Báo cáo Y học: Interaction of the anterior fat body protein with the hexamerin receptor in the blowfly Calliphora vicina

Eur. J. Biochem. 269, 954–960 (2002) (cid:211) FEBS 2002

Interaction of the anterior fat body protein with the hexamerin receptor in the blowfly Calliphoravicina

Immo A. Hansen, Susanne R. Meyer, Ingo Scha¨ fer and Klaus Scheller

Department of Cell and Developmental Biology, Biocenter of the University, Wu¨rzburg, Germany

P30 peptide) and other receptor cleavage products that contain P30. Expression of AFP mRNA and protein is restricted to the anterior part of the fat body tissue and to haemocytes in last-instar larvae. AFP mRNA occurs in all postembryonic developmental stages. Our results suggest that AFP plays a role in the regulation of hexamerin uptake by fat body cells along the anterior–posterior axis.

both Diptera and Lepidoptera, data are accumulating that show regional differences in fat body function. In the corn earworm, Helicoverpa zea, storage proteins are synthesized by the peripheral fat body fraction, but are taken up and stored only by the perivisceral fat body [12]. In the silkworm, Bombyx mori, it has been demonstrated that dorsal and ventral perivisceral fat body contains the most competent cells for sequestering haemolymph proteins compared with peripheral and hind-gut associated fat body tissue [13].

In dipteran insects, differences in both composition and fate of the anterior and posterior fat body have been reported. The larval fat body of the fruitfly, Drosophila melanogaster, and the blue blowfly, Calliphora vicina, is organized into a lobed tissue of (cid:25) 2000–3000 polytene cells, which become dissociated from each other during meta- morphosis. Roughly half of the cell population survives metamorphosis, indicating a specific degree of differentia- tion during postembryonic life [14,15]. An increase in the number of storage protein granules found along the anterior–posterior axis has been described in the fruitfly Drosophila [16], and rapid degradation of the anterior part of the fat body tissue after pupariation has been reported in the fleshfly Sarcophaga peregrina [17]. The authors report the specific expression of anterior fat body protein (AFP) in the trophocytes of the anterior fat body of S. peregrina, demonstrating one of the biochemical differences in dipteran fat body tissue.

The construction of adult tissues during the metamorphosis of holometablous insects requires large amounts of energy and building blocks. Before formation of the puparium, fat body cells reabsorb proteins and other macromolecules that have accumulated in the haemolymph during the larval feeding period. The major fraction of incorporated proteins consists of arylphorins and LSP-2 which belong to the class of hexamerins, haemocyanin-related proteins, named according to their composition of six identical or closely related subunits [1]. Although some studies suggest that a nonspecific, general protein uptake mechanism is responsi- ble for the incorporation of hexamerins [2], the selectivity of this process has been demonstrated unambiguously by the differential clearing of distinct proteins from the haemol- ymph [3–6]. Transport of hexamerins through fat body cell membranes is controlled by ecdysteroids and mediated by a specific receptor (for review, see [7]). The hexamerin receptor of Calliphora vicina was cloned and its post- translational processing studied in detail. Two cleavage steps, which detach a 45-kDa and a 30-kDa peptide from the hexamerin-binding N-terminus of the receptor precursor (Fig. 1), have been shown to be connected to activation of the receptor and initiation of hexamerin endocytosis [8,9]. The principal cell type of the fat body is the trophocyte, which is morphologically uniform and has long been thought to have equivalent functions. Almost all experiments dealing with protein expression and sequestration by this tissue have been performed using the entire fat body [10,11]. However, in

Keywords: anterior fat body protein; Calliphora vicina; cDNA sequence; hexamerin receptor; yeast two-hybrid system. In late larvae of the blowfly, Calliphora vicina, arylphorin and LSP-2 proteins, which belong to the class of hexamerins, are selectively taken up by the fat body from the haemolymph. Hexamerin endocytosis is mediated by a specific membrane- bound receptor, the arylphorin-binding protein (ABP). Using the two-hybrid technique, we found that the anterior fat body protein (AFP) interacts with the hexamerin receptor. AFP, a homologue of the mammalian calcium-binding liver protein regucalcin (senescence marker protein-30), exhibits a strong binding a(cid:129)nity for a naturally occurring C-terminal cleavage fragment of the hexamerin receptor precursor (the

Here we report the tissue-specific expression of AFP and its interaction with the hexamerin receptor. This is the first demonstration of a protein–protein interaction of the hexamerin receptor with a nonhexameric partner.

E X P E R I M E N T A L P R O C E D U R E S

Experimental animals

Correspondence to I. A. Hansen, Medizinische Polyklinik der Universita¨ t, Endokrinologie, Josef-Schneider-Str. 2, D-97080 Wu¨ rzburg, Germany. E-mail: i.hansen@medizin.uni-wuerzburg.de Abbreviations: ABP, arylphorin-binding protein; AFP, anterior fat body protein; NBT/BCIP, nitroblue tetrazolium chloride/5-bromo- 4-chloro-3-indonyl phosphate (Received 22 June 2001, revised 22 October 2001, accepted 7 December 2001)

A strain of C. vicina that has been maintained in our laboratory for several decades was used. The flies were

Calliphora anterior fat body protein (Eur. J. Biochem. 269) 955

(cid:211) FEBS 2002

plasmid isolation using the QIAfilter Plasmid Mega Kit (Qiagen, Hilden, Germany). One milligram of library plasmids was isolated. The cDNA library contains (cid:25) 3.8 · 105 individual clones in the correct reading frame. The average insert size was 1 kbp.

Construction of hexamerin receptor bait proteins for two-hybrid screening

Three hexamerin receptor bait plasmids were constructed receptor cleavage products according to the natural ABP130, ABP96, ABP64 described previously [9] (Fig. 1). Using a pBluescript SK+ vector bearing the complete hexamerin receptor cDNA sequence (GenBank accession number X79100) as a template, three cDNA fragments were amplified via PCR using different primer combinations:

(2) ABP96: ABP130-5¢/ABP96-3¢ (CTCGAGAGGCAAC

AACAGACGATGAGGCAACTTA);

(3) ABP64: ABP130-5¢/ABP64-3¢(CTCGAGACCAGA

GATCTCATCATTATCATTGTAATT).

Fig. 1. Scheme of the post-translational cleavage pattern of the Calli- phora hexamerin receptor [7,9]. The primary translation product con- tains a 17-amino-acid N-terminal signal peptide which is removed immediately after translation. Before reaching the cell membrane, the receptor precursor is cleaved a second time: a 429-amino-acid C-ter- minal fragment is removed, giving rise to P45 and ABP96 (807 amino acids) which comprises the active receptor. The onset of arylphorin reabsorption by the fat body coincides with a third receptor cleavage which generates ABP64 (554 amino acids) and P30 (253 amino acids). Only ABP 130, ABP96 and P30 are able to bind hexamerins.

reared on bovine meat at 25 (cid:176)C and relative humidity of 65% as previously described [18].

(1) ABP130: ABP130-5¢(CTCGAGGGTGTTATAATGG ATCGAGGTGGACGAGT)/ABP130-3¢ (CTCGAG ATTCAATTATTTAGTACAAATGGCTAAGAGG CATTT);

Preparation of fat body tissue and haemocytes

XhoI restriction sites were attached at the 5¢ ends of the primers. PCR was carried out using PfuTurbo(cid:210) DNA Polymerase (Stratagene, La Jolla, CA, USA) following the manufacturer’s protocol. The PCR products were sub- cloned in pCR-Script Amp vector (PCR-ScriptTM Amp Cloning Kit; Stratagene), excised with XhoI, and finally ligated in the two-hybrid bait vector pEG202 (Origene, Rockville, MD, USA). The orientation and correct insertion were checked by sequencing using the pEG202-seq primer.

Third-instar larvae were washed in insect saline and anaes- thetized by cooling on ice for a few minutes. The larvae were dissected by a medial cut, washed with cold insect saline, and the fat body tissues excised. For the isolation of haemocytes, anaesthetized larvae were dried and transferred to a cold microscope slide. From a small cut in the abdomen, haemolymph (5–10 lL per larva) was collected by pipette and transferred to a 1.5-mL Eppendorf tube on ice. After centrigugation at 3000 r.p.m. at 4 (cid:176)C, the supernatant was removed and the pellet containing the haemocytes was washed twice with ice-cold insect saline and re-centrifuged.

This was carried out following a standard protocol for LexA-based two-hybrid systems [19]. Thirty-one library plasmids that interacted with the baits were isolated from the yeast and transferred into E. coli XL1-blue cells and sequenced from the 3¢ and 5¢ end on a Perkin–Elmer 310 sequencer using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin–Elmer).

Two-hybrid screening

Two-hybrid library construction

5¢ RACE 5¢ RACE was performed using the SMARTTM RACE cDNA Amplification Kit (Clontech, Alameda, CA, USA) following the manufacturer’s instructions. Two specific primers were used (P1: 5¢-GCCATCGGGCAACAAAT GATCCTTGGGGCTGGTCTTG-3¢; P2: 5¢-GATCGG TTGTACCTTCGACGGGCACAGCAAAACCA-3¢, see Fig. 3).

Northern-blot hybridization

Total RNA was isolated from dissected fat body tissues of third-instar larvae (6–7-day-old larvae) using Trizol reagent (Gibco) following the supplier’s instructions for fatty tissues. One microgram of total RNA was used for cDNA synthesis with the SMARTTM PCR cDNA Library Construction Kit (Clontech, Heidelberg, Germany). The cDNA obtained included two different SfiI restriction sites at the 5¢ and 3¢ ends (SfiI/A, SfiI/B). The two-hybrid library vector pJG4-5 (GenBank accession number U89961) was modified by introducing the SfiI/A and SfiI/B restriction sites into its multiple coloning site allowing directed cloning of the cDNA. The ligation reaction was carried out overnight at 16 (cid:176)C. The library plasmids were transformed in Escherichia coli XL1-Blue cells via electroporation and grown on Luria– Bertani plates containing ampicillin. A total of 1.2 · 106 independent bacterial clones were obtained and subjected to Total RNA was extracted from freshly prepared tissues using the TriFast Kit (Peqlab, Erlangen, Germany) and subjected to electrophoresis in a 0.8% agarose gel. North- ern-blot analysis was performed according to standard procedures [20]. As a hybridization probe, we used a synthesized from digoxygenin-labeled antisense RNA,

956 I. A. Hansen et al. (Eur. J. Biochem. 269)

(cid:211) FEBS 2002

the pellet washed eight times with NaCl/Pi. The last pellet was suspended in 30 lL sample buffer, heated at 95 (cid:176)C for 2 min, and centrifuged. The supernatant (15 lL) was subjected to SDS/PAGE.

linearized AFP cDNA as template using the DIG-RNA- Labeling Kit (T7; Roche Molecular Biochemicals, Mann- heim, Germany). Immunodetection was carried out using antibodies to DIG coupled with peroxidase. The blots were developed by the nitroblue tetrazolium chloride/5-bromo- 4-chloro-3-indonyl phosphate (NBT/BCIP) method. Western-blot analysis

Insitu hybridization on cryosections

For immunoblots, the heat-denatured proteins were trans- ferred to poly(vinylidene difluoride) membranes (Millipore Corp., Bedford, MA, USA). The membranes were blocked with 10% nonfat dried milk/0.3% Tween 20 in NaCl/Tris and incubated with anti-AFP IgG (0.5 lgÆmL)1 in NaCl/ Tris containing 1% BSA) for 2 h at room temperature. After three washes in NaCl/Tris, the secondary antibody (goat anti-rabbit IgG conjugated with alkaline phosphatase, diluted 1 : 7500; Promega, Heidelberg, Germany) was added and the blots were incubated for 1 h. After three washes, the blots were developed with NBT/BCIP system as described under Northern-blot hybridization.

in 0.5 · PAT). After

Immunofluorescence analysis

Longitudinal cryosections (10 lm) from the same larvae as used for in situ hybridization were blocked at room temperature for 2 h with 3% normal goat serum in 0.5 · PAT (1 · NaCl/Pi, 1% albumin, 0.5% Triton X-100) and then incubated overnight at 4 (cid:176)C with anti-AFP IgG (10 lgÆlL)1 three washes with NaCl/Pi, the sections were incubated for 2 h at room temperature with a Cy2 (cyanine 2-OSu bisfunctional)- conjugated affinity-purified goat anti-rabbit IgG (1 : 50; Rockland, Gilbertsville, PA, USA) in 0.5 · PAT. After being thoroughly washed, the sections were analyzed under a Leica fluorescent microscope and photographed with a Pixera CCD camera. The specificity of the AFP immuno- reaction was verified by omitting the primary antibody.

Seven-day-old anaesthetized larvae received injections of 5 lL 4% paraformaldehyde in NaCl/Pi (7 mM Na2HPO4, 3 mM NaH2HPO4, 130 mM NaCl) and were fixed overnight in paraformaldehyde/NaCl/Pi at 4 (cid:176)C. The fixed larvae were incubated at 4 (cid:176)C for 24 h in Ringer solution (130 mM NaCl, 4.7 mM KCl, 0.74 mM KH2HPO4, 0.35 mM Na2HPO4, 1.8 mM MgCl2, pH 7.0) containing 25% sucrose. Longitudinal cryosections (10 lm) were incubated for 5 min in 0.1 M glycine/Tris/HCl buffer (pH 7.0) and successively for 15 min at room temperature in NaCl/Pi containing 0.3% Triton X-100. After three wash steps with NaCl/Pi, the sections were fixed for 2 min in 2% paraform- aldehyde and then for 10 min in 10 mM Tris/HCl/1 mM EDTA (pH 7.4). After a 1-h prehybridization, the heat- denatured DIG-labeled AFP-antisense RNA probe was added for hybridization overnight at 42 (cid:176)C. The slides were washed according to the following scheme: 3 · 10 min with 4 · NaCl/Cit; 2 · 10 min with 2 · NaCl/Cit; 10 min with 0.1 · NaCl/Cit; 10 min with 0.05 · NaCl/Cit; 5 min with NaCl/Tris. After incubation for 30 min in nonfat dried milk-saturated NaCl/Pi, the slides were incubated for 2 h at 37 (cid:176)C with antibodies to DIG. After three washes with NaCl/Tris, the reactive structures were visualized by the NBT/BCIP method. The specimens were mounted in Mowiol and analyzed under the microscope.

Whole-mount insitu hybridization

R E S U L T S

Last-instar larvae were dissected in ice-cold insect saline by a cut at the posterior end and upending the complete larvae. The gut was removed and the preparations promptly fixed in MEMFA (0.1 M Mops, 2 mM EGTA, 1 mM MgSO4, 3.7% formaldehyde) for 2 h at room temperature. The tissues were dehydrated with methanol and stored at )20 (cid:176)C until used for whole-mount in situ hybridization [21].

Screening for interaction with hexamerin receptor

Using the yeast two-hybrid system and ABP 130, as well as ABP 96 (Fig. 1) as a bait, we isolated 27 (cid:212)interaction positive(cid:213) yeast clones. The library (prey) plasmids of these clones was isolated. Sequence analysis of the cDNAs revealed that 17 were hexamerin cDNAs (14 arylphorin and three LSP-2), confirming the ability of the experimental system to identify proteins that interact with the hexamerin receptor. Thirteen of the library plasmids contained cDNAs that encoded nonhexamerin interactors. In our database search using BLAST X analysis, nine showed no homology to any known protein. We identified three cDNAs that encoded a protein with 93% identity in the deduced amino-acid sequence with the AFP of S. peregrina (GenBank accession number BAA99282). Because of the high sequence identity with the Sarcophaga AFP, we named our clone Calliphora AFP (GenBank accession number AY028616). The AFP clones were identified by screening the prey library with ABP130 (once) or ABP96 (twice) as baits.

Immuno-coprecipitiation with AFP and ABP antibodies

We also examined the ability of AFP to interact with ABP130, ABP96, and ABP64 in the two-hybrid assay. We found a strong interaction between AFP and ABP130 and ABP96, but no interaction with ABP64 (Table 1). The anti-ABP IgG recognizes the hexamerin (arylphorin) receptor of C. vicina [5]. The anti-AFP IgG was provided by Dr Nakajima and recognizes a 34-kDa AFP in S. peregrina [17]. Protein A–Sepharose CL-4B (Pharma Biotech, Frei- burg, Germany) was suspended in NaCl/Pi. The resulting gel was centrifuged at 1000 g and resuspended in 1 vol. NaCl/Pi (SL). Anterior fat body tissue from 8-day-old larvae was homogenized in NaCl/Pi containing 0.05% phenylthiourea and centrifuged for 5 min at 8000 g at 4 (cid:176)C. The supernatant was used for immunoprecipitation. SL (50 lL) was incubated in an Eppendorf cap with 5 lg anti- ABP IgG at 4 (cid:176)C for 4 h. Then, 500 lL fat body supernatant or 500 lL haemocytes was added and incuba- ted at 4 (cid:176)C overnight. As controls, anti-(rabbit LexA) IgG was added as an antibody or NaCl/Pi was used instead of homogenate. The incubation mixtures were centrifuged and

Calliphora anterior fat body protein (Eur. J. Biochem. 269) 957

(cid:211) FEBS 2002

Table 1. Interaction of AFP with different fragments of the hexamerin receptor (see Fig. 1) in a two-hybrid experiment. AFP binds to ABP130 and ABP96 but not ABP64. The hexamerin, arylphorin, used as a positive control, binds to all receptor fragments.

Reporter gene

Leu2

lacZ

Library plasmid (Prey)

Bait

the AFP of S. peregrina, and, furthermore, a 75% identity and 85% positivity with the AFP of D. melanogaster (GenBank accession number JC7250).

The presence of a stop codon at position 33 in the AFP cDNA ()9 from the start codon) explains why we were not able to isolate a full-length cDNA by two-hybrid screening. A stop codon at this position interrupts the synthesis of a two-hybrid fusion protein, if the full-lenth cDNA is ligated in the library plasmid.

ABP130 ABP96 ABP64 ABP130 ABP96 ABP64

AFP AFP AFP Arylphorin Arylphorin Arylphorin

+ + – + + +

+ + – + + +

Stage-specific and tissue-specific appearance of AFP

Immuno-coprecipitation of AFP and hexamerin receptor

We tested the Sarcophaga antibody to AFP for its ability to recognize a similar protein in Calliphora by immunoblot analysis. As shown in Fig. 4, a 34-kDa protein was recognized in the anterior as well as the central, but not the posterior, part of the fat body (Fig. 4B). A clear signal was also detected in the haemocytes. The apparent molec- ular mass of the detected AFP band (34 kDa) corresponds well to that calculated from the amino-acid sequence (34.4 kDa).

Northern-blot analysis confirms the presence of strongly enriched AFP mRNA (1.2 kbp) in the anterior part of the fat body of last-instar larvae (Fig. 5B). The mRNA was also present in pupae and adults (Fig. 5A), as well as in haemocytes of last-instar larvae (Fig. 5B).

To confirm the results demonstrating the interaction of AFP with different cleavage products of the hexamerin receptor, we used immuno-coprecipitation as an indepen- dent method. AFP could be precipitated with anti-ABP IgG and the receptor (ABP) with anti-AFP IgG. As can be seen from Fig. 2, anti-AFP IgG precipitated the receptor cleavage fragment P30, whereas anti-ABP IgG precipitated AFP.

in last-instar

lobes

The results obtained by immunoblot and Northern- blot analysis were confirmed by immunofluorescence (Fig. 6A–C), in situ hybridization of cryosections (Fig. 6D), and whole-mount in situ hybridization (Fig. 6E,F). A sharp border could be detected between fluorescent cells of the anterior fat body lobe and nonfluorescent cells of the central lobe in the immunofluorescence experiment (Fig. 6A). The whole-mount in situ hybridization revealed that the AFP mRNA transcription in the fat body is almost exclusively restricted to the anterior larvae (Fig. 6E,F). Haemocytes were shown to express the AFP mRNA (Fig. 6D) and to synthesize the AFP protein (Fig. 6C).

Western blots, using an antibody that recognizes the receptor fragments ABP96, ABP64, P45 and P30, showed that the hexamerin receptor is present in all fat body fractions but not in the haemocytes (Fig. 4A).

The deduced peptide sequences of the isolated AFP cDNAs did not contain a start methionine and were lacking 40 amino acids at the N-terminus compared with the AFP of S. peregrina (GenBank accession number BAA99282). 5¢-RACE PCR led to an overlapping fragment of 288 bp. The complete 1150-bp AFP cDNA obtained (GenBank accession number AY028616) had an ORF of 921 bp starting with an ATG codon at postion 42 and ending with a TAA codon at position 962 (Fig. 3). The predicted protein is composed of 306 amino acids, with a calculated molecular mass of 34.3 kDa and a pI of 5.72. Similar searches with the deduced amino-acid sequence of full-length Calliphora AFP, tested against the SwissProt database, showed a 93% pairwise amino-acid identity and 97% positivity with

Fig. 2. Immuno-coprecipitation of AFP and the Calliphora hexamerin receptor by antibodies to ABP and AFP demonstrated by Western blotting. (A) Proteins were separated by SDS/PAGE (10% gel), transferred to membrane filters, and probed with a polyclonal anti-AFP IgG. Fat body extract from 7-day-old larva (H). Fat body proteins after immunoprecipitation with hexamerin receptor antibody (anti-ABP IgG); proteins derived from posterior fat body (pF), or anterior fat body (aF). Controls: K1 (cid:136) aF, omitting anti-ABP IgG precipitation; K2 (cid:136) aF using anti-(LexA) IgG instead of anti-AFP IgG; K3 (cid:136) buffer instead of fat body homogenate. The stained 34-kDa band represents AFP. AB (cid:136) anti-ABP or anti- LexA (K2), respectively. (B) The separated proteins were probed with a polyclonal anti-ABP IgG. aF (cid:136) proteins from anterior fat body after immunoprecipitation with anti-AFP IgG. The stained 30-kDa band represents P30. AB (cid:136) anti-AFP. Visualization of the bands was with a secondary anti-rabbit antibody coupled with alkaline phosphatase followed by NBT/BCIP colour reaction.

Isolation and sequence analysis of full-length AFP cDNA

958 I. A. Hansen et al. (Eur. J. Biochem. 269)

(cid:211) FEBS 2002

Fig. 3. Nucleic acid and deduced amino-acid sequences of the cDNA encoding Calliphora AFP. The specific primers used for RACE PCR are underlined, and the additional N-terminal sequence obtained by 5¢ RACE is enclosed in shaded boxes. Start and termina- tion codons are in bold letters, and the putative polyadenylation signal is double- underlined.

D I S C U S S I O N

control of protein biosynthesis. One of the most detailed investigations of fat body proteins has been the metab- olism of the storage protein arylphorin, which belongs to the class of hexamerins [5–9]. These proteins are synthe- sized in a stage-specific manner and reabsorbed by the fat body. Hexamerin uptake has been shown to be due to receptor-mediated endocytosis. As in all other dipteran insects investigated so far, the hexamerin receptor of C. vicina is subjected to threefold post-translational cleav- age, which succesively results in the active receptor involved in endocytosis. The last cleavage step is initiated by ecdysteroids, the hormone acting at the post-transla- tional level [7,9].

The fat body is the biochemically most active organ in insects, with multiple functions such as metabolism of proteins, carbohydrates and lipids, particularly blood sugar and haemolymph proteins, such as vitellogenins and hexamerins. The fat body corresponds functionally, at least in part, to the liver of vertebrates. Therefore, this insect organ is a highly suitable tissue for studies of the stage-specific and tissue-specific expression of genes, post- transcriptional regulation of RNA, and post-translational

Fig. 4. Tissue-specific appearance of AFP and the hexamerin receptor. (A) Extracts of anterior (aF), central (cF), posterior (pF) fat body, hae- mocytes (H) and cell-free haemolyph (s) were analyzed by SDS/PAGE (8% gel) and probed with a polyclonal anti-ABP antibody using the BCIP/ NBT colour reaction. The cleavage fragments (ABP96, ABP64, P45, P30) of the hexamerin receptor can be observed exclusively in the fat body but not in the haemocytes and haemolymph. (B) Same protein samples as in (A) probed with an anti-AFP IgG. Large amounts of the 34-kDa protein (AFP) can be detected in the anterior part of the fat body (aF); substantial less protein is found in the central (cF) fat body and no AFP in the posterior fat body (pF) and within the cell-free haemolymph (s). AFP can also be observed in the haemocytes (H).

AFP, a binding partner of the hexamerin receptor

Calliphora anterior fat body protein (Eur. J. Biochem. 269) 959

(cid:211) FEBS 2002

receptor that contain this peptide (ABP130, ABP96), whereas shorter N-terminal fragments of the receptor that do not include P30 show no interaction with AFP (Table 1). Thus, three cleavage products are possible interactors in vivo: ABP130, ABP96 and P30. However, significant interaction of AFP and peptides derived from the hexamerin receptor precursor can only take place in the anterior lobe of the fat body because of the large amounts of AFP in this tissue.

Expression of AFP in C.vicina

Fig. 5. Northern blot demonstrating the stage-specific and tissue-specific appearance of AFP mRNA. (A) Stage specificity of AFP mRNA expression. Total fat body RNA (20 lg) isolated from different developmental stages was applied to each slot. A digoxygenin-labeled antisense AFP RNA probe was used with an alkaline phosphatase- linked anti-digoxygenin IgG. Hybridization resulted in a distinct band at 1.2 kb. RNA was derived from last-instar larvae (4–7: 4–7-day-old larvae), prepupae (V), and pupae (P). Adult flies (Ad) do not show a distinct band, indicating weak expression of AFP mRNA. (B) Tissue specificity of AFP mRNA expression. Same probe as in (A). Total RNA was prepared from anterior (aF), central (cF) and posterior (pF) fat body, and haemocytes (H) of 7-day-old pupae. The 1.2-kb signal was detected in the anterior fat body and the haemocytes. A light signal only appears in the central fat body; no signal was obtained in the posterior fat body.

Looking for binding partners of the hexamerin receptor, we constructed and screened a cDNA library of C. vicina RNA from fat body by two-hybrid assays. In addition to the conversant interactors arylphorin and LSP-2, which belong to the hexamerin family, we identified AFP as a strong interactor. The two-hybrid analysis and the results of the immuno-coprecipitation revealed that AFP interacts with P30 and with all cleavage products of the hexamerin

In addition to its expression in trophocytes of the anterior fat body, AFP was found to be present in another cell type. Larval haemocytes contain substantial amounts of AFP mRNA (Fig. 5B) and AFP protein (Fig. 4B). As these cells never express the hexamerin receptor (Fig. 4A), AFP must have different functions in the two cell types. Cell-free haemolymph preparations were negative, indicating that AFP is not secreted into the haemolymph. AFP does not contain a transmembrane transport signal peptide.

Fig. 6. Immunostaining and in situ hybridization of Calliphora fat body. Longitudinal cryosections (10 lm) of 7-day-old larvae (A–C) were stained with a Cy2-conjugated goat anti-rabbit IgG after incubation with rabbit anti-AFP IgG. (A) In the border region of anterior (aF) and central fat body (cF), AFP-immunostaining appears only in the anterior fat body. (B) In a single fat body cell of the anterior fat body, AFP immunostaining is restricted to the cytoplasm. (C) AFP immunostaining can also be found in the cytoplasm of haemocytes. (D) In situ hybridization of longitudinal cryosections with a digoxygenin-labeled antisense AFP RNA probe shows no expression of AFP in muscle (m) and posterior fat body cells (pF). Haemocytes (hc) show high expression of AFP mRNA. (E,F) Whole-mount in situ hybridization of upended 7-day-old larvae. The anterior fat body exhibits strong expression of AFP mRNA, whereas only weak expression is seen in the central fat body (cF) and no expression in the posterior fat body (pF) or the brain. The white bars indicate 50 lm, and the black bars indicate 250 lm.

As in almost all experiments dealing with protein expression and sequestration, these studies were performed using the entire fat body. Here we show that AFP is exclusively expressed in the anterior pair of fat body lobes of last-instar larvae, and the median and posterior lobes appear to be free from AFP. This region-specific expression pattern also resembles that reported for S. peregrina [17]. As the anterior part of the fat body is in contact with the ring gland, the ecdysteroid-producing organ, its function may be more under endocrine control than the central and posterior parts, which are provided with hormones circulating in the haemolymph.

960 I. A. Hansen et al. (Eur. J. Biochem. 269)

(cid:211) FEBS 2002

5. Burmester, T. & Scheller, K. (1995) Ecdysterone-mediated uptake of arylphorin by larval fat bodies of Calliphora vicina: involvement and developmental regulation of arylphorin binding proteins. Insect Biochem. Mol. Biol. 25, 799–806.

6. Burmester, T. & Scheller, K. (1997) Conservation of hexamerin

endocytosis in Diptera. Eur. J. Biochem. 244, 713–720.

7. Burmester, T. & Scheller, K. (1999) Ligands and receptors: com- mon theme in insect storage protein transport. Naturwissenschaften 86, 468–474.

The possible function of AFP

8. Burmester, T. & Scheller, K. (1995) Complete cDNA-sequence of the receptor responsible for arylphorin uptake by the larval fat body of the blowfly, Calliphora vicina. Insect Biochem. Mol. Biol. 25, 981–989.

9. Burmester, T. & Scheller, K. (1997) Developmentally controlled cleavage of the Calliphora arylphorin receptor and posttransla- tional regulation by 20-hydroxy-ecdysone. Eur. J. Biochem. 247, 695–702.

10. Locke, M. & Collins, J.V. (1965) The structure and formation of protein granules in the fat body of an insect. J. Cell Biol. 26, 857–884. 11. Locke, M. & Collins, J.V. (1968) Protein uptake in multivesicular bodies and storage granules in the fat body of an insect. J. Cell Biol. 36, 453–483.

12. Wang, Z. & Haunerland, N. (1994b) Storage protein uptake in Helicoverpa zea: arylphorin and VHDL share a single receptor. Arch. Insect. Biochem. Physiol. 26, 15–26.

13. Vanishree, V., Nirmala, X. & Krishnan, M. (1999) Differential synthesis of storage proteins by various fat body tissues during development of female silkworm, Bombyx mori. SAAS Bull.: Biochem. Biotechnol. 12, 69–89.

14. Ritzki, T.M. (1978) Fat body. In The Genetics and Biology of Drosophila (Ashburner, A. & Wright, T.R.F., eds), Vol 2b, pp. 561–601. Academic Press, New York.

15. Du¨ bendorfer, A. & Eichenberger, S. (1985) In vitro metamorphosis of insect cells and tissues: development and function of fat body cells in embryonic cell cultures of Drosophila. In Metamorphosis (Balls, M. & Bownes, M., eds), pp. 146–161. Oxford University Press, Oxford.

Nothing is known about the function of AFP to date. Its amino-acid sequence contains no conversant domains that suggest a function. In contrast with the mammalian liver protein, regucalcin, which is assumed to be derived from a common ancestral gene, AFP has been shown to have no calcium-binding activity in S. peregrina [17] and is upregu- lated in adult D. melanogaster reared at low temperatures [22].

The interaction of AFP and the hexamerin receptor, shown in this paper, gives a first clue to a possible function of this protein. From our data, we conclude that it may be involved in endocytosis of hexamerin by interacting with the receptor. As mentioned above, this molecular interaction can only occur in the anterior fat body, a tissue known to contain fewer protein storage granules, particularly fewer hexamerin storage particles (R. Marx, personal communication), than the central and posterior parts [16] and which rapidly disintegrates shortly after pupariation [17]. We speculate that, because of the interaction with AFP, most of the hexamerin receptor is inactivated in the anterior fat body preventing uptake of storage protein in this part of the tissue. This study opens the way to further experiments in two distinct areas. On the one hand, the binding domains of AFP and the hexamerin receptor could be mapped in detail by functional dissection using truncated prey proteins in two-hybrid experiments. On the other hand, the use of antibodies against AFP in in vitro and in vivo experiments investigating hexamerin uptake by the anterior fat body may give insights into the nature of the interactions described above. Such approaches could lead to a better understanding of the regulation of endocytotic uptake in the insect fat body and beyond. It is possible that hexamerin endocytosis in insects does not follow the standard scheme of eukaryotic endocytosis.

A C K N O W L E D G E M E N T S

16. Butterworth, F.M. & Rasch, E.M. (1986) Adipose tissue of Drosophila melanogaster. VII. Distribution of nuclear DNA amount along the anterior-posterior axis in the larval fat body. J. Exp. Zool. 239, 77–85.

17. Nakajima, Y. & Natori, S. (2000) Identification and character- ization of an anterior fat body protein in an insect. J. Biochem. 127, 901–908.

This work was supported by a grant from the Deutsche Forschungs- gemeinschaft (Sche 195/13). We are indebted to Dr Nakajima for the gift of antibodies against AFP. We thank Anneliese Striewe-Conz and Dieter Dudaczek for competent technical assistance.

18. Scheller, K. & Karlson, P. (1977) Effects of ecdysteroids on RNA synthesis of fat body cells in Calliphora vicina. J. Insect Physiol. 23, 285–291.

R E F E R E N C E S

1. Telfer, W.H. & Kunkel, J.G. (1991) The function and evolution of

19. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seid- man, J.G., Smith, J.A. & Struhl, K. (1998) Current Protocols in Molecular Biology. John Wiley & Sons, NewYork.

insect storage hexamers. Annu. Rev. Entomol. 36, 205–228.

20. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

2. Duhamel, R.C. & Kunkel, J.G. (1987) Moulting-cycle regulation of haemolymph protein clearance in cockroaches: possible size- dependent mechanism. J. Insect Physiol. 33, 155–158.

21. Harland, R.M. (1991) In situ hybridization: an improved whole- mount method for Xenopus embryos. Methods Cell Biol. 36, 685–695.

3. Pan, M.I. & Telfer, W.H. (1992) Selectivity in storage hexamerin clearing demonstrated with hemolymph transfusions between Hyalophora cecropia and Actias luna. Arch. Insect Biochem. Physiol. 19, 203–219.

22. Goto, S.G. (2000) Expression of Drosophila homologue of senes- cence marker protein-30 during cold acclimation. J. Insect Physiol. 46, 1111–1120.

4. Wang, Z. & Haunerland, N. (1994a) Receptor-mediated endo- cytosis of storage proteins by the fat body of Helicoverpa zea. Cell Tissue Res. 278, 107–115.