BioMed Central
Virology Journal
Open Access
Research Persistent expression of chemokine and chemokine receptor RNAs at primary and latent sites of herpes simplex virus 1 infection W James Cook1,2, Martha F Kramer3,4, Russell M Walker1, Timothy J Burwell1, Holly A Holman4, Donald M Coen3 and David M Knipe*4
Address: 1Millennium Pharmaceuticals Inc., Cambridge, MA 02139, USA, 2GlycoFi, Inc., 21 Lafayette Street, Suite 200, Lebanon, NH 03766, USA, 3Department of Biological Chemistry and Molecular Pharmacology Harvard Medical School, Boston, MA 02115, USA and 4Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, MA 02115, USA
Email: W James Cook - JCook@glycofi.com; Martha F Kramer - martha_kramer@hms.harvard.edu; Russell M Walker - Walker@mpi.com; Timothy J Burwell - Burwell@mpi.com; Holly A Holman - holmanholly@yahoo.com; Donald M Coen - don_coen@hms.harvard.edu; David M Knipe* - david_knipe@hms.harvard.edu * Corresponding author
Published: 23 September 2004
Received: 25 May 2004 Accepted: 28 May 2004
Virology Journal 2004, 1:5
doi:10.1186/1743-422X-1-5
This article is available from: http://www.virologyj.com/content/1/1/5
© 2004 Cook et al; licensee BioMed Central Ltd. This is an open-access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract Inflammatory cytokines and infiltrating T cells are readily detected in herpes simplex virus (HSV) infected mouse cornea and trigeminal ganglia (TG) during the acute phase of infection, and certain cytokines continue to be expressed at lower levels in infected TG during the subsequent latent phase. Recent results have shown that HSV infection activates Toll-like receptor signaling. Thus, we hypothesized that chemokines may be broadly expressed at both primary sites and latent sites of HSV infection for prolonged periods of time. Real-time reverse transcriptase-polymrease chain reaction (RT-PCR) to quantify expression levels of transcripts encoding chemokines and their receptors in cornea and TG following corneal infection. RNAs encoding the inflammatory-type chemokine receptors CCR1, CCR2, CCR5, and CXCR3, which are highly expressed on activated T cells, macrophages and most immature dendritic cells (DC), and the more broadly expressed CCR7, were highly expressed and strongly induced in infected cornea and TG at 3 and 10 days postinfection (dpi). Elevated levels of these RNAs persisted in both cornea and TG during the latent phase at 30 dpi. RNAs for the broadly expressed CXCR4 receptor was induced at 30 dpi but less so at 3 and 10 dpi in both cornea and TG. Transcripts for CCR3 and CCR6, receptors that are not highly expressed on activated T cells or macrophages, also appeared to be induced during acute and latent phases; however, their very low expression levels were near the limit of our detection. RNAs encoding the CCR1 and CCR5 chemokine ligands MIP-1α, MIP-1β and RANTES, and the CCR2 ligand MCP-1 were also strongly induced and persisted in cornea and TG during the latent phase. These and other recent results argue that HSV antigens or DNA can stimulate expression of chemokines, perhaps through activation of Toll-like receptors, for long periods of time at both primary and latent sites of HSV infection. These chemokines recruit activated T cells and other immune cells, including DC, that express chemokine receptors to primary and secondary sites of infection. Prolonged activation of chemokine expression could provide mechanistic explanations for certain aspects of HSV biology and pathogenesis.
Page 1 of 12 (page number not for citation purposes)
Virology Journal 2004, 1:5
http://www.virologyj.com/content/1/1/5
on Langerhans-like (CD34+) DC that migrate to skin, but not on monocyte-derived DC that migrate to non-skin tis- sues (reviewed in [14]. Acute viral infection in the mouse corneal model system is known to induce the expression of cytokines and chemokines in corneal tissue. Thomas et al. [16] observed the induction of transcripts encoding N51/KC, macrophage inflammatory protein-1 β (MIP- 1β), MIP-2 and monocyte chemotactic protein 1 (MCP-1) and the cytokines IL-1, IL-6, IL-12, and TNF-α. Similarly, Tumpey et al. [17] showed induction of MIP-2, MIP-1α, and MCP-1 chemokines in the cornea during acute infec- tion. Infection of mouse fibroblast cells by HSV induces expression of IL-6 [18], and infection of macrophages by HSV induces RANTES expression directly [19]. Infection of other cell types may induce expression of other cytokines and chemokines. Less is known about chemok- ine expression during HSV latent infection phase. Halford et al. [10] observed RANTES RNA expression, in addition to RNAs for IL-2, TNF-α, IFN-γ, and IL-10, during latent infection.
Introduction Acute viral infections are usually cleared from the primary site of infection by the host immune response [1], but some viruses can persist at other sites in a latent form. Herpes simplex virus (HSV), for example, causes a pri- mary infection at a mucosal site, which is cleared within 7–10 days by the host immune response. HSV, neverthe- less, enters sensory neurons and establishes a latent infec- tion within those cells. In a mouse corneal model of HSV- 1 infection, infectious virus is detected in corneal secre- tions and tissue for approximately 7 days [2]. Similarly, infectious virus is detected in trigeminal ganglion (TG) tis- sue for up to approximately 10 days [2]. Latent infection is established by 30 days postinfection (dpi) because no infectious virus can be detected in homogenates of TG tis- sue at that time. HSV DNA, however, is readily detected in latently infected TG for at least 150 dpi [3-5]. Viral gene expression is greatly attenuated during latent infection because the only abundant viral gene product detected is the latency-associated transcript or LAT [6]. Nevertheless, low levels of lytic transcripts can be detected in ganglia latently infected with HSV [5]. Evidence of viral protein expression is provided by the continued T cell infiltration [7,8], elevated levels of interferon γ (IFN-γ) and TNF-α transcripts and numbers of IL-6 expressing cells in the ganglia, [3,9-11]. Expression of IFN-γ and TNF-α tran- scripts persists in TG latently infected with HSV strains unable to replicate in neurons, indicating that neither HSV replication nor ability to reactivate are required for persistent cytokine gene expression [3]. While CD4+ T cells appear to be important in immunized mice for pro- tection against challenge virus infection [12], CD8+ T cells appear to be important for establishment of latent infec- tion in mice [7]; and CD8+ T cells specific for HSV persist in TG for long periods of time [8]. Thus, there is evidence for long-term immune surveillance in the ganglion during latent infection by HSV.
Recent studies have shown that HSV infection activates Toll-like signaling and chemokine synthesis [20,21]. Thus, we hypothesized that HSV infection might induce prolonged expression of a broad range of chemokines at sites of acute and latent infection. Real-time quantitative RT-PCR methods have facilitated studies of immune cell RNA expression in mouse models [22,23]. We report here the use of real-time RT-PCR to monitor RNA expression of selected chemokine receptors and their chemokine lig- ands during HSV infection of mouse corneal and TG tis- sue. Our data show that RNA encoding inflammatory- type chemokine receptors and their ligands persists in infected corneas and TG long after infectious virus can be detected, suggesting prolonged chemokine production and subsequent homing of inflammatory immune cells to these tissues. Strikingly, the data demonstrate the persist- ent expression of chemokines and chemokine receptor genes in the apparent absence of detectable viral produc- tive infection transcripts in infected corneas.
Results Development of TaqMan® RT-PCR assays to measure viral and host gene expression during acute and latent infection To monitor RNA expression of viral and host genes during HSV infection of mice, we developed TaqMan® RT-PCR assays for the quantification of transcripts from the HSV tk and ICP0 genes and from mouse genes encoding selected chemokine receptors and their ligands. In the real-time PCR assay detailed in Materials and Methods, RNA iso- lated from corneal and ganglionic tissue was used for syn- thesis of cDNA. Primers and Taqman® probes for the viral or cellular genes (Table 2) were used in real-time PCR assays to measure the concentration of cDNA for each transcript.
Chemokines are critical for recruiting inflammatory cells to infected tissues. Chemokine specificity is due in large part to the cell-specific expression of their respective receptors (reviewed in [13-15]. Inflammatory-type recep- tors including CCR1, CCR2, CCR5, and CXCR3 are expressed by activated T cells, macrophages, natural killer (NK) cells, and immature (i.e. potent for antigen capture but not antigen presentation) dendritic cells (DC), while homostatic-type receptors including CCR7 and CXCR4 are highly expressed by resting T and B cells and mature (i.e., antigen-presenting) DC (Table 1). In addition, recep- tors including CCR2, CCR5 and CXCR3 are expressed on cells (e.g. Th1 cells) specific for infection-induced inflam- mation, while others including CCR3 and CXCR4 are on cells (e.g., Th2 T cells) associated with allergic inflamma- tion. Certain receptors are expressed by specific subsets of a given cell type. For example, CCR6 is highly expressed
Page 2 of 12 (page number not for citation purposes)
Virology Journal 2004, 1:5
http://www.virologyj.com/content/1/1/5
Table 1: Expression of Chemokine Receptors, Chemokines and Cytokines in Leukocyte Populations
Cell type expression Chemokine ligand Proposed primary function(s) Chemokine receptors
CCR1 T cells, macrophages, immature dendritic cells (DC), natural killer cells (NK) RANTES; MIP-1α; MCP-3, and 4; HCC-1, 2, and 4
CCR2 MCP-1, 3, and 4 T cells, natural killer cells (NK), macrophages, immature DC
CCR3 eosinophils, basophils, T cells Migration of DC to sites of inflammation Recruitment of T cells, macrophages and NK Migration of effector T cells (Th1) Migration of DC progenitors to sites of inflammation Recruitment of eosinophils
CCR5 eotaxin-1 and 2; RANTES; MCP-2, 3, and 4; HCC-2 RANTES; MIP-1α and 1β T cells (Th1, Tc1), macrophages, immature DC
CCR6 MIP-3α Migration of effector T cells (Th1) Migration of DC to sites of inflammation Recruitment of macrophages Migration of DC to skin
CCR7 immature DC (CD34+/Langerhans-like), T cells T cells, B cells, mature DC SLC, ELC
CXCR3 CXCR4 IP-10, MIG, ITAC SDF-1 Migration of naïve T cells to lymph nodes Migration of memory T cells to lymphoid tissue Migration of B cells Migration of DC to lymphoid tissues Migration of effector T cells (Th1) Migration of effector T cells (Th2) T cells (Th1, Tc1) T cells, macrophages, DC, B cells, others including neurons
Migration of B cells Migration of hematopoietic progenitors Chemokines Receptor
MIP-1α T cells, NK, macrophages, others CCR1, CCR5
MIP-1β T cells, NK, macrophages, others CCR5, CCR1 (weak)
RANTES MCP-1 T cells, NK macrophages, others CCR1, CCR5, CCR3 (weak) CCR2
epithelial cells, NK, macrophages, others Chemoattract macrophages, T cells, NK, and others Chemoattract macrophages, T cells, and others Chemoattract T cells and others Chemoattract macrophages, T cells, NK, and others Chemoattract eosinophils Eotaxin-1 Cytokines CCR3 Receptor
Using 2-fold dilutions of uninfected mouse TG cDNA, we observed that the primer/probe sets for host genes listed in Table 2 including GAPDH gave linear amplification curves over at least 3 and up to 7 dilutions. In all cases, CT values changed by about 1 cycle for every 2-fold change in template concentration as expected (not shown). Thus our assays matched well with previously described TaqMan® assays [22-24] for linearity and sensitivity.
Following corneal inoculation of mice with HSV or virus diluent (mock), we collected corneas and TG during acute (3 and 10 dpi) and latent (30 dpi) phases. To monitor viral gene expression in infected mice, we tested tissue
To characterize the range over which the HSV tk and ICP0 real-time PCR assays were accurate and linear, we tested 10-fold dilutions of purified HSV genomic DNA (kind gift of Jean Pesola) starting from 5.5 × 104 copies for tk and ICP0 gene levels. The HSV tk and ICP0 primer/probe sets gave linear amplification curves over 4 logs of template concentrations until the limit of detection within the lin- ear range was reached at 55 DNA copies for tk and 550 copies for ICP0 (not shown). At these limits of detection, the threshold cycle (CT) value, which indicated the PCR cycle at which a significant increase in amplification was first detected, was 39.2 for tk at 55 DNA copies and 36.5 for ICP0 at 550 DNA copies.
Page 3 of 12 (page number not for citation purposes)
IFN-γ TNF-α T cells, NK macrophages, NK, others IFN-γR TNF-R Activation of antiviral response Broad activation of antiviral and inflammatory response
Virology Journal 2004, 1:5
http://www.virologyj.com/content/1/1/5
Table 2: Primer and Probe Sequences
CGAGACAATCGCGAACATCTAC CTGCGCTGCGACACCTT
CCCCGGCCGATATCTCA CAATTGCATCCAGGTTTTCATG
CCACACAACACCGCCTCGACCA TGCATGCACCGCTTCTGCATCC
CAGCCATTTTGCCAGTGGTA
GGGTGAACGGTTCTGGAAGTAC ATGAGTAACTGTGTGATTGACAAGCA GCAGCAGTGTGTCATTCCAAGA ACCAGCTGTGAGCAGAGTAAACAT ACTGCTGCCTAAACCCTGTCA TTGGTGCAGGCCCAGAAC CTGCTACCTCATTATCATCCGTACCT TGTAGTTGGGCTAGCTCGAACTT CTCCAAGGGCCACCAGAA
CACAGCAGTGGGTGTAGGCA GTTTTCGGAAGAACACTGAGAGATAA GAACACGAGAACCACAGCGAT TGATCACCTTGATGGCCTTGT ACCTGGATATATGCTGAGCTGTCA GGCAAAGAAAGCTAGGATGAGG
ACATGCCTTTGAAACAGCTGCCGAA CTCTGTCACCTGCATGGCCTGGTCT CACCTCAGTCACCTGCATGGCCA TCCGGAACTTCTCTCCAACAAAGGCA CCAAGAGGCACAGAGCCATCCGA CTCCAGGCACGCAACTTTGAGCG GCATCCTGGCAGCAAAGTTACGGG CGCAAGGCCCTCAAGACGACAGTC
AGCCTTTGCTCCCAGCCAGGTGTC CTCTGACCCTCCCACTTCCTGCTGTTT ATCCCCTACTCCCACTCCGGTCCTG
TCATCGTTGACTATTTTGAAACCAG AGGGTTCTCAGCACCAATGG CTGTCATCGCTTGCTCTAGTCCTA GCTGGGTTCAGTTTCCTTAAGC CCTAAGACGTGCTCTGAGGGAAT
GCCGGTTTCTCTTAGTCAGGAA GCTGCCGGGAGGTGTAAGA CGGATGGAGATGCCGATTT CCTAGTCTTTAGCTGTGAGACCTTCTG AGGCCTCGCTGCTCCACATCCA TCCCATCTGGAACTACATGAAGC
TCAGCACCAGTCGCCCAAGGACT
TGAGTATTGCCAAGTTTGAGGTCA ACAAGGCTGCCCCGACTAC
GTGGACCACTCGGATGAGCT CGCAGAGAGGAGGTTGACTT
CCACAGGTCCAGCGCCAAGCA CCTCACCCACACCGTCAGCCG
Forward Primer Reverse Primer Probe*
HSV tk ICP0 Chemokine receptor CCR1 CCR2 CCR3 CCR5 CCR6 CCR7 CXCR3 CXCR4 Chemokine MIP-1α MIP-1β RANTES MCP-1 Eotaxin-1 Cytokine IFN-γ TNF-α
assay for tk transcripts is at least 50-fold less sensitive than that used by Kramer and Coen [5].
samples for tk and ICP0 gene transcripts. In infected cor- neal tissue, HSV tk and ICP0 transcripts were readily detected at 3, but not at 10 or 30 dpi where CT values = 40 (indicating no measurable RNA) (Fig. 1). Thus we could not detect lytic transcripts in infected corneas beyond the acute phase using this assay.
ICP0 RNA levels were similar to tk in that they peaked at 3 dpi in cornea and TG (Fig. 1B). However, because our ICP0 probe/primer set overlaps latency-associated tran- script minor (LAT) – coding sequences, the signal detected at 10 and 30 dpi in TG but not cornea may be due to minor LAT read-through RNAs. RT-PCR analysis of LAT transcripts from the TGs at 30 dpi was consistent with latent virus in infected TG (unpublished results).
ligand eotaxin-1, CCR6 which
* all probes FAM-5' and 3'-TAMRA
Chemokine and chemokine receptor expression in infected cornea and ganglia We next used TaqMan® RT-PCR to monitor expression of a selected series of mostly T cell and macrophage-specific chemokine receptors and chemokines in mock and HSV- infected cornea and TG. We chose chemokine receptors CCR1, CCR2, CCR5, and CXCR3, which are expressed by activated T cells, macrophages, NK cells, and immature DC that would be part of the immune infiltration in response to HSV infection, and their ligands MIP-1α, MIP- 1β, RANTES, and MCP-1. For comparison, we included CCR3 which is primarily expressed on granulocytes, the CCR3 is primarily expressed on resting T cells and immature Langerhans-like (i.e., skin homing) DCs, CCR7 which is primarily
In infected TG, tk RNA peaked at 3 dpi then dropped pre- cipitously (200-fold) to low but readily detectable levels by 10 dpi. At 30 dpi, we detected very low or undetectable tk RNA expression in infected TG. In the experiment shown in Fig. 1A, we measured a CT value of 38.2 for tk expression in infected TG at 30 dpi, resulting in a relative expression value of 0.0002. In an independent experi- ment, we measured a CT of 38.1 for tk RNA in 30 dpi TG; however, a CT value of 40 was measured in two additional experiments (not shown). CT values for all reactions with- out RT were 40, indicating no DNA contamination. Thus, while tk expression in latent TG was at the limit of detec- tion for our assay, our ability to detect tk expression in some but not all latent TG was consistent with previous reports in which very sensitive RT-PCR assays were used to detect tk (and ICP0) gene transcripts in some but not all TG during latent infection [5,25]. In those previous reports, an assay that included a radioactive Southern blotting step subsequent to RT-PCR could detect single copies of tk nucleic acid per PCR reaction. Our present
Page 4 of 12 (page number not for citation purposes)
Virology Journal 2004, 1:5
http://www.virologyj.com/content/1/1/5
A
25.0
tk expression
20.0
i
15.0
10.0
n o s s e r p x E e v
5.0
i t a
l
e R
0.0
Mock HSV Mock HSV Mock HSV Mock HSV Mock HSV Mock HSV
3d
30d
3d
30d
10d
10d
Cornea
TG
0.0
22.1
0.0
0.1
0.0
0.0
2.1 29.4
0.0 40.0
0.0 40.0
0.0 40.0
0.0 40.0
20.5
20.1
19.5
19.6
20.4
40.0 17.0
22.3 16.8
40.0 16.9
30.4 17.0
40.0 16.0
38.2 16.2
0.0 Rel express 40.0 tk CT GAPDH CT 21.6
B
60.0
ICP0 expression
50.0
40.0
30.0
20.0
n o i s s e r p x E e v i t a l e R
10.0
0.0
Mock HSV Mock HSV Mock HSV Mock HSV Mock HSV Mock HSV
3d
30d
3d
30d
10d
10d
Cornea
TG
0.0 40.0
50.8 20.5
0.0 40.0
2.7 26.0
0.0 40.0
2.2 24.7
7.0 26.7 19.5
0.0 40.0 19.9
0.0 40.0 19.2
0.0 40.0 19.5
0.0 40.0 20.2
17.2
16.2
17.0
17.5
16.6
15.8
0.0 Rel express 40.0 ICP0 CT GAPDH CT 21.2
HSV tk and ICP0 RNA expression in mock and HSV-infected cornea and TG Figure 1 HSV tk and ICP0 RNA expression in mock and HSV-infected cornea and TG. RNA isolated from tissues harvested at 3, 10, or 30 days postinfection (d) was subjected to TaqMan RT-PCR analysis using HSV tk primers/probe (A) and HSV ICP0 primers/ probe (B) as described in Materials and Methods. Mouse GAPDH RNA was measured in multiplex reactions, and used to cal- culate relative expression using the formula Rel Exp= 2-(∆∆CT) × 1000 as described in Materials and Methods. Shown below the plots are relative expression values and the CT value measured for tk (A) and ICPO (B) in each sample. The ICP0 signal detected at 10 and 30 dpi in HSV-infected TG is likely due to LAT RNA as described in the text. Results shown are for one experiment (Experiment #1) in which the number of individual mouse tissues pooled were 10 for cornea and 6 for TG. Similar results were obtained in two additional experiments (Experiment #2 and Experiment #3), except for variation in detection of tk RNA in infected TG at 30 dpi as described in the text.
Page 5 of 12 (page number not for citation purposes)
Virology Journal 2004, 1:5
http://www.virologyj.com/content/1/1/5
expressed on resting T and B cells and mature DCs that home back to lymphoid tissues, and CXCR4 which is broadly expressed on many immune and non-immune cell types (Table 1). We also tested the chemokine-induc- ing cytokines IFN-γ and TNF-α, whose RNA and protein have previously been shown to be expressed during both acute and latent phases of HSV infection [3,9-11].
A striking finding in this analysis was the persistent expression of inflammatory cell RNAs during the latent phase of TG infection when detectable production of infectious virus has ceased. To determine if induction of these RNAs persisted past 30 dpi, we monitored expres- sion of a limited number of transcipts from in TG col- lected at 45, 62, and 90 dpi. In previous studies [3-5], HSV genomic DNA was maintained at constant levels (~104 copies per TG) for up to 150 dpi in infected TG, indicating that latent virus persists well beyond 90 dpi in this mouse model. Induction of all RNAs in our panel persisted for at least 62 dpi; furthermore, all but CCR3 and eotaxin-1 were also induced at 90 dpi (Table 4). Thus chemokine receptor and ligand expression persisted long into the latent phase in infected TG.
i. Chemokine and chemokine receptor expression in infected cornea Epithelial cells of the cornea are the initial sites of replica- tion following infection but infectious virus and viral mRNAs are not detectable past 7–10 dpi [26]. We har- vested RNA from mock and HSV-infected cornea at 3, 10, and 30 dpi, and tested for chemokine receptor and chem- okine RNA expression in parallel. As expected for tissues supporting active replication or having recently cleared virus, chemokine receptors CCR1, CCR2, CCR5, CCR7, CXCR3 and CXCR4, but not CCR3 or CCR6, were highly expressed and strongly induced (i.e., >3-fold) at 3 and 10 dpi (Fig. 2 and Table 3). Chemokines MIP-1α, MIP-1β, RANTES, and MCP-1, but not eotaxin-1, were also highly expressed and strongly induced in infected cornea at 3 and 10 dpi. IFN-γ and TNF-α were also induced in infected cornea as previously reported [16]. Surprisingly, induc- tion of all host RNAs tested persisted into latent phase at 30 dpi in infected corneas. For example, CCR1, CCR2, and CCR5 exhibited similar induction and similar or only slightly reduced expression levels at 30 dpi as compared to earlier time points. Relative expression and induction of CCR7 and CXCR4 in infected cornea appeared to be biphasic in that values were high at 3, lower at 10, and higher again at 30 dpi. These results suggested that contin- ued presentation of HSV antigens stimulates chemokine production and subsequent homing of effector cells to cornea despite the apparent clearance of infectious virus.
Discussion Recent studies have shown that HSV infection induces Toll-like signaling and chemokine synthesis. Thus, we hypothesized that HSV infection might induce a broad range of chemokines at sites of primary and latent infec- tion. In agreement with and extending previous studies [3,9-11], we have found evidence for persistent expression of chemokines and trafficking of inflammatory cells including activated T cells to acutely infected corneal tis- sue and to latently infected trigeminal ganglia. We also observed prolonged expression of chemokine and chem- okine receptor gene transcripts in corneal tissue, the primary site of HSV-1 infection in this model system, long after infectious virus has been cleared. Microarray analysis of host gene expression has also demonstrated long-term alterations of host gene expression during latent infection by HSV, including alterations in expression of CXCR6 mRNA in TG [27]. These results argue for long-term per- sistence or expression of viral antigens or immunogens and stimulation of expression of these chemokines, even at the primary site of infection, the cornea. Recent results [28] have shown similar elevated chemokine expression in lung tissue after clearance of murine gamma herpesvi- rus 68. It will be of interest to determine how widespread this effect is among different virus infections or whether it is unique to viruses that persist in the host, such as the herpesviruses.
ii. Chemokine and chemokine receptor expression in infected ganglia In infected TG, transcripts from the genes encoding recep- tors CCR1, CCR2, CCR5, CCR7, and CXCR3 were induced by HSV infection during both acute (3 and 10 dpi) and latent (30 dpi) phases (Fig. 3 and Table 3). Peak induction of these RNAs was at 10 dpi during the clearance phase. CXCR4 was induced at 10 and 30 dpi but not at 3 dpi. While we measured induction of CCR3 and CCR6 at 10 and 30 dpi, their very low expression was at the limit of our detection (i.e., relative expression values < 0.5) as also seen in corneas. RNAs for the MIP-1α, MIP-1β, RANTES, and MCP-1 chemokines were also strongly induced at each timepoint, particularly at 3 dpi. Eotaxin-1 was induced at 3 dpi, but much less so at 10 and 30 dpi. As seen previously [3] cytokines IFN-γ and TNF-α were strongly induced at 3 and 10 dpi, but much less so at 30 dpi.
Potential mechanisms for elevated expression of chemokines and chemokine receptors after viral clearance Low level expression of viral lytic transcripts in TG during latent infection has been documented [5], which could result in low level expression of viral proteins. Recent results have shown that HSV-1 can activate Toll-like recep- tor 2 to stimulate chemokine expression and secretion and to activate NF-κB regulated promoters [20]. Lund et al. [21] showed that infectious HSV-2 and also purified HSV-2 DNA activates signaling through DC-expressed Toll-like receptor 9, resulting in the induction of IFN-α
Page 6 of 12 (page number not for citation purposes)
Virology Journal 2004, 1:5
http://www.virologyj.com/content/1/1/5
A
70.0
Cornea, 3dpi
60.0
i
50.0
40.0
n o s s e r p x e
Mock HSV+
30.0
e v
i t a
l
20.0
e R
10.0
0.0
1 -
i
I
I
g g - - N N F F
I I
I
I
1 R C C
2 R C C
3 R C C
5 R C C
6 R C C
7 R C C
a a - - F F N N T T
P C M
a a 1 1 - - P P M M
b b 1 1 - - P P M M
3 R C X C
4 R C X C
S E T N A R
1 - n x a t o E
B
35.0
Cornea, 10dpi
30.0
25.0
20.0
Mock HSV+
15.0
10.0
n o i s s e r p x e e v i t a l e R
5.0
0.0
1 -
i
g g - - N N F F
I I
I I
I I
1 R C C
2 R C C
3 R C C
5 R C C
6 R C C
7 R C C
1 - n x a
a a - - F F N N T T
t
P C M
b b 1 1 - - P P M M
a a 1 1 - - P P M M
3 R C X C
4 R C X C
S E T N A R
o E
C
35.0
Cornea, 30dpi
30.0
25.0
20.0
Mock HSV+
15.0
10.0
n o i s s e r p x e e v i t a l e R
5.0
0.0
1 -
b 1 -
b 1 -
i
g g - - N N F F
I
I
I
I
I I
1 R C C
2 R C C
3 R C C
5 R C C
6 R C C
7 R C C
a a - - F F N N T T
P C M
a a 1 1 - - P P M M
P P M M
3 R C X C
4 R C X C
S E T N A R
1 - n x a t o E
Relative levels of chemokine and chemokine receptor RNA expression in mock and HSV-infected cornea Figure 2 Relative levels of chemokine and chemokine receptor RNA expression in mock and HSV-infected cornea. Corneas were har- vested at 3 (A), 10 (B), or 30 (C) days postinfection, and relative levels of expression were determined by TaqMan RT-PCR anal- ysis as described in Fig. 1 and Materials and Methods. Results shown are the average of relative expression values determined using cDNA from two independent experiments, with each cDNA subjected to 2 or 3 separate measurements. Dashed bars represent ranges of individual values. Each cDNA was synthesized from RNA isolated from pooled corneas (5 mice) as described in Fig. 1 and Materials and Methods. The induction ratios (HSV+ vs. mock) for individual genes are tabulated in Table 3.
Page 7 of 12 (page number not for citation purposes)
Virology Journal 2004, 1:5
http://www.virologyj.com/content/1/1/5
Table 3: Induction Ratio (HSV+/Mock) of Transcripts for Chemokine Receptors, Chemokines and Cytokines in Cornea and Trigeminal Ganglia (TG)
Corneaa TGb
Gene 10d 3d 10d 30d 3d 30d
CCR1 11 (9.2–12) 18 (13–23) 20 (10–26) 5 (2.2–7.1) 15 (9.0–19) 4 (1.7–7.0)
CCR2 14 (9.2–19) 22 (11–32) 14 (8.1–24) 3 (1.5–4.2) 15 (11–19) 3 (1.3–4.4)
CCR3 2 (1.0–5.0) 3 (2.0–5.0) 3 (2.5–3.3) 2 (0.5–5.0) 8 (2.2–20) 3 (1.8–4.7)
CCR5 12 (12.3–12.5) 11 (8.0–14) 20 (8.9–36) 9 (4.8–11) 57 (22–110) 9 (7.0–10)
CCR6 3 (2.4–3.0) 2 (1.0–2.5) 5 (1.5–8.5) 3 (0.3–11) 3 (1.0–5.0) 14 (1.0–40)
CCR7 24 (8.0–40) 5 (3.0–6.5) 17 (13–21) 13 (9.0–17) 19 (17–20) 7 (2.0–11)
CXCR3 10 (5.0–18) 15 (8.0–23) 5 (2.8–6.5) 2 (1.0–4.0) 104 (54–160) 36 (14–59)
CXCR4 11 (4.8–14) 3 (1.7–4.0) 45 (33–74) 0.6 (0.4–0.9) 4 (2.9–6.2) 3 (2.3–3.7)
MIP-1α 69 (33–106) 394 (263–1700) 34 (16–53) 232 (80–471) 126 (80–168) 25 (13–45)
MIP-1β 53 (39–67) 285 (261–310) 16 (11–21) 282 (10–595) 230 (202–245) 31 (24–37)
RANTES 55 (36–73) 43 (38–48) 16 (12–18) 64 (61–66) 304 (302–306) 31 (12–50)
MCP-1 54 (52–55) 64 (55–74) 12 (7.5–20) 153 (113–194) 22 (16–27) 3 (1.6–4.2)
Eotaxin-1 3 (1.9–3.5) 1 (0.6–1.3) 3 (1.0–5.4) 5 (3.3–9.1) 2 (1.2–2.8) 1.5 (0.7–2.3)
Inf. Inf. Inf. Inf. Inf. IFNγ Inf.c
a Induction ratios were calculated as relative expression in HSV-infected/relative expression in mock-infected cornea. Each value is the average of induction ratios (2 or 3 separate measurements per cDNA sample) from two independent experiments. Ranges of individual ratios are in parentheses. b Induction ratios were calculated for HSV- vs. mock-infected TG as in footnote a. Each value is the average of induction ratios (2 or 3 separate measurements per cDNA sample) from three independent experiments, with ranges in parentheses. c Inf., infinite due to relative expression = 0 in all or most mock-infected samples.
ies are also induced during latent HSV infection via Toll- like receptor dependent mechanisms. Elevated expression of chemokine receptors is likely due to the chemokine- induced trafficking of inflammatory cells to the site of infection or, in the case of 30 days postinfection or latent infection, the site of viral antigen persistence.
secretion. Toll-like receptor activation by HSV-2 DNA raises the intriguing possibility that HSV DNA alone is at least partially responsible for TLR-dependent induction of chemokine expression in latent TG. Among the transcripts that we studied, we detected persistent expression of tran- scripts for MIP-1α, MIP-1β, and RANTES, whose expres- sion is activated by Toll-like receptors [29]. Expression of MIP-1α and MIP-1β could recruit NK cells, which express CCR5, and immature dendritic cells, which express CCR1 and CCR5, into the site of infection. Thus, elevated expres- sion of at least some of the chemokines could be due to Toll-like receptor activation. It is also possible that other chemokines that were not assayed in this or previous stud-
Although we have not examined expression of IP-10, a chemokine also induced by Toll-like receptor signaling [29], we did examine the expression of transcripts for CXCR3, its receptor on activated T cells. Levels of both are elevated during latent infection in TG. Thus, stimulation of expression of this chemokine could attract activated T
Page 8 of 12 (page number not for citation purposes)
TNF-α 3 (2.9–3.0) 3 (2.6–3.8) 7 (3.9–12) Inf. Inf. Inf.
Virology Journal 2004, 1:5
http://www.virologyj.com/content/1/1/5
A
100.0
TG, 3dpi
90.0
80.0
70.0
60.0
50.0
Mock HSV+
40.0
30.0
n o i s s e r p x e e v i t a l e R
20.0
10.0
0.0
1 -
i
g g - - N N F F
I
I I
I I
I
1 R C C
2 R C C
3 R C C
5 R C C
6 R C C
7 R C C
a a - - F F N N T T
P C M
a a 1 1 - - P P M M
b b 1 1 - - P P M M
3 R C X C
4 R C X C
S E T N A R
1 - n x a t o E
B
100.0
385 (337-432)
TG, 10dpi
90.0
80.0
i
70.0
60.0
50.0
n o s s e r p x e
Mock HSV+
e v
40.0
i t a
l
30.0
e R
20.0
10.0
0.0
1 -
i
I
I
g g - - N N F F
I I
I
I
1 R C C
2 R C C
3 R C C
5 R C C
6 R C C
7 R C C
a a - - F F N N T T
P C M
a a 1 1 - - P P M M
b b 1 1 - - P P M M
3 R C X C
4 R C X C
S E T N A R
1 - n x a t o E
C
40.0
TG, 30dpi
35.0
30.0
25.0
20.0
Mock HSV+
15.0
n o i s s e r p x e e v i t a l e R
10.0
5.0
0.0
1 -
i
g - N F
g - N F
I
I
I
I I
I
7 R C C
6 R C C
5 R C C
3 R C C
2 R C C
1 R C C
1 - n x a
t
a a - - F F N N T T
P C M
b b 1 1 - - P P M M
a a 1 1 - - P P M M
4 R C X C
3 R C X C
S E T N A R
o E
Relative levels of chemokine and chemokine receptor RNA expression in mock and HSV-infected TG Figure 3 Relative levels of chemokine and chemokine receptor RNA expression in mock and HSV-infected TG. TG were harvested at 3 (A), 10 (B), or 30 (C) days postinfection, and RNA levels were determined by TaqMan RT-PCR analysis as described in Fig. 1, Fig. 2 and Materials and Methods. Results shown are the average of relative expression values determined using cDNA from three independent experiments, with each cDNA subjected to 2 or 3 separate measurements. Dashed bars represent ranges of individual values as described in Fig. 2. The induction ratios (HSV+ vs. mock) for individual genes are tabulated in Table 3.
Page 9 of 12 (page number not for citation purposes)
Virology Journal 2004, 1:5
http://www.virologyj.com/content/1/1/5
Table 4: Induction Ratio (HSV+/Mock) of Transcripts for Chemokine Receptors and Chemokines in Trigeminal Ganglia (TG) at Late Times Post-Infection
Induction Ratioa
Gene 45d 62d 90d
a Induction ratios were calculated as relative expression in HSV-infected/relative expression in mock-infected cornea as described in Table 3. Each value is the average induction ratio (2 separate measurements per cDNA sample) from one experiment. Ranges of individual ratios are in parentheses.
cells to the latently infected TG, providing a mechanism for the persistent presence of HSV-specific CD8+ T cells in latently infected TG [8].
conceivable that genital herpes infections could similarly induce the expression of chemokines in the genital mucosae and the trafficking of dendritic cells and CD4+ T cells to that site. In addition to the break in the genital epi- thelium provided by the genital lesion, the recruitment of dendritic cells and CD4+ T cells to sites of HSV infection would provide cells to transport HIV to lymph nodes and the primary host cell, respectively, and increase the poten- tial for HIV infection.
CCR2 CCR3 CCR5 CXCR3 MIP-1α Eotaxin-1 3 (3.2–3.3) 8 (5.0–12) 5 (5.1–5.7) 17 (10–24) 10 (7.0–13) 3 (1.5–3.9) 5 (1.3–8.8) 3 (1.0–4.4) 7 (4.9–9.0) 68 (25–111) 35 (4.0–67) 2 (1.1–3.1) 2 (2.2–2.4) 0.7 (0.4–1.0) 5 (2.9–6.5) 20 (11–28) 4 (1.0–7.0) 1.5 (0.8–2.3)
Implications of persistent chemokine expression Long-term inflammatory responses in neural tissue could induce pathology due to damage to neuronal cells. A number of neurological diseases have been associated with HSV infection [30], and these could be associated with these long-term inflammatory responses. In addi- tion, the possibility of other types of specific pathological effects is raised.
Implications for HSV biology and vaccine design Recent studies on the persistence of CD8+ T cells in latently infected ganglia have concluded that these cells play a role in maintaining the latent infection [8]. The results presented here raise the possibility that the pres- ence of CD8+ T cells in latently infected TG's could be the result of chemokine expression. Thus, further studies are needed to establish the causal relationship between the presence of CD8+ T cells in latently infected ganglia and maintenance of latent infection.
lesions
Role of HSV in coronary heart disease Recent data have shown an association between HSV-1 seropositivity and myocardial infarction and coronary heart disease in older adults [31]. These authors hypothe- sized that HSV-1 reactivation from autonomic nerves that innervate the coronary arteries could cause infection of endothelial cells, endothelial injury, and the initiation of an acute thrombotic event. Similarly, based on our work, HSV infection might induce expression of MCP-1 and IL- 8, which are known to cause adhesion of monocytes to vascular endothelium [32], an early step in the develop- ment of atherosclerotic in mouse models (reviewed in Gerszten et al. [32]. Therefore, the induction and prolonged expression of these chemokines by HSV infection could play a role in the pathogenesis of coronary heart disease.
Various HSV strains, including replication-defective mutants and amplicon vectors which do not establish neuronal latency efficiently, have been shown to induce durable immune responses [12,34,35]. These results sug- gest that the basis for the durable immune responses may be the persistence of antigen or continued antigen expres- sion at sites of primary infection. Further studies are needed to determine the source of this antigen and the mechanism of the induction of chemokine expression at primary and latent sites of HSV infection.
Materials and Methods Viruses, infection of mice, and tissue collection HSV-1 KOS was propagated and titered on Vero cell mon- olayers as described previously [36]. Seven-week-old
Role of HSV in HIV transmission Considerable evidence has accumulated for the role of genital herpes infections in promoting the transmission of human immunodeficiency virus (reviewed in [33]. Although we examined HSV-1 in these studies, HSV-2 shares many biological properties with HSV-1. Thus, it is
Page 10 of 12 (page number not for citation purposes)
Virology Journal 2004, 1:5
http://www.virologyj.com/content/1/1/5
or GAPDH were used (not shown). Control reactions lacking RT were used to test for the presence of contami- nating HSV or mouse DNA, and in all cases either no or low (relative to when RT was present) levels of amplification were measured (not shown). Purified HSV- 1 genomic DNA was kindly provided by Jean Pesola.
Competing interests The author(s) declare that they have no competing interests.
HSD:ICR mice (Harlan, Sprague, Dawley) were anesthe- tized and infected with 2 × 106 pfu of virus or mock infected with virus diluent via corneal scarification as described [2]. At specific days post infection (dpi), cornea and TG were collected and flash-frozen on dry ice with minimal elapsed time post sacrifice [5]. Cornea and TG from each time and treatment group were pooled prior to isolation of RNA. A total of four infections were per- formed: in Exp. #1 cornea and TG were collected at 3, 10, and 30 dpi; in Exp. #2 TG were collected at 3, 10, and 30 dpi; in Exp. #3 TG were collected at 3, 10, 45, 62, and 90 dpi; and in Exp. #4 cornea and TG were collected at 30 dpi.
Authors' Contributions W. Cook, R. Walker and T. Burwell performed the RT-PCR analyses of chemokine transcripts. M. Kramer and H. Hol- man performed the animal infections and provided tis- sues for transcript analysis. D. Coen and D. Knipe participated in the design of experiments, oversight of the conduct of the experiments, and in the interpretation of the results.
Acknowledgments This research was supported by NIH grant P01 NS35138 and a grant from Millennium Pharmaceuticals to DMC and DMK.
We thank numerous colleagues at Millennium Pharmaceuticals, particularly Laura Rudolph-Owen, Michael Donovan, and Jose-Carlos Gutierrez, and members of the Knipe and Coen laboratories. We thank Ming Chen for help with Experiment #1.
2.
3.
4.
5.
6.
7.
8.
9.
References 1. Whitton LJ, Oldstone MBA: The immune response to viruses. Fields Virology, 4th ed Edited by: Knipe D M and Howley P M. Philadel- phia, PA, Lippincott, Williams and Wilkins; 2001:285-320. Leib DA, Coen DM, Bogard CL, Hicks KA, Yager DR, Knipe DM, Tyler KL, Schaffer PA: Immediate-early regulatory gene mutants define different stages in the establishment and reactivation of herpes simplex virus latency. J Virol 1989, 63:759-768. Chen S-H, Garber DA, Schaffer PA, Knipe DM, Coen DM: Persist- ent elevated expression of cytokine transcripts in ganglia latently infected with herpes simplex virus in the absence of viral replication and reactivation. Virology 2000, 278:207-216. Kramer MF, Chen SH, Knipe DM, Coen DM: Accumulation of viral transcripts and DNA during establishment of latency by her- pes simplex virus. J Virol 1998, 72:1177-1185. Kramer MF, Coen DM: Quantification of transcripts from the ICP4 and thymidine kinase genes in mouse ganglia latently infected with herpes simplex virus. J Virol 1995, 69:1389-1399. Stevens JG, Wagner EK, Devi-Rao GB, Cook ML, Feldman LT: RNA complementary to a herpesvirus alpha gene mRNA is prom- inent in latently infected neurons. Science 1987, 235:1056-1059. Liu T, Khanna KM, Chen XP, Fink DJ, Hendricks RL: CD8+ T cells can block herpes simplex virus type 1 (HSV-1) reactivation from latency in sensory neurons. Journal of Experimental Medicine 2000, 191:1459-1466. Khanna KM, Bonneau RH, Kinchington PR, Hendricks RL: Herpes simplex virus-specific memory CD8(+) T cells are selectively activated and retained in latently infected sensory ganglia. Immunity 2003, 18:593-603. Cantin EM, Hinton DR, Chen J, Opehshaw H: Gamma interferon expression during acute and latent nervous system infection by herpes simplex virus type 1. J Virol 1995, 69:4898-4905. 10. Halford WP, Gebhardt BM, Carr DJJ: Persistent cytokine expres- sion in trigeminal ganglion latently infected with herpes sim- plex virus type 1. J Immunol 1996, 157:3542-3549.
Preparation of RNA and cDNA, and real-time quantitative RT-PCR Total RNA was purified from tissues using RNA STAT-60 (Tel-Test, Friendswood, TX), followed by secondary puri- fication and DNAse I treatment using RNeasy columns (Qiagen). cDNA was synthesized using the Omniscript Reverse Transcriptase Kit (Qiagen) for Exp. #1 or TaqMan® Reverse Transcription Reagents (Perkin Elmer) for Exps. #2, #3, and #4 following the manufacturers' suggested protocols. Design of the PCR primers and TaqMan® probes for mouse chemokine and chemokine receptors was done using Primer Express (Applied Biosystems) soft- ware. Primer and probe sequences are listed in Table 2. Primers and the VIC-labeled TaqMan® probes for the housekeeping control genes rodent GAPDH and 18S rRNA were purchased from Applied Biosystems. Real-time quantitative RT-PCR assays were performed with reagents recommended by the manufacturer (Applied Biosystems) using an ABI PRISM 7700 Sequence Detection System instrument. Briefly, 0.5 µL (approximately 300 pg) of cDNA was added to 25µL reactions containing 12.5 µL of PCR Universal Mix (Applied Biosystems), 600 nM F primer, 600 nM R primer, 200 nM FAM-labeled TaqMan probe, 200 nM rodent GAPDH F primer, 200 nM rodent GAPDH R primer, and 100 nM rodent GAPDH TaqMan® probe. The number of PCR cycles needed for FAM or VIC fluorescence to cross a threshold where a statistically sig- nificant increase in change in fluorescence (CT=threshold cycle) was measured using Applied Biosystems software. Relative RNA expression was determined using the for- mula Rel Exp= 2-(∆∆Ct) × 1000 where ∆∆ CT= (CT gene of interest-CT rodent GAPDH in experimental sample)-(CT gene of interest-CT rodent GAPDH in a no-template con- trol sample) (the ∆∆ CT method, Taqman® Bulletin #2: Relative Quantitation of Gene Expression, Applied Biosys- tems, updated 2001, http://docs.appliedbiosystems.com/ pebiodocs/04303859.pdf). To assure that GAPDH RNA levels were not affected by HSV infection and thus a good control, we repeated most analyses using 18S rRNA as an internal control. In all cases tested, induction measure- ments (HSV+/mock) were indistinguishable whether 18S
Page 11 of 12 (page number not for citation purposes)
Virology Journal 2004, 1:5
http://www.virologyj.com/content/1/1/5
11.
Shimeld C, Whiteland JL, Williams NA, Easty DL, Hill TJ: Cytokine production in the nervous system of mice during acute and latent infection with herpes simplex virus type 1. Journal of General Virology 1997, 78:3317-3325.
12. Morrison LA, Knipe DM: Mechanisms of immunization with a replication-defective mutant of herpes simplex virus 1. Virol- ogy 1996, 220:402-413.
32. Gerszten RE, Garcia-Zepeda EA, Lim YC, Yoshida M, Ding HA, Gim- brone M. A. Jr, Luster AD, Luscinskas FW, Rosenzweig A: MCP-1 and IL-8 trigger firm adhesion of monocytes to vascular endothelium under flow conditions. Nature 1999, 398:718-723. 33. Wald A, Link K: Risk of human immunodeficiency virus infec- tion in herpes simplex virus type 2-seropositive persons: a meta-analysis. J Infect Dis 2002, 185:45-52.
34. Brockman M, Knipe DM: Herpes simplex virus vectors elicit a durable antibody response in mice despite the presence of preexisting host immunity. J Virol 2002, 76:3678-3687.
14.
15.
immune responses.
13. Murphy CG, Lucas WT, Means R, Czajak S, Hale CL, Lifson JD, Kauer A, Johnson RP, Knipe DM, Desrosiers RC: Vaccine protection against simian immunodeficiency virus by recombinant strains of herpes simplex virus. J Virol 2000, 74:7745-7753. Sozzani S, Allavena P, Vecchi A, Mantovani A: The role of chemok- ines in the regulation of dendritic cell trafficking. J Leukoc Biol 1999, 66:1-9. von Andrian UH, MacKay CR: T-cell function and migration. N Engl J Med 2000, 343:1020-1034.
35. Hocknell PK, Wiley RD, Wang X, Evans TG, Bowers WJ, Hanke T, Federoff HJ, Dewhurst S: Expression of human immunodefi- ciency virus type 1 gp120 from herpes simplex virus type 1- derived amplicons results in potent, specific, and durable cel- lular and humoral J Virol 2002, 76:5565-5580.
36. Coen DM, Fleming H.E.,Jr., Leslie LK, Retondo MJ: Sensitivity of arabinosyladenine-resistant mutants of herpes simplex virus to other antiviral drugs and mapping of drug hypersensitivity mutations to the DNA polymerase locus. J Virol 1985, 53:477-488.
16. Thomas J, Kanangat S, Rouse BT: Herpes simplex virus replica- tion-induced expression of chemokines and proinflamma- tory cytokines in the eye: implications in herpetic stromal keratitis. Journal of Interferon & Cytokine Research 1998, 18:681-690. 17. Tumpey TM, Cheng H, Yan XT, Oakes JE, Lausch RN: Chemokine synthesis in the HSV-1-infected cornea and its suppression by interleukin-10. J Leukoc Biol 1998, 63:486-492.
18. Kanangat S, Babu JS, Knipe DM, Rouse BT: HSV-1 mediated mod- ulation of cytokine gene expression in a permissive cell line: Selective up-regulation of IL6 gene expression. Virology 1996, 219:295-300.
21.
19. Melchjorsen J, Pedersen FS, Mogensen SC, Paludan SR: Herpes sim- plex virus selectively induces expression of the CC chemok- ine RANTES/CCL5 in macrophages through a mechanism dependent on PKR and ICP0. J Virol 2002, 76:2780-2788. 20. Kurt-Jones E, Mandell L, Cerny A, Chan M, Zhou S, Reed G, Bronson R, Arnold MM, Knipe DM, Finberg RW: Neonatal herpes simplex infection: Herpes simplex virus 1 interaction with TLR2 con- tributes to lethal encephalitis. PNAS 2004, 101:1315-1320. Lund J, Sato A, Akira S, Medzhitov R, Iwasaki A: Toll-like receptor 9-mediated recognition of Herpes simplex virus-2 by plasma- cytoid dendritic cells. J Exp Med 2003, 198:513-520.
22. Hempel DM, Smith KA, Claussen KA, Perricone MA: Analysis of cellular immune responses in the peripheral blood of mice using real-time RT-PCR. J Immun Methods 2002, 259:129-138.
23. Overbergh L, Valckx D, Waer M, Mathieu C: Quantification of murine cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine 1999, 11:305-312.
24. Wen SF, Xie L, McDonald M, Digiacomo R, Chang A, Gurnani M, Shi B, Liu S, Indelicato SR, Hutchins B, Nielsen L: Development and validation of sensitive assays to quantitate gene expression after p53 gene therapy and paclitaxel chemotherapy using in vivo dosing in tumor xenograft models. Cancer Gene Therapy 2000, 7:1469-1480.
25. Chen S-H, Lee LY, Garber DA, Schaffer PA, Knipe DM, Coen DM: Neither LAT nor open reading frame P mutations increase expression of spliced or intron-containing ICP0 transcripts in mouse ganglia latently infected with herpes simplex virus. J Virol 2002, 76:4764-4772.
26. Babu JS, Thomas J, Kanangat D, Morrison LA, Knipe DM, Rouse BT: Viral replication is required for induction of ocular immun- opathology by herpes simplex virus. J Virol 1996, 70:101-107.
27. Kramer MF, Cook WJ, Roth FR, Zhu J, Holman H, Knipe DM, Coen DM: Latent herpes virus infection of sensory neurons alters neuronal gene expression. J Virol 2003, 77:9533-9541.
Publish with BioMed Central and every scientist can read your work free of charge
29.
"BioMed Central will be the most significant development for disseminating the results of biomedical researc h in our lifetime."
28. Weinberg JB, Lutzke ML, Efstathiou S, Kunkel SL, Rochford R: Ele- vated chemokine responses are maintained in lungs after clearance of viral infection. J Virol 2002, 76:10518-10523. Luster AD: The role of chemokines in linking innate and adap- tive immunity. Curr Opin Immunol 2002, 14:129-135.
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
31.
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours — you keep the copyright
30. Whitley RJ: Herpes Simplex Viruses. Fields Virology, 4th ed Edited by: Knipe D M and Howley P M. Philadelphia, PA, Lippincott, Williams and Wilkins; 2001:2461-2509. Siscovick DS, Schwartz SM, Corey L, Grayston JT, Ashley R, Wang SP, Psaty BM, Tracy RP, Kuller LH, Kronmal RA: Chlamydia pneumo- niae, herpes simplex virus type 1, and cytomegalovirus and incident myocardial infarction and coronary heart disease death in older adults : The Cardiovascular Health Study. Cir- culation 2000, 102:2335-2340.
BioMedcentral
Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp
Page 12 of 12 (page number not for citation purposes)