TLR6, 10 lm R-848 for TLR7 ⁄ 8 and 7.5 lgÆmL)1 CpG ODN 2395 for TLR9 in the presence of 0.1 ngÆmL)1 mouse inter- feron-c for 24 h. Nitrite was then measured using the Gri- ess reaction. One hundred microlitres of cell culture supernatant was reacted with 100 lL Griess reagent fol- lowed by spectrophotometric measurement at 540 nm. Nitrite concentrations in the supernatants were determined by comparison with a sodium nitrite standard curve.
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1648
The THP-1 promonocytic cell line and RAW264.7 cells obtained from ATCC (Manassas, VA, USA) were cultured in RPMI 1640 and DMEM, respectively, containing 10% heat-inactivated fetal bovine serum supplemented with 1% penicillin ⁄ streptomycin, as suggested by ATCC, in a 5% CO2 humid atmosphere at 37 (cid:2)C. THP-1 blue CD14, pur- chased from Invivogen, overexpress CD14 and were stably transfected with a NF-jB inducible reporter plasmid system expressing a SEAP. The culture conditions were similar to normal THP-1 cells with the addition of Zeocin and Blasticidin antibiotics in the culture media. Human PBMCs were isolated from peripheral blood obtained from healthy human volunteers (as per the procedure approved by the appropriate regulatory committee) by density gradient centrifugation using HistoPaque-1077 (Sigma-Aldrich) and suspended in RPMI 1640 medium containing 10% heat- inactivated fetal bovine serum, 100 UÆmL)1 penicillin G and 100 lgÆmL)1 streptomycin. Cell viability was assessed by morphology and by reduction of the tetrazolium salt MTT by mitochondrial dehydrogen- ases, according to the manufacturer’s instructions (Sigma). Cytotoxicity studies were performed in 96-well plates. THP-1 cells (2 · 105 cells per well) were seeded. RSCL-
M. D. Kalluri et al.
RSCL-0409 inhibits LPS-induced TLR signalling
Real-time quantitative PCR analysis of TNF-a and IL-6 expression
p65NF-jB bands was normalized by tubulin. The bands obtained were quantitated using imagej software version 1.42.
Preparation of nuclear extracts
0409 (1–100 lm) was added to the cells, and the plates were incubated for 24 h. The cells were then washed once before adding 50 lL fetal bovine serum-free medium containing MTT (5 mgÆmL)1). After 4 h of incubation at 37 (cid:2)C, the medium was discarded and the formazan blue that formed in the cells was dissolved in dimethylsulfoxide. The absor- bance was measured at 570 nm using a powerwave Xs from Biotek Instruments (Winooski, VT, USA).
Western blot analysis
RT-PCR analysis
Nuclear extracts were prepared from THP-1 cells according to the modified procedure of Dignam et al. [45]. Briefly, 3 · 106 cells were pretreated with RSCL-0409 for 1 h fol- lowed by LPS treatment for 30, 60 and 120 min. Following incubation, the cells were lysed in 400 lL lysis buffer (10 mm Hepes pH 7.9, 100 mm KCl, 1.5 mm MgCl2, 0.1 mm EGTA, 0.5 mm dithiothreitol, 0.5 mm phenylmethanesulfonyl fluo- ride, 0.5% Nonidet P-40 and 1 lLÆmL)1 protease inhibitor cocktail; Calbiochem, La Jolla, CA, USA). The homogenate was centrifuged in a microfuge at 10 000 g for 5 min. The supernatant was discarded, and the nuclear pellet was resus- pended in 50 lL nuclear extraction buffer (10 mm Hepes pH 7.9, 1.5 mm MgCl2, 420 mm NaCl, 0.1 mm EGTA, 0.5 mm dithiothreitol, 5% glycerol, 0.5 mm phenylmethanesulfonyl fluoride and 1 lLÆmL)1 protease inhibitor cocktail) with intermittent mixing in ice. The nuclear extract was obtained by centrifuging at 10 000 g for 10 min at 4 (cid:2)C. The concen- tration of protein in each sample was then quantified using the Bradford method (Bio-Rad, Hercules, CA, USA). Western blot analysis was carried out to check for p65 levels in the extracts. THP-1 cells seeded at a density of 3 · 106 cellsÆwell)1 in a six-well plate were stimulated with 250 ngÆmL)1 LPS in the presence or absence of RSCL-0409 (50 lm) for 1 h. Total RNA was isolated from these cells and cDNA was synthe- sized. LPS-treated cells acted as a positive control. All quantitative real-time PCR (TaqMan(cid:3)) primers and probes were obtained from Applied Biosystems (Weiterstadt, Ger- many). For the detection of TNF-a, IL-6 and internal con- trol b-actin predeveloped assay reagents were used. The PCR was performed utilizing 1 lL cDNA per reaction in triplicates of 25 lL volume on an ABI 7500 real-time PCR machine using a two-step PCR protocol after the initial denaturing of the cDNA (10 min at 95 (cid:2)C) with 40 cycles of 95 (cid:2)C for 15 s and 60 (cid:2)C for 1 min. The universal as obtained from Applied Biosystems, master mix, including Taq-polymerase, apart included all reagents, from specific primers and probes. All amplification batches included no template controls. Quantitation of mRNA was performed using the comparative threshold level attained by the cycle method. The highest control stimulation (without RSCL-0409) was regarded as 100%, and the levels of the control group at other time points and the RSCL-0409-added group were expressed as a per- level. Data were analysed centage of the highest control using standard software.
THP-1 cells (3 · 106 cells) were seeded in a six-well dish. The cells were treated with RSCL-0409 (50 lm) for 1 h fol- lowed by incubation with or without 250 ngÆmL)1 LPS. After two washes with ice-cold phosphate-buffered saline, the cells were harvested and total cellular RNA was iso- lated using TRIZOL Reagent (Invitrogen) according to the manufacturer’s instructions. cDNA synthesis was carried out using a high capacity cDNA reverse transcription kit (ABI Systems). Amplification of ICAM-1, Cox-2 and IL-8 genes from the cDNA was carried out using the respective gene-specific primers:
ICAM-1
5¢- CTGATGGGCAGTCAACAGCTAAAA - 3¢(sense) 5¢- TCCAGTTCAGTGCGGCACGAGAA - 3¢ (antisense) Cox-2
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1649
5¢-ATGAGATTGTGGGAAAATTGCT- 3¢ (sense) 5¢- GGTAGATCATCTCTGCCTGAGTATC - 3¢ (antisense), IL-8 5¢- GCCAAGGAGTGCTAAAGAACTTAG -3¢ (sense) THP-1 cells at 1 · 106 cellsÆmL)1 in serum-free RPMI 1640 medium were incubated with LPS (250 ngÆmL)1) for different time points. Where indicated, THP-1 monocytes were incubated with RSCL-0409 for 60 min before LPS treatment. Cells were lysed following incubation in RIPA buffer (1· phosphate-buffered saline, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mm sodium orthovanadate, 10 lgÆmL phenylmethanesulfonyl fluoride and 1 lLÆmL)1 protease inhibitor cocktail). The protein concentration in each sample was quantified using the Bradford method. Twenty-five micrograms of protein were size fractionated in a 10% SDS ⁄ PAGE gel and transferred to a nitrocellulose membrane (BioTraceNT, Pall Corpora- tion, Port Washington, NY, USA). Blots were probed with an anti-p65 IgG (Cell Signaling Technology). Horse- radish peroxidase-conjugated secondary antibodies were used to develop the membrane and visualization of the bands was performed using a chemiluminescent substrate (Amersham). Blots were stripped and reprobed with tubu- lin to normalize the protein loading. Quantification of
M. D. Kalluri et al.
RSCL-0409 inhibits LPS-induced TLR signalling
CA, USA). The Neuman–Keuls test was used for mul- tiple comparisons. Values of P < 0.05 were considered as significant.
5¢- GAATTCTCAGCCCTCTTCAAAAAC -3¢ (antisense) b-actin, an internal control, was also amplified using the following primers:
5¢- TCC TCC CTG GAG AAG AGC TA - 3¢ (sense) 5¢- AGT ACT TGC GCT CAG GAG GAC – 3¢ (anti-
Acknowledgements
sense)
The authors gratefully acknowledge the encouragement and support of Reliance Life Sciences Pvt Ltd, in car- rying out the research work. PD and SU were part of Reliance Life Sciences Pvt Ltd when the work was undertaken. Their current affiliation is indicative of their current address only, and not to be understood as collaborative work.
Furthermore, the TLR-related genes (TIRAP, IRAK-1, IRAK-4 and TRAF6) were amplified from the cDNA extracted from a similar experimental set using the respec- tive gene-specific primers [46].
The amplified PCR products were then analysed on a 2% agarose gel electrophoresis and visualized under UV with ethidium bromide. Quantification of bands for the specific genes was normalized by b-actin.
References
Quanti Blue assay
1 Kawai T & Akira S (2006) TLR signaling. Cell Death Differ 13, 816–825. 2 Hirschfeld M, Weis JJ, Toshchakov V, Salkowski CA,
Cody MJ, Ward DC, Qureshi N, Michalek SM & Vogel SN (2001) Signaling by Toll-like receptor 2 and 4 agon- ists results in differential gene expression in murine macrophages. Infect Immun 69, 1477–1482.
3 Wyllie DH, Kiss-Toth E, Visintin A, Smith SC, Boussouf S, Segal DM, Duff GW & Dower SK (2001) Evidence for an accessory protein function for Toll-like receptor 1 in anti-bacterial responses. J Immunol 165, 7125–7132. 4 Wright SD, Ramos RA, Tobias PS, Ulevitch RJ &
The Quanti Blue assay is a reporter-based assay system to determine the SEAP activity in supernatants of cell cultures induced by NF-jB activators such as LPS. The assay was carried out as per the manufacturer’s instructions. Briefly, THP-1 CD14 blue cells were plated and cultured overnight in 96-well plates (2 · 105 cellsÆwell)1). These cells were stim- ulated with LPS in the presence and absence of RSCL-0409 (50 lm). Culture supernatants were collected 24 h after LPS stimulation and the SEAP activity was determined using (Invivogen). The change in media Quanti Blue reagent colour to purple-blue was quantitated by measuring the absorbance at 625–655 nm. The data was expressed rela- tive to SEAP.
In vivo experiments: LPS-induced TNF-a release in Balb ⁄ c mice
Mathison JC (1990) CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science (Wash DC) 249, 1431–1433.
5 da Silva Correia J, Soldau K, Christen U, Tobias PS & Ulevitch RJ (2001) Lipopolysaccharide is in close prox- imity to each of the proteins in its membrane receptor complex. Transfer from CD14 to TLR4 and MD-2. J Biol Chem 276, 21129–21135.
6 Guha M & Mackman N (2001) LPS induction of gene expression in human monocytes. Cell Signal 13, 85–94. 7 Akira S, Takeda K & Kaisho T (2001) Toll-like recep-
tors: critical proteins linking innate and acquired immu- nity. Nat Immunol 2, 675–680. 8 Fitzgerald KA, Palsson-McDermott EM, Bowie AG,
Statistical analysis
Jefferies CA, Mansell AS, Brady G, Brint E, Dunne A, Gray P, Harte MT et al. (2001) Mal (MyD88-adapter- like) is required for Toll-like receptor-4 signal transduc- tion. Nature 413, 78–83. 9 Silverman N & Maniatis T (2001) NF-jB signaling Specific pathogen-free female Balb ⁄ c mice (5–6 weeks) were injected with LPS (225 lg) intraperitoneally with and without pretreatment with two concentrations of RSCL- 0409 (10 and 20 mgÆkg)1) given intraperitoneally 30 min before LPS treatment. RSCL-0409 injected alone served as the negative control. Blood collection was carried out retro-orbitally under anaesthesia 1 h after LPS injection. The serum collected was analysed for TNF-a secretion using individual Duo-Set ELISA (R&D Systems) accord- ing to the manufacturer’s instructions. The local animal research board committee, Committee for the Purpose of Control and Supervision of Experiments on Animals, and the Institutional Animal Ethics Committee approved these studies. pathways in mammalian and insect innate immunity. Genes Dev 15, 2321–2342. 10 Raza A (2000) Anti-TNF therapies in rheumatoid
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1650
arthritis, Crohn’s disease, sepsis and myelodysplastic syndromes. Microsc Res Tech 50, 229–235. 11 Hehlgans T & Pfeffer K (2005) The intriguing biology A statistical analysis of the responses obtained from control and LPS-treated THP-1 cells was conducted by one-way ANOVA using instat 2 software (GraphPad La Jolla, of the tumour necrosis factor ⁄ tumour necrosis factor
M. D. Kalluri et al.
RSCL-0409 inhibits LPS-induced TLR signalling
receptor superfamily: players, rules and the games. Immunology 115, 1–20. 12 Wang Q, McLoughlin RM, Cobb BA, Charrel-Dennis bacterial endotoxin exhibit CD14 ⁄ LBP dependent and independent binding that is influenced by endotoxin concentration. Eur J Biochem 267, 2218–2226.
24 Beutler B (2000) TLR4: central component of the sole mammalian LPS sensor. Curr Opin Immunol 12, 20–26.
M, Zaleski KJ, Golenbock D, Tzianabos AO & Kasper DL (2006) A bacterial carbohydrate links innate and adaptive responses through Toll-like receptor 2. J Exp Med 203, 2853–2863.
25 Yang RB, Mark MR, Gray A, Huang A, Xie MH, Zhang M, Goddard A, Wood WI, Gurney AL & Godowski PJ (1998) Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signaling. Nature 395, 284–288. 26 Werts C, Tapping RI, Mathison JC, Chuang TH, 13 Termeer C, Benedix F, Sleeman J, Fieber C, Voith U, Ahrens T, Miyake K, Freudenberg M, Galanos C & Simon JC (2002) Oligosaccharides of hyaluronan acti- vate dendritic cells via Toll-like receptor 4. J Exp Med 195, 99–111. 14 Monari C, Bistoni F, Casadevall A, Pericolini E,
Kravchenko V, Saint Girons I, Haake DA, Godowski PJ, Hayashi F, Ozinsky A et al. (2001) Leptospiral lipo- polysaccharide activates cells through a TLR2-depen- dent mechanism. Nat Immunol 2, 346–352. 27 Aderem A & Ulevitch RJ (2000) Toll-like receptors in
the induction of the innate immune response. Nature 406, 782–787.
Pietrella D, Kozel TR & Vecchiarelli A (2001) Glucur- onoxylomannan, a microbial compound, regulates expression of costimulatory molecules and production of cytokines in macrophages. J Infect Dis 91, 127–137. 15 Romagne F (2007) Current and future drugs targeting one class of innate immunity receptors: the Toll-like receptors. Drug Discov Today 12, 80–87.
28 Ozinsky A, Underhill DM, Fontenot JD, Hajjar AM, Smith KD, Wilson CB, Schroeder L & Aderem A (2000) The repertoire for pattern recognition of patho- gens by the innate immune system is defined by cooper- ation between toll-like receptors. Proc Natl Acad Sci USA 97, 13766–13771.
16 Ii M, Matsunaga N, Hazeki K, Nakamura K, Takashi- ma K, Seya T, Hazeki O, Kitazaki T & Iizawa Y (2006) A novel cyclohexene derivative, ethyl (6R)-6-[N-(2- chloro-4-fluorophenyl) sulfamoyl]cyclohex-1-ene-1- carboxylate (TAK-242), selectively inhibits toll-like receptor 4-mediated cytokine production through suppression of intracellular signaling. Mol Pharmacol 69 1288–1295. 29 Takeuchi O, Hoshino K, Kawai T, Sanjo H, Takada H, Ogawa T, Takeda K & Akira S (1999) Differential roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components. Immunity 11, 443–451.
30 Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K et al. (2000) A Toll-like receptor recognizes bacterial DNA. Nature (Lond) 408, 740–745. 17 Mullarkey M, Rose JR, Bristol J, Kawata T, Kimura A, Kobayashi S, Przetak M, Chow J, Gusovsky F, Christ WJ et al. (2003) Inhibition of endotoxin response by E5564, a novel Toll-like receptor 4-directed endotoxin antagonist. J Pharmacol Exp Ther 304, 1093–1102.
31 Alexopoulou L, Holt AC, Medzhitov R & Flavell RA (2001) Recognition of double-stranded RNA and acti- vation of NF-jB by Toll-like receptor 3. Nature (Lond) 413, 732–738. 18 Christ WJ, Asano O, Robidoux AL, Perez M, Wang Y, Dubuc GR, Lewis MD, Kishi Y, Kawata T, Bristol JR et al. (1995) E5531, a pure endotoxin antagonist of high potency. Science (Wash DC) 268, 80–83.
32 Takeda K, Takeuchi O & Akira S (2002) Recognition of lipopeptides by Toll-like receptors. J Endotoxin Res 8, 459–463. 19 Rossignol DP & Lynn M (2002) Antagonism of in vivo and ex vivo response to endotoxin by E5564, a synthetic lipid A analogue. J. Endotoxin Res 8, 483–488.
33 Sandor F, Latz E, Re F, Mandell L, Repik G, Golen- bock DT, Espevik T, Kurt-Jones EA & Finberg RW (2003) Importance of extra- and intracellular domains of TLR1 and TLR2 in NF-kappa B signaling. J Cell Biol 162, 1099–1110. 20 Fort MM, Mozaffarian A, Stover AG, da Silva Correia J, Johnson DA, Crane RT, Ulevitch RJ, Persing DH, Bielefeldt-Ohmann H, Probst P et al. (2005) A synthetic TLR4 antagonist has anti-inflammatory effects in two murine models of inflammatory bowel disease. J Immu- nol 174, 6416–6423.
34 Dunne A & O’Neill LA (2005) Adaptor usage and Toll- like receptor signaling specificity. FEBS Lett 579, 3330– 3335.
21 Sugiyama K, Muroi M & Tanamoto K (2008) A novel TLR4-binding peptide that inhibits LPS-induced activa- tion of NF-jB and in vivo toxicity. Eur J Pharmacol 594, 152–156.
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1651
35 Yamamoto M, Sato S, Hemmi H, Uematsu S, Hoshino K, Kaisho T, Takeuchi O, Takeda K & Akira S (2003) TRAM is specifically involved in the Toll-like receptor 4-mediated MyD88-independent signaling pathway. Nat Immunol 4, 1144–1150. 22 Ziegler-Heitbrock HW & Ulevitch RJ (1993) CD14: cell surface receptor and differentiation marker. Immunol Today 14, 121–125. 36 Fitzgerald KA, Rowe DC, Barnes BJ, Caffrey DR, Visintin A, Latz E, Monks B, Pitha PM & Golenbock 23 Triantafilou M, Triantafilou K & Fernandez N (2006) Rough and smooth forms of fluorescein-labelled
M. D. Kalluri et al.
RSCL-0409 inhibits LPS-induced TLR signalling
DT (2003) LPS-TLR4 signaling to IRF-3 ⁄ 7 and NF-jB involves the toll adapters TRAM and TRIF. J Exp Med 198, 1043–1055. 37 Oshiumi H, Matsumoto M, Funami K, Akazawa T & 42 Youn HS, Lim HJ, Lee HJ, Hwang D, Yang M, Jeon R & Ryu JH (2008) Garlic (Allium sativum) extract inhibits lipopolysaccharide-induced Toll-like receptor 4 dimerization. Biosci Biotechnol Biochem 72 368–375.
Seya T (2003) TICAM-1, an adaptor molecule that par- ticipates in Toll-like receptor 3-mediated interferon-beta induction. Nat Immunol 4, 161–167. 38 Hayden MS & Ghosh S (2004) Signaling to NF-kap- 43 Youn HS, Saitoh SI, Miyake K & Hwang DH (2006) Inhibition of homodimerization of Toll-like receptor 4 by curcumin. Biochem Pharmacol 72, 62–69. 44 Gangloff M & Gay NJ (2000) MD-2: the Toll ‘gate- paB. Genes Dev 18, 2195–2224.
keeper’ in endotoxin signaling. Trends Biochem Sci 29, 6294–6300. 45 Dignam JD, Lebovitz RM & Roeder RG (1983) 39 Kong L & Ge BX (2008) MyD88-independent activa- tion of a novel actin-Cdc42 ⁄ Rac pathway is required for Toll-like receptor-stimulated phagocytosis. Cell Res 18, 745–755. 40 Han J (2006) MyD88 beyond Toll. Nat Immunol 7, 370–371. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11, 1475–1489. 41 Ahn SI, Lee JK & Youn HS (2009) Inhibition of
FEBS Journal 277 (2010) 1639–1652 ª 2010 Reliance Life Sciences Pvt Ltd. Journal compilation ª 2010 FEBS
1652
homodimerization of toll-like receptor 4 by 6-shogaol. Mol Cells 27, 211–215. 46 Nishimura M & Naito S (2005) Tissue-specific mRNA expression profiles of human toll-like receptors and related genes. Biol Pharm Bull 28, 886–892.
