Sp1-like sequences mediate human caspase-3 promoter activation by p73 and cisplatin Cherukuri Sudhakar, Nishant Jain and Ghanshyam Swarup
Centre for Cellular and Molecular Biology, Hyderabad, India
Keywords caspase-3; cisplatin; p73; promoter activation; Sp1
Correspondence G. Swarup, Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad 500 007, India Fax: +91 40 27160591 or +91 40 27160311 Tel: +91 40 27192616 or +91 40 27160222 E-mail: gshyam@ccmb.res.in
(Received 16 October 2007, revised 22 February 2008, accepted 3 March 2008)
doi:10.1111/j.1742-4658.2008.06373.x
Caspase-3 is a cysteine protease that plays a central role in the execution of apoptosis induced by a wide variety of stimuli. However, little is known about the mechanisms involved in the regulation of caspase-3 gene tran- scription. This study was carried out to characterize the human caspase-3 promoter and to understand the mechanisms involved in the induction of caspase-3 gene expression in response to the anticancer drug cisplatin and p73. Caspase-3 gene expression was induced by treatment of cells with cisplatin, which also induced p73 protein in HeLa and K562 cells. The human caspase-3 promoter was cloned and characterized. p73b strongly activated the caspase-3 promoter, whereas p73a showed less activation. Cisplatin treatment increased caspase-3 promoter activity. Basal and cisplatin-induced promoter activity was inhibited by the p73 inhibitor p73DD. Deletion analysis defined a minimal promoter of 120 base pairs, which showed good basal and p73b-induced activity. The examination of the minimal promoter sequence showed several putative Sp1 sites, but no p53 ⁄ p73 site. The caspase-3 promoter was activated by Sp1 in Sp1-deficient Drosophila SL-2 cells. Sp1-induced promoter activity was further enhanced by p73b in SL-2 cells. Mutation of Sp1 sites in the minimal promoter resulted in a loss of basal and p73-induced promoter activity. These results show that caspase-3 gene transcription is induced by cisplatin, which is mediated partly by p73. We have identified p73 and Sp1 as activators of the caspase-3 promoter. Sp1-like sequences in the minimal promoter not only sustain basal promoter activity, but also mediate p73-induced activation of the promoter.
apoptosis, development and in certain diseases [1–3]. Their activity is generally controlled by protein modifi- cation, and also by interaction with many regulatory proteins. However, recent studies have shown that cer- tain apoptotic stimuli and developmental cues also involve the regulation of gene expression of various caspases.
Abbreviations CAT, chloramphenicol acetyl transferase; CMV, cytomegalovirus; ECL, enhanced chemiluminescence; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; HA, hemagglutinin; TERT, telomerase reverse transcriptase.
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2200
Caspases are key effector molecules in apoptotic path- ways and immune responses. These enzymes are cyste- ine proteases that cleave their substrates after an aspartic acid residue [1,2]. They are produced as inac- tive procaspases, which can become activated by prote- olytic processing at conserved aspartic acid residues and ⁄ or by oligomerization. Proteolytically activated caspase is a tetramer composed of two subunits of 20 and 10 kDa, both of which are required for catalytic activity. The activation of caspases occurs during Caspase-3 is an important component of the effector phase of the apoptotic process induced by a wide variety of stimuli. Initially described as Yama [4],
C. Sudhakar et al.
p73 activates caspase-3 promoter through Sp1
caspase-3 cleaves several proteins during apoptosis, thereby activating or inactivating them. Caspase-3 can be activated by the apical caspases (caspase-8, caspase- 9 and caspase-12) in many cells, in response to several apoptotic stimuli. It is required for certain hallmarks of apoptosis, such as internucleosomal DNA degrada- tion mediated by caspase-activated DNase, nuclear fragmentation and membrane blebbing [5–7]. Caspase- 3 knockout mice show neuronal hyperplasia, and most die prenatally [8]. Caspase-3 gene is expressed in most ing of two half-sites of 10 base pairs (bp) [22–27]. Binding of p53 or p73 to these sequences results in the activation or repression of transcription. The p73 pro- tein is activated on exposure of cells to certain chemo- therapeutic agents, such as cisplatin, camptothecin and doxorubicin [28–31]. The p73 gene gives rise to many protein isoforms, which arise as a result of alternative splicing or alternative promoter usage [22–27]. The activation of caspase-1 promoter by cisplatin is medi- ated by p73 through a p53 ⁄ p73-responsive site present in the minimal promoter [31]. This
the
sequences, which mediate the
Results
study was undertaken to characterize the human caspase-3 promoter and to understand the mechanisms involved in the induction of caspase-3 gene expression in response to the chemotherapeutic drug cisplatin and p73. Here, we show that caspase-3 gene expression is induced by cisplatin in various cell lines. Cisplatin activates caspase-3 promoter, which is mediated partly by p73. We also identified Sp1-like cisplatin- induced as well as p73-induced caspase-3 promoter activity.
treated with cells Induction of caspase-3 gene expression by cisplatin
treatment. In K562 cells, apoptosis of required for the tissues and cells constitutively. Its expression is altered during the induction of apoptosis by drugs, and during dif- ferentiation and development. Several studies have shown the induction of caspase-3 gene expression during apoptosis of neuronal cells [9–12]. Several drugs can induce caspase-3 mRNA levels. Human leukaemic U937 and HL60 cells and HT29 colon carcinoma cells show increased expression of cas- pase-3 mRNA levels when treated with the topo- isomerase II inhibitor, etoposide [13]. Immortalized lines show enhanced levels rabbit lens epithelial cell of caspase-3 mRNA during apoptosis induced by okadaic acid, a protein phosphatase-1 and phospha- tase-2A inhibitor [14]. Caspase-3 and other caspase are upregulated in murine osteoblastic mRNAs MC3T3-E1 dexamethasone. This upregulation may play a role in the osteo- porosis induced by prolonged use of dexamethasone [15]. Caspase-3 mRNA induction is observed in C6 glioma cells treated with desipramine [16]. The activation of T cells through the T-cell receptor leads to the selective induction of caspase-3 expression, these which is cells [17].
of of the this activity promoter
in all cell
The cloning and characterization of rat caspase-3 promoter have revealed the role of certain transcrip- tion factors in regulating its expression [18]. The inhi- bition by mithramycin A has indicated a role for Sp1 in caspase- 3 gene expression. Putative Sp1-binding sites are pres- ent in rat and mouse caspase-3 promoters which have yet to be characterized [18,19]. An ETS-1-like site pres- ent at 1.6 kb upstream of the start site is also needed for efficient promoter activity [18]. Hypoxia-inducible factor-1-binding site has been identified in rat caspase- 3 promoter [20]. The tumour suppressor FOXO1a induces apoptosis in mouse cells by activating the tran- scription of the caspase-3 gene, which is mediated by direct binding of FOXO1a to the upstream regulatory sequences [21].
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2201
We analysed the level of caspase-3 mRNA by semi- quantitative RT-PCR in cisplatin-treated K562 and HeLa cells. The cells were treated with the required concentration (5–25 lm) of cisplatin or the solvent isolated after dimethylformamide, and RNA was there was a 24–48 h of increase in caspase-3 mRNA large (over 10-fold) after 24 h of (Fig. 1A). This cisplatin treatment increase in caspase-3 mRNA level by cisplatin was not the result of the induction of cell death, because other inducers of cell death, such as staurosporine and cycloheximide, did not increase the caspase-3 mRNA level (Fig. 1B). The treatment of U937 and HL60 cells with cisplatin resulted in an increase in caspase-3 mRNA at a cisplatin concentration of 25 lm (Fig. 1C). However, treatment of SAOS2 cells with cisplatin (10–100 lm) showed only a marginal increase in the level of caspase-3 mRNA (data not shown). These results suggest that cisplatin induces the expression of caspase-3 mRNA in many cells, but not types. The level of caspase-3 protein in cisplatin-treated K562 cells was determined in by western blotting. There was an increase processed caspase-3 protein (p17), but no significant lack of in procaspase-3 (Fig. 1D). The increase The p53 family of transcription factors (p53, p73 and p63) binds to specific sequences of DNA, consist-
C. Sudhakar et al.
p73 activates caspase-3 promoter through Sp1
D K562
A K562
Con
12 h
24 h
F M D
M µ 5 2
e v –
M µ 0 1
M µ 5
p73
Casp 3 GAPDH
Tubulin
Procaspase 3
l
T U
B K562 e v –
e v +
o c y C
o r u a t S
O S M D
Casp 3
GAPDH
p17
U937
HL 60
C
M µ 0 1
M µ 5 2
T U
F M D
M µ 5 2
T U
M µ 5 2
E V –
T U
M µ 0 1
M µ 0 1
F M D
F M D
p73
Casp 3
Cdk2
GAPDH
Fig. 1. Induction of caspase-3 gene expression by cisplatin. (A) K562 cells were treated with cisplatin or the solvent dimethylformamide (DMF) for 24 h. Total RNA was isolated and the level of caspase-3 (Casp 3) mRNA was determined by semiquantitative RT-PCR. GAPDH was used as a control. )ve, negative control for PCR without RT product. (B) Effect of the apoptotic agents cycloheximide (Cyclo) and staurosporine (Stauro) on caspase-3 mRNA level. DMSO, dimethylsulfoxide; UT, untreated cells. (C) Effect of cisplatin treatment on caspase- 3 mRNA level in U937 and HL60 cells. (D) Effect of cisplatin treatment on p73 and caspase-3 protein level in K562 cells. The cells were trea- ted with 10 lM cisplatin for 12 or 24 h. Cell lysates were subjected to immunoblotting using antibodies for p73 and caspase-3 (top panels). Tubulin was used as a loading control. The effect of different concentrations of cisplatin on the p73 protein level in K562 cells was deter- mined by immunoblotting (bottom panels). Cdk2 was used as a loading control.
Activation of human caspase-3 promoter by p73
increase in unprocessed procaspase-3 in cisplatin- treated cells is probably the result of proteolytic processing.
and caspase-10) showed a the plasmid) In order to determine whether this induction of cas- pase-3 gene expression by cisplatin was specific to cas- pase-3, we analysed the expression of several other caspases. To our surprise, in K562 cells, almost all the caspases tested (except caspase-7) showed an increase in mRNA level on cisplatin treatment (Fig. 2A). By contrast, in HeLa cells, only caspase-1, caspase-3 and caspase-4 showed significant increases in mRNA level on cisplatin treatment (Fig. 2B). Some of the caspases significant (caspase-2 decrease in mRNA level after 48 h of treatment with cisplatin in HeLa cells (Fig. 2B).
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2202
The treatment of cells with cisplatin is known to increase the level of the transcription factor p73 [28– 31]. Indeed, there was an increase in p73 protein level in cisplatin-treated K562 and HeLa cells, as deter- mined by immunoblotting [Fig. 1D (bottom panel), 2C]. This raised the possibility that caspase-3 gene expression induced by cisplatin may be mediated in part by p73. The human caspase-3 gene promoter has not been characterized. We cloned the putative human caspase-3 promoter by designing appropriate primers for PCR using human genomic DNA as template. The nucleo- tide sequence of this 715 bp promoter (Fig. 3) matched with the nucleotide sequence available in the human genome database. It was cloned in a promoter-less vec- tor (pCAT-BASIC) upstream of the chloramphenicol acetyl transferase (CAT) reporter gene. This promoter showed very good activity in HeLa cells, and p73b was able to activate this promoter by 40–60-fold at low concentration (2–10 ng of (Fig. 4A). Other isoforms of p73, namely p73a, p73c and p73d, were also able to activate this promoter, although to a much lower level. Higher concentrations of p73a or p73b (50 ng each) were inhibitory (Fig. 4A). The higher level of activation by p73b was not caused by its higher level of expression, as shown by western blot analysis of various p73 isoforms with hemagglutinin (HA) tag antibody (Fig. 4B). However, p53 was not able to activate the caspase-3 promoter (Fig. 4C). The
C. Sudhakar et al.
p73 activates caspase-3 promoter through Sp1
A K562
B Hela –ve
–ve
F M D
h 4 2
h 4 2
h 8 4
F M D
h 8 4
GAPDH
GAPDH
Casp 1
Casp 1
Casp 2
Casp 2
Casp 3
Casp 3
Casp 4
Casp 4
Casp 5
Casp 5
Casp 6
Casp 6
Casp 7
Casp 8
Casp 9
Casp 8
Casp 10
Casp 9
Casp 7
Casp 10
+ve
C
Con 12 h
24 h
p73
Tubulin
Fig. 2. Induction of various caspase genes by cisplatin. (A) K562 cells were treated with 10 lM cisplatin for 24 or 48 h. The expression of various caspase genes was determined by RT-PCR using gene-specific primers. The positive control for caspase-7 was a sample from HeLa cells. (B) HeLa cells were treated with 25 lM cisplatin, and caspase gene expression analysis was car- ried out as in (A). (C) Immunoblot showing increase in p73 protein level in HeLa cells on treatment with cisplatin.
Fig. 3. Nucleotide sequence of human caspase-3 promoter with 48 bases of exon 1, which are shown in italics and underlined. Putative transcription factor-binding sites for Sp1, AP2, AP2a, p53, E2F1 and a GC box were identified by MatInspector, and are shown. Two groups of Sp1 sites, A and B, which were mutated to test their functional significance are indicated. The indicated p53 sites are not functional.
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2203
expression of p53 was confirmed by western blotting (Fig. 4D). The analysis of the human caspase-3 promoter sequence showed no TATA box. Several putative Sp1 sites and one GC box were observed. Putative tran- scription factor-binding sites for Sp1, AP2, AP2a, p53 and E2F1 were identified by MatInspector, which are shown in Fig. 3. Attempts to identify transcription
C. Sudhakar et al.
p73 activates caspase-3 promoter through Sp1
A
B
β
α
γ δ
e v –
y t i v i t c a T A C e v i t a l e R
80 70 60 50 40 30 20 10 0
- - - 10
p73α (ng) p73β (ng) p73γ (ng) p73δ (ng)
50 - - -
- 10 - -
- 50 - -
2 - - -
- - - -
10 - - -
- 2 - -
- - 10 -
1.5
C
D
1
e v –
3 5 p
0.5
0 p53 (ng)
2
10
50
100
-
Fig. 4. Transactivation of the caspase-3 promoter-reporter by various p73 isoforms. (A) The caspase-3 promoter-reporter plasmid (100 ng) was cotransfected with b-galactosidase expression plasmid, together with the indicated amounts of p73 expression plasmids, in HeLa cells. lysates were prepared and reporter activities were determined. CAT activities relative to the control are After 24 h of transfection, cell shown (n = 3). The numbers 2, 10 and 50 indicate the amount of plasmid in nanograms. (B) Western blot analysis of the expression of p73 isoforms using HA tag antibody. Equal amounts of plasmids for expressing various isoforms of p73 were transfected in HeLa cells and, after 24 h, the cell lysates were subjected to western blotting. (C) Effect of p53 on caspase-3 promoter activity. Caspase-3 reporter plasmid (100 ng) was transfected in HeLa cells, together with the indicated amounts of p53 plasmid. After 24 h of transfection, the cell lysates were prepared for reporter assays. (D) Western blot showing expression of transfected p53 in HeLa cells.
Sp1 activates the caspase-3 promoter
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2204
start sites by primer extension were not successful, pos- sibly because of the high GC content of this region of the promoter. The putative transcription start site shown in Fig. 3 corresponds to that identified in rat caspase-3 promoter [18]. Human and rat caspase-3 promoters showed 56% sequence identity. Analysis of the caspase-3 promoter sequence using MatInspector showed one putative p53 ⁄ p73-binding site consisting of two half-sites (Fig. 3). To identify the DNA sequences, which may mediate the p73-dependent activation of the caspase-3 promoter, several deletion mutants were prepared (Fig. 5A). All of these deletion mutants were activated by p73b by at least 20-fold (Fig. 5C). This deletion analysis identified a minimal promoter of 120 bp (Idel4; from )108 to +12), which retained good basal activity (about 30% activity relative to that of the full-length 715 bp promoter), and was activated by p73b by over 20-fold (Fig. 5A–C). This minimal promoter was activated nine-fold by p73a (Fig. 5C). These results show that p73-responsive sequences are present in the minimal caspase-3 promoter. As several putative Sp1 sites were identified in the caspase-3 promoter using MatInspector, we tested the ability of Sp1 to activate the caspase-3 promoter. For this purpose, we used the Drosophila embryo- derived cell line SL-2, which lacks Sp1 or Sp1-related activities [32]. The full-length and minimal caspase-3 promoter showed extremely low basal activity in SL-2 cells, but strong activation (several 100-fold) by Sp1 (Fig. 6A). p73b alone was not able to activate the caspase-3 promoter, but the addition of p73b increased the Sp1-induced caspase-3 promoter activity by 160% (Fig. 6A). A similar result was obtained (Idel4), which also with the minimal promoter showed strong activation by Sp1, and p73b further increased Sp1-induced activation (data not shown). Sp3, a member of the Sp1 family, was also able to activate the caspase-3 promoter, but p73b showed no cooperation with Sp3 in activating the promoter (Fig. 6B).
C. Sudhakar et al.
p73 activates caspase-3 promoter through Sp1
A
Sp1 sites A B
C3
+ 127
–588
A B
Del1
+ 127
–475
A B
Del2
+ 127
–350
A B
Del3
+ 127
–233
A B
IDel1
–167
+ 67
A B
IDel2
–167
+ 12
A B
IDel3
+ 67
–108
A B
IDel4
–108
+ 12
B
2 1.8
y t i
1.6 1.4
l
1.2 1
0.8
0.6 0.4
v i t c a d o f e v i t a l e R
0.2 0
C3 Del1 Del2 Del3
Idel1
Idel2
Idel3
Idel4
C
50
12
45
40
10
35
8
30
l
25
6
20
4
15
y t i v i t c a T A C e v i t a l e R
y t i v i t c a d o f e v i t a l e R
10
2
5
0
0
Idel1 Idel2
Idel3 Idel4 C3 Del1 Del2 Del3 – + – + – + – + – + – + – + – +
IDel4 + p73α 10 ng –
+ +
p73β (10 ng)
Fig. 5. Deletion analysis of caspase-3 promoter. (A) Schematic representation of various caspase-3 promoter-reporter constructs used for experiments in (B) and (C). Arrow indicates the transcription start site. (B) Basal activity of various deletion mutants of caspase-3 promoter in HeLa cells. Activities are shown relative to full-length promoter (C3) activity taken as 1.0 (n = 3). (C) Activation of deletion mutants of cas- pase-3 promoter by p73b (10 ng). CAT activities relative to full-length promoter activity (taken as 1.0) are shown (n = 3). The right panel shows the activation of minimal promoter by p73a.
Mutational analysis of putative Sp1 sites
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2205
As the caspase-3 promoter showed many potential Sp1 sites, we mutated these sites in the minimal promoter. Closely spaced sites were mutated in two groups to generate three mutants which carried point mutations to abrogate Sp1 sites (Fig. 7A). In each site, ‘GG’ in the core sequence was mutated to ‘AA’. These plas- mids were transfected in HeLa cells to determine the basal and p73-induced activity. Mutation of Sp1 sites located at the 5¢-end region of the minimal promoter (MutA construct) resulted in a loss of basal activity by more than 90%, whereas mutation of internal Sp1 sites (MutB) had a marginal effect on the basal promoter
C. Sudhakar et al.
p73 activates caspase-3 promoter through Sp1
2000
A
1800
1600
1400
1200
1000
800
600
y t i v i t c a T A C e v i t a l e R
400
200
0 Sp1 p73β
– + + +
– –
+ –
B
700
600
p73 may activate the caspase-3 promoter through interaction with another transcription factor. Sp1 has been shown to interact with p73 physically and func- tionally to mediate the p73-dependent repression of transcription from cyclin B1 and telomerase reverse transcriptase (TERT) promoters [33–35]. Sp1 is also involved in the mediation of the p73-induced activa- tion of the promoter for the cell cycle inhibitor p21 [36]. Therefore, we determined the effect of the muta- tion of Sp1 sites on the p73-dependent activation of the minimal caspase-3 promoter. Activation by p73b was drastically reduced in MutA and MutAB mutants, together with a decrease in basal activity (Fig. 7C). However, mutation of Sp1 sites B (in MutB) resulted in a partial reduction in p73b-induced promoter activ- ity (Fig. 7C). Similar results were obtained with the p73a isoform, which showed a nine-fold activation of the minimal promoter and no significant activation of MutA or MutAB (data not shown). These results show that Sp1-like sequences (mutated in the MutA con- struct) sustain basal caspase-3 promoter activity, and that the same sequences are also involved in the p73b- induced activation of the promoter.
y t i
500
400
300
v i t c a T A C e v
l
200
i t a e R
100
0
Sp3 p73β
– –
+ –
+ +
A synthetic oligonucleotide corresponding to the putative Sp1 sites present at the 5¢-end of the minimal caspase-3 promoter (Sp1 sites A, Fig. 3) was used for gel shift assays. This oligonucleotide was labelled with 32P and then incubated with nuclear extracts of HeLa cells. Binding to this oligonucleotide was seen with nuclear extracts of HeLa cells (Fig. 8A,B). This bind- ing was competed out with a 50-fold excess of unla- belled self-oligonucleotide and also with a consensus Sp1-binding oligonucleotide, but not by unrelated oli- gonucleotides (Fig. 8B). Binding of the consensus Sp1 site oligonucleotide to nuclear extract was competed out with the caspase-3 promoter oligonucleotide (Fig. 8C).
Fig. 6. Activation of caspase-3 promoter by Sp1 in SL-2 cells. (A) SL-2 cells were transfected with full-length caspase-3 promoter- reporter plasmid C3 (200 ng), with or without Drosophila cell-spe- cific expression vector for Sp1 (pPac Sp1, 50 ng) and p73b (500 ng). b-Galactosidase expression plasmid (pActin 5C bgal, 200 ng) was included in all transfections. After 48 h of transfection, cell lysates were prepared for reporter activity assays. CAT activi- ties relative to the control are shown. (B) Activation of caspase-3 promoter (Idel4) by Sp3. This experiment was performed as described in (A), except that pPac Sp3 plasmid was used instead of pPac Sp1.
Cisplatin activates caspase-3 promoter
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2206
activity (Fig. 7A,B). Mutation of all of these sites in MutAB further reduced the basal promoter activity. As no putative p73-binding sites could be identified in it is probable that the minimal caspase-3 promoter, The treatment of HeLa cells with cisplatin resulted in the activation of the full-length caspase-3 promoter- reporter construct (Fig. 9A). As cisplatin treatment of HeLa cells induced p73 protein and caspase-3 pro- moter activity, it was probable that p73 was mediating the cisplatin-induced caspase-3 promoter activity. Therefore, we examined the effect of the p73 inhibitor, p73DD, on cisplatin-induced caspase-3 promoter activ- ity. p73DD is a dominant inhibitor of p73 and lacks the N-terminal including the sequences of p73, sequence-specific DNA-binding domain [37]. Cisplatin- induced and basal caspase-3 promoter activity was inhibited by coexpression of p73DD (Fig. 9A). These
C. Sudhakar et al.
p73 activates caspase-3 promoter through Sp1
Fig. 7. Mutational analysis of Sp1-like sequences in caspase-3 promoter. (A) Schematic diagram showing the wild-type (Idel4) and its mutated sites in various mutants. The exact location of Sp1-like sequences in the promoter is shown in Fig. 3. (B) Basal activity of various mutants in HeLa cells. HeLa cells were transfected with the indicated plasmids (100 ng) and, 24 h later, the cell lysates were prepared for reporter assays. CAT activities relative to the activity of Idel4 (without mutations) are shown (n = 3). (C) Activation of various Sp1 site mutants by p73b. The indicated plasmids (100 ng) were cotransfected with or without p73b (10 ng). CAT activities relative to the activity of Idel4 are shown (n = 3). (D) Activation of various Sp1 site mutants of caspase-3 promoter by Sp1 in SL-2 cells. SL-2 cells were transfected with Idel4 or its mutants (200 ng each) in the absence or presence of Sp1 (pPac Sp1, 50 ng). After 48 h of transfection, the cell lysates were prepared for reporter activity assays.
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2207
C. Sudhakar et al.
p73 activates caspase-3 promoter through Sp1
Casp-3Sp1 site
GCGCGGGGGCGGGGCGCGCTGCGGTGGGCGGGCGC C
A
Consensus
ATTCGATCGGGGCGGGGCGAG
B
C
Casp-3Sp1 Consensus Unrelated oligo 1 Unrelated oligo 2
– – – –
– – – –
+ – – –
– + – –
– – + –
– – – +
Consensus Casp-3Sp1
– –
– –
+ –
– +
1
2
3
4
5
6
1
2
3
4
Casp-3Sp1 probe
Consensus probe
Fig. 8. Electrophoretic mobility shift assays. (A) Nucleotide sequence of a synthetic oligonucleotide (Casp-3 Sp1) encompassing Sp1 sites A, and of a consensus Sp1-binding oligonucleotide. (B,C) Electrophoretic mobility shift assays were carried out using radiolabelled Casp-3 Sp1 (B) or consensus Sp1 oligonucleotide (C). Nuclear extracts from HeLa cells were used for binding (lanes 2–4; lane 1, without nuclear extract). This binding was competed out with a 50-fold excess of unlabelled Casp-3 Sp1 or consensus oligonucleotide, showing the specificity of binding. Unrelated oligonucleotides were not able to compete out the binding of Casp-3 Sp1 (B).
contribute to the activation of the caspase-3 promoter by cisplatin.
results suggest that cisplatin-induced caspase-3 pro- moter activation is partly mediated by p73. In addi- tion, these results suggest that p73 contributes to the basal caspase-3 promoter activity. Induction of caspase-3 gene expression by p73
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2208
suggest that Previously, we have shown that cisplatin activates human caspase-1 promoter by activating endogenous p73, which acts primarily through a p73-responsive site in the minimal promoter [31]. As no putative p73-binding site could be identified in the minimal caspase-3 promoter, we determined the effect of the mutation of the Sp1 sites present in the minimal pro- moter on cisplatin-induced promoter activity. Muta- the Sp1 sites abolished cisplatin-induced tion of caspase-3 promoter activity (Fig. 9B). It was also observed that the minimal promoter (Idel4) showed less activation than the 715 bp promoter by cisplatin (Fig. 9A,B). These observations the sequences present outside the minimal promoter also We next examined the ability of overexpressed p73 to induce caspase-3 gene expression. Overexpression of p73 was achieved by the use of adenoviruses, which express p73a or p73b. In HeLa cells, overexpression of p73a or p73b resulted in only a small increase in cas- pase-3 mRNA levels relative to those of control virus- infected cells (Fig. 10A). Western blot analysis showed that the expression of p73a or p73b resulted in the appearance of processed caspase-3, although no detect- able increase or decrease in procaspase-3 was observed (Fig. 10B). The lack of increase in procaspase-3 pro- tein is probably the result of its proteolytic processing in cells overexpressing p73a or p73b. In A549 cells,
C. Sudhakar et al.
p73 activates caspase-3 promoter through Sp1
A
3.5
A Hela
3
1.35
1.07
1.00
2.5
Casp 3
2
1.5
GAPDH
1
Control
p73α
p73β
0.5
y t i v i t c a T A C e v i t a l e R
l
B
0
–
+
+
–
β 3 7 p
T U
α 3 7 p
o r t n o C
p73DD Cisplatin
–
+
–
+
Procaspase 3
B
1.6
Processed Caspase 3
1.4
1.2
p73α p73β
1
Tubulin
0.8
0.6
C A549
2.33
1.00
3.58
0.4
y t i v i t c a T A C e v i t a l e R
Casp 3
0.2
GAPDH
p73α
p73β
Control
+
+
+
–
0 Cisplatin
–
–
Idel4
MutA
MutAB
Fig. 10. Effect of overexpression of p73 on caspase-3 gene expres- sion. (A) HeLa cells were infected with adenoviruses AdCon (con- trol virus), Adp73a or Adp73b. After 48 h of infection, RNA was isolated and caspase-3 mRNA levels were determined by RT-PCR. (B) Immunoblot showing the level of procaspase-3, activated cas- pase-3 and p73 in HeLa cells infected with the indicated adenovi- ruses for 48 h. Tubulin was used as a loading control. (C) This experiment was carried out as described in (A), except that A549 cells were used. Numbers at the top (A,C) indicate the relative amount of Caspase-3 PCR product after normalization with the amount of GAPDH.
Fig. 9. Activation of caspase-3 promoter by cisplatin. (A) HeLa cells were transfected with 100 ng of caspase-3 promoter plasmid, C3, with or without p73DD plasmid (100 ng). After 6 h of transfection, the cells were treated with 10 lM cisplatin for 24 h. CAT activities relative to control are shown (n = 3). (dimethylformamide) (B) Effect of Sp1 site mutation on cisplatin-induced caspase-3 pro- moter activity. The minimal promoter Idel4 or its indicated mutants were transfected in HeLa cells. Treatment of cells and reporter assays were carried out as in (A).
showed that
Discussion
overexpression of p73a or p73b resulted in a much greater increase in caspase-3 gene expression relative to that in HeLa cells (Fig. 10C). These results suggest that overexpressed p73 can induce caspase-3 gene expression.
fied, which showed activation by Sp1, Sp3 and p73. Mutational analysis certain Sp1-like sequences play a critical role in sustaining basal pro- moter activity. In addition, p73-induced activation of the minimal promoter was mediated by the same Sp1- like sequences. The basal activity of the 120 bp mini- mal promoter was about three-fold lower than that of the full-length (715 bp) promoter, suggesting that sequences upstream or downstream of the minimal promoter also contribute to the basal promoter activity.
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2209
We have cloned and characterized human caspase-3 promoter. This promoter does not contain any TATA box, but several Sp1-like sequences are present. This promoter is activated by Sp1 and p73 isoforms, but not by p53. A minimal promoter of 120 bp was identi- Treatment of various p53-negative cell lines with the anticancer drug cisplatin resulted in the induction of
C. Sudhakar et al.
p73 activates caspase-3 promoter through Sp1
synergistically by p73 and Sp1. Although the p21 pro- moter has p53- ⁄ p73-binding sites, in SL-2 cells Sp1 is required for p73-induced activation of this promoter [36]. However, mutational analysis of the p21 promoter has not been carried out to determine the requirement of Sp1 sites for p73-induced activation of the promoter in mammalian cells. Thus, to our knowledge, the cas- pase-3 promoter is the first example of activation of a promoter by p73 through Sp1-like sequences.
caspase-3 gene expression. This effect of cisplatin was more pronounced in K562 cells, which also showed the induction of many other caspase genes, except caspase-7. These observations suggest that at least some common regulatory mechanisms are involved in the expression of many caspase genes. In addition, our results suggest that there are cell type-dependent differences in the induction of the caspase-3 gene and other caspase genes in response to treatment with cisplatin. Cis- platin-induced expression of the caspase-3 gene is probably a result of the activation of the promoter, because cisplatin was able to activate a caspase-3 promoter-reporter. Why is the caspase-3 promoter not activated by p53, although both p73 and p53 can interact with Sp1?
Conclusion
The full specificity of a transcriptional activator depends on a broad set of protein–protein and protein–DNA interactions [39]. The activation of transcription by p53 or p73 requires various coactivators and other regula- tory ⁄ accessory proteins. One possibility is that binding of p73 (but not of p53) to Sp1 at the caspase-3 promoter results in the recruitment of coactivators, which are required for activation of transcription from this pro- moter. Another possibility is that p53 may not be able to bind to Sp1 when it is bound to the caspase-3 pro- moter. In other words, the binding of p53 or p73 to Sp1 at any promoter may be dependent on the complement of regulatory proteins, which can bind to it.
The caspase-3 promoter-reporter is activated by p73 at low concentration. Overexpressed p73a and p73b induced a good increase in caspase-3 mRNA levels in A549 cells (Fig. 10); however, in HeLa cells, there was only a marginal increase in caspase-3 mRNA. One possible explanation is that, in HeLa cells, there may be much more turnover of caspase-3 mRNA than in A549 cells, which would result in less increase on p73 expression. There was turnover of procaspase-3 protein on p73 expression in HeLa cells, which possibly accounts for the lack of increase in caspase-3 protein. In the absence of any increase in the synthesis of pro- caspase-3 protein, there would be a decrease in procas- pase-3 protein on processing in p73-overexpressing cells, but no decrease was observed. Overall, our results are consistent with the suggestion that, on over- expression of p73, there is increased turnover of cas- pase-3 protein, which is maintained by increased transcription from the caspase-3 promoter.
How does p73 activate the caspase-3 promoter?
Experimental procedures
We have identified and characterized a minimal cas- pase-3 promoter, which is regulated by Sp1 and p73 isoforms, but not by p53. Cisplatin induces caspase-3 gene expression and promoter activation. Activation of this promoter by p73 is mediated by Sp1-like sequences, which also sustain basal promoter activity.
The expression vectors for the various isoforms of p73, namely p73a, p73b, p73c and p73d, cloned in frame with the HA tag into pcDNA3-HA, were a kind gift from G. Melino (University of Rome, Rome, Italy) [26]. The plasmid for expressing p73DD, cloned in frame with the T7 tag into pcDNA3-T7, was a kind gift from W. G. Kaelin (Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA, USA) [37]. For the expression of Sp1 and Sp3 in Drosophila SL-2 cells, pPac Sp1 and pPac Sp3 plasmids were used, which have the respective cDNAs cloned under the control of the Drosophila Actin 5C promoter [40]. The empty vector pPac O was used as control. For the expres-
Expression vectors and antibodies
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2210
No putative p53- or p73-binding sites were found by analysis of the minimal caspase-3 promoter, although it was activated by p73, even at very low concentrations. On the basis of the various results, we suggest that Sp1 or Sp1-like proteins mediate the p73-induced activation of the caspase-3 promoter. This suggestion is supported by the following observations: (a) p73 by itself does not activate the caspase-3 promoter in SL-2 cells (which are deficient in Sp1 or Sp1-like activities); however, in the presence of Sp1, it increases the promoter activity; (b) the mutation of Sp1-like sequences results in the abroga- tion of p73-induced promoter activity in HeLa cells; and (c) Sp1 is known to interact physically and functionally with p73 [33–36]. Previously, it has been shown that human TERT, cyclin B1 and vesicular endothelial growth factor promoters are repressed by p73 through Sp1-binding sites [33–35,38]. The promoter of the cyclin-dependent kinase inhibitor p21 gene is activated
C. Sudhakar et al.
p73 activates caspase-3 promoter through Sp1
sion of b-galactosidase in SL-2 cells, pActin 5C bgal plas- mid was used [40]. Cdk2, tubulin and caspase-3 antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA); p73 monoclonal antibody (ER15) was obtained from Neomarkers Inc. (Union City, CA, USA). Activated caspase-3 antibody was obtained from Cell Signaling Tech- nology, Danvers, MA, USA.
Indianapolis,
(Roche Diagnostics,
Reporter plasmids and reporter assays
site-directed mutagenesis
The mammalian cell lines were maintained at 37 (cid:2)C in a CO2 incubator in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum. The transfections were performed using Lipofectamine Plus(cid:3) reagent (Invitrogen, San Diego, CA, USA), according to the manufacturer’s instructions. All the plasmids for trans- fection were prepared using Qiagen (Hilden, Germany) columns. Cisplatin (Sigma, St Louis, MO, USA) dissolved in dimethylformamide (25 mm stock solution) was added wherever indicated. Dimethylformamide was used as a control for cisplatin. The final concentration of dimethyl- formamide did not exceed 0.1%.
Cell culture and transfections
In order to clone the promoter of human caspase-3, the genomic DNA isolated from normal human blood was used as a template to amplify the upstream sequences from )588 to +127 of the caspase-3 gene, employing a GC-rich PCR kit IN, USA) with appropriate primers. This 715 bp amplicon contains 48 bases of the first exon. The product was cloned into the PstI site of the pCAT promoter-less basic vector upstream of the CAT gene. The nucleotide sequence of the promoter was confirmed using an automated DNA sequencing unit. Various deletion clones were generated by PCR and cloned into the pCAT vector in HindIII-PstI sites. The smallest deletion clone generated was Idel4. The Sp1 sites present in the middle of the smallest clone Idel4 were mutated by PCR-based, (MutB construct). The Sp1 sites present at the 5¢-end of the smallest clone Idel4 were mutated by PCR by incorporating mutations in the forward primer itself (MutA construct). The construct MutAB, in which Sp1 sites A and Sp1 sites B were mutated, was also generated. The sequences of all of the mutants were also confirmed by automated sequencing. These reporter constructs were tested by transient transfec- tion for responsiveness to p73b. Cells grown in 35 mm dishes or 24-well plates were transfected with various pro- (Invitrogen) and moter constructs, pCMV.SPORT-b-gal indicated amounts of the plasmids expressing various p73 isoforms. The total amount of plasmid in each transfection was kept constant (1 lg for a 35-mm dish and 0.4 lg for a 24-well plate) by adding control plasmid. The preparation of lysates and CAT assays were carried out as described previously [31]. Relative CAT activities were calculated after normalizing with b-galactosidase enzyme activities.
Total RNA was isolated using Trizol(cid:3) reagent (Invitro- gen). Semiquantitative RT-PCR was carried out essentially as described previously [31]. RNA was reverse transcribed, using reagents from a first-strand cDNA synthesis kit (Invi- trogen). Amplification of caspase-3 was performed for 30 cycles using appropriate primers, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was amplified for 19 cycles. Gene-specific primers were used for the ampli- fication of various caspases.
RT-PCR
antibody
using
The Drosophila Schneider line 2 (SL-2) cells were main- tained and propagated in Schneider’s Drosophila medium (Invitrogen) containing 10% fetal bovine serum (Invitrogen) at room temperature without CO2. One day before trans- fection, two million cells were plated in a six-well plate with 2 mL of complete medium. Before transfection, the cells were washed with serum-free medium. One microgram of plasmid (containing various plasmids according to the requirement), diluted in 100 lL of serum-free medium, was mixed with 100 lL of medium containing 6 lL of Cellfec- tin, incubated for 30 min at room temperature and added to cells at a final volume of 600 lL made up with serum- free medium. After 5 h of incubation, 300 lL of medium with 30% serum was added. After 24 h, 1 mL of medium containing 10% serum was added. Cell extracts were pre- pared after 48 h of transfection in reporter lysis buffer,
After treatment, cells were washed twice with NaCl ⁄ Pi and lysed in 1· SDS sample buffer. Proteins were separated on 10% SDS-polyacrylamide gels, and blotted onto nitrocellu- lose membranes. The blot was washed twice with Tween ⁄ Tris-buffered saline before blocking nonspecific binding with 5% nonfat dry milk (BLOTTO, from Santa Cruz Biotech- nology). The p73 antibody (1 : 100) was added and the blot was incubated overnight at 4 (cid:2)C. The blot was then washed three times, and detection was performed by horseradish peroxidase-conjugated the secondary enhanced chemiluminescence (ECL) method (Roche Mole- cular Biochemicals, Indianapolis, IN, USA). The caspase-3, Cdk2 and other antibodies were used at 1 : 500 dilution and the blot was incubated for 1 h at room temperature. The blot was washed three times, and detection was performed using alkaline phosphatase-conjugated secondary antibody, or by the ECL method, as described previously [31].
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2211
Western blot analysis Maintenance and transfection of Drosophila SL-2 cells
C. Sudhakar et al.
p73 activates caspase-3 promoter through Sp1
death substrate poly(ADP-ribose) polymerase. Cell 81, 801–809.
after pelleting the cells and washing with NaCl ⁄ Pi, as described previously for mammalian cells [31].
5 Tang D & Kidd VJ (1998) Cleavage of DFF-45 ⁄ ICAD by multiple caspases is essential for its function during apoptosis. J Biol Chem 273, 28549–28552.
6 Woo M, Hakem R, Soengas MS, Duncan GS, Shahi- nian A, Kagi D, Hakem A, McCurrach M, Khoo W, Kaufman SA et al. (1998) Essential contribution of cas- pase 3 ⁄ CPP32 to apoptosis and its associated nuclear changes. Genes Dev 12, 806–819.
double-stranded
labelled
with
Electrophoretic mobility shift assay was performed with nuclear extracts of HeLa cells using labelled double- stranded oligonucleotide, as described previously [41]. For binding, 2 lL of extracts was incubated in appropriate buf- fer oligonucleotide (20 000 c.p.m.) at 37 (cid:2)C for 30 min. The samples were then run on a 4% non-denaturing acrylamide gel. The gel was then dried and exposed to X-ray film.
7 Zheng TS, Schlosser SF, Dao T, Hingorani R, Crispe IN, Boyer JL & Flavell RA (1998) Caspase-3 controls both cytoplasmic and nuclear events associated with Fas-mediated apoptosis in vivo. Proc Natl Acad Sci USA 95, 13618–13623.
Electrophoretic mobility shift assay
8 Kuida K, Zheng TS, Na S, Kuan C, Yang D, Karasuy-
ama H, Rakie P & Flavell RA (1996) Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature 384, 368–372.
9 Yakovlev AG, Knoblach SM, Fan L, Fox GB, Good- night R & Faden AI (1997) Activation of CPP32-like caspases contributes to neuronal apoptosis and neuro- logical dysfunction after traumatic brain injury. J Neu- rosci 17, 7415–7424.
10 Ni B, Wu X, Su Y, Stephenson D, Smalstig EB, Clem- ens J & Paul SM (1998) Transient global forebrain ischemia induces a prolonged expression of the caspase- 3 mRNA in rat hippocampal CA1 pyramidal neurons. J Cereb Blood Flow Metab 18, 248–256.
(Invitrogen),
2000
Adenoviral vectors for expressing p73 isoforms were gener- ated using the AdEasy System, as described previously [42]. Adp73a and Adp73b, expressing the p73a and p73b iso- forms, respectively, were constructed as follows. p73a or p73b cDNA was isolated from the pcDNA3.1-p73 plasmid by KpnI ⁄ XhoI digestion, and cloned into pAdtrack-CMV plasmid under the control of the cytomegalovirus (CMV) promoter terminated by the SV40 polyadenylation signal, resulting in pAdtrack-CMV-p73a or pAdtrack-CMV-p73b. The pAdtrack-CMV plasmid was utilized as a control vec- tor. Recombinant plasmids were generated by homologous recombination in AdEasier cells. The 293T cells were trans- fected with the recombinant adenoviral plasmids using lipo- fectamine and adenoviruses were collected. The amount of virus needed for the infection of more than 90% of cells was determined by titration.
11 Jin K, Mao XO, Eshoo MW, Nagayama T, Minami M, Simon RP & Greenberg DA (2001) Microarray analysis of hippocampal gene expression in global cerebral ische- mia. Ann Neurol 50, 93–103.
Acknowledgements
12 Chen M, Ona VO, Li M, Ferrante RJ, Fink KB, Zhu S, Bian J, Guo L, Farrell LA, Hersch SM et al. (2000) Minocycline inhibits caspase-1 and caspase-3 expression and delays mortality in a transgenic mouse model of Huntington disease. Nat Med 6, 797–801.
13 Droin N, Dubrez L, Eymin B, Renvoize C, Breard J,
Construction of adenoviral vectors
Dimanche-Boitrel MT & Solary E (1998) Upregulation of CASP genes in human tumor cells undergoing etoposide- induced apoptosis. Oncogene 16, 2885–2894.
References
1 Salvesen GS & Dixit VM (1997) Caspases: intracellular
signaling by proteolysis. Cell 91, 443–446.
14 Li DW, Xiang H, Mao YW, Wang J, Fass U, Zhang XY & Xu C (2001) Caspase-3 is actively involved in okadaic acid-induced lens epithelial cell apoptosis. Exp Cell Res 266, 279–291.
2 Degterev A, Boyce M & Yuan J (2003) A decade of
caspases. Oncogene 22, 8543–8567.
3 Boatright KM & Salvesen GS (2003) Mechanisms
15 Chua CC, Chua BH, Chen Z, Landy C & Hamdy RC (2003) Dexamethasone induces caspase activation in murine osteoblastic MC3T3-E1 cells. Biochim Biophys Acta 1642, 79–85.
of caspase activation. Curr Opin Cell Biol 15, 725– 731.
16 Qi H, Chen HZ & Jin ZJ (2002) Caspase 3 gene expres- sion and (Ca2+)i homeostasis underlying desipramine- induced C6 glioma cell apoptosis. Acta Pharmacol Sin 23, 803–807.
4 Tewari M, Quan LT, O’Rourke K, Desnoyers S, Zeng Z, Beidler DR, Poirier GG, Salvesen GS & Dixit VM (1995) Yama ⁄ CPP32 beta, a mammalian homolog of CED-3, is a CrmA-inhibitable protease that cleaves the
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2212
We thank Drs Gerry Melino and William Kaelin for providing reagents, and Dr V. Radha for critical read- ing of the manuscript. This work was supported by a grant from the Indian Council of Medical Research to GS.
C. Sudhakar et al.
p73 activates caspase-3 promoter through Sp1
17 Sabbagh L, Kaech SM, Bourbonniere M, Woo M,
by cell adhesion is independently mediated by p53 and c-Abl. Proc Natl Acad Sci USA 100, 10281–10286. 30 Strano S, Monti O, Pediconi N, Baccarini A, Fon-
Cohen LY, Haddad EK, Labrecque N, Ahmed R & Sekaly RP (2004) The selective increase in caspase-3 expression in effector but not memory T cells allows susceptibility to apoptosis. J Immunol 173, 5425–5433. 18 Liu W, Wang G & Yakovlev AG (2002) Identification and functional analysis of the rat caspase-3 gene promoter. J Biol Chem 277, 8273–8278.
19 Sabbagh L, Bourbonniere M, Denis F & Sekaly RP
temaggi G, Lapi E, Mantovani F, Damalas A, Citro G, Sacchi A et al. (2005) The transcriptional coactivator Yes-associated protein drives p73 gene-target specificity in response to DNA damage. Mol Cell 18, 447–459. 31 Jain N, Gupta S, Sudhakar Ch, Radha V & Swarup G (2005) Role of p73 in regulating human caspase-1 gene transcription induced by interferon-c and cisplatin. J Biol Chem 280, 36664–36673.
(2006) Cloning and functional characterization of the murine caspase-3 gene promoter. DNA Cell Biol 25, 104–115.
20 Hoeche MV, Prigent-Tessier AS, Garnier PE, Bertrand
32 Courey AJ & Tjian R (1988) Analysis of Sp1 in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif. Cell 55, 887–898.
NM, Filomenko R, Bettaieb A, Marie C & Beley AG (2006) Evidence of HIF-1 functional binding activity to caspase-3 promoter after photothrombotic cerebral ischemia. Mol Cell Neurosci 34, 40–47.
33 Innocente SA & Lee JM (2005) p73 is a p53-indepen- dent, Sp1-dependent repressor of cyclin B1 transcrip- tion. Biochem Biophys Res Commun 329, 713–718. 34 Racek T, Mise N, Li Z, Stoll A & Putzer BM (2005)
21 Bois PR, Izeradjene K, Houghton PJ, Cleveland JL,
C-terminal p73 isoforms repress transcriptional activity of the human telomerase reverse transcriptase (hTERT) promoter. J Biol Chem 280, 40402–40405.
Houghton JA & Grosveld GC (2005) FOXO1a acts as a selective tumour suppressor in alveolar rhabdomyo- sarcoma. J Cell Biol 170, 903–912.
35 Beitzinger M, Oswald C, Beinoraviciute-Kellner R &
22 Melino G, De Laurenzi V & Vousden KH (2002) p73: friend or foe in tumorigenesis. Nat Rev Cancer 2, 605– 615.
Stiewe T (2006) Regulation of telomerase activity by the p53 family member p73. Oncogene 25, 813–826.
23 Irwin MS & Kaelin WG (2001) p53 family update: p73 and p63 develop their own identities. Cell Growth Differ 12, 337–349.
36 Koutsodontis G, Vasilaki E, Chou W-C, Papakosta P & Kardassis D (2005) Physical and functional interac- tions between members of the tumour suppressor p53 and the Sp families of transcription factors: importance for the regulation of genes involved in cell cycle arrest and apoptosis. Biochem J 389, 443–445.
37 Irwin M, Marin MC, Phillips AC, Seelan RS, Smith
24 Yang A & McKeon F (2000) P63 and P73: P53 mimics, menaces and more. Nat Rev Mol Cell Biol 1, 199–207. 25 Pozniak CD, Radinovic S, Yang A, McKeon F, Kaplan DR & Miller FD (2000) An anti-apoptotic role for the p53 family member, p73, during developmental neuron death. Science 289, 304–306.
DI, Liu W, Flores ER, Tsai KY, Jacks T, Vousden KH et al. (2000) Role for the p53 homologue p73 in E2F-1- induced apoptosis. Nature 407, 645–648.
38 Salimath B, Marme D & FinkenZellar G (2000) Expres- sion of the vascular endothelial growth factor gene is inhibited by p73. Oncogene 19, 3470–3476.
39 Harrison SC (2007) Three dimensional intricacies in
26 De Laurenzi V, Costanzo A, Barcaroli D, Terrinoni A, Falco M, Annicchiarico-Petruzzelli M, Levrero M & Melino G (1998) Two new p73 splice variants, gamma and delta, with different transcriptional activity. J Exp Med 188, 1763–1768.
protein–DNA recognition and transcriptional control. Nat Struct Mol Biol 14, 1118–1119.
40 Muralikrishna B & Parnaik VK (2001) Sp3 and AP-1
mediate transcriptional activation of the lamin A proxi- mal promoter. Eur J Biochem 268, 3736–3743.
27 Fillippovich I, Sorokina N, Gatei M, Haupt Y, Hobson K, Moallem E, Spring K, Mould M, McGuckin MA, Lavin MF et al. (2001) Transactivation deficient p73alpha (p73Deltaexon2) inhibits apoptosis and com- petes with p53. Oncogene 20, 514–522.
41 Gupta S, Radha V, Furukawa Y & Swarup G (2001)
28 Gong JG, Costanzo A, Yang HQ, Melino G, Kaelin WG Jr, Levrero M & Wang JY (1999) The tyrosine kinase c-Abl regulates p73 in apoptotic response to cisplatin-induced DNA damage. Nature 399, 806–809.
29 Truong T, Sun G, Doorly M, Wang JY & Schwartz MA
(2003) Modulation of DNA damage-induced apoptosis
Direct transcriptional activation of human caspase-1 by tumor suppressor p53. J Biol Chem 276, 10585–10588. 42 Jain N, Sudhakar Ch & Swarup G (2007) Tumor necro- sis factor-a-induced caspase-1 gene expression: role of p73. FEBS J 274, 4396–4407.
FEBS Journal 275 (2008) 2200–2213 ª 2008 The Authors Journal compilation ª 2008 FEBS
2213
