Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3

Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 Hui-Jun Wu1,*, Yang Yang1,*, Shuai Wang2,*, Jun-Qing Qiao1, Yan-Fei Xia1, Yu Wang1, Wei-Duo Wang1, Sheng-Feng Gao1, Jun Liu1, Peng-Qi Xue1 and Xue-Wen Gao1

1 Department of Plant Pathology, College of Plant Protection, Nanjing Agricultural University, Key Laboratory of Monitoring and Management of Crop Diseases and Pest Insects, Ministry of Agriculture, China 2 Key Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, China

Keywords aspartate aminotransferase; Bacillus subtilis; conserved active residues; kinetic parameters; protein sequence analysis

Correspondence X.-W. Gao, Department of Plant Pathology, College of Plant Protection, Nanjing Agricultural University, Key Laboratory of Monitoring and Management of Crop Diseases and Pest Insects, Ministry of Agriculture, Nanjing 210095, China Fax: +86 25 84395268 Tel: +86 25 84395268 E-mail: gaoxw@njau.edu.cn

*These authors contributed equally to this work

In the present study, we report the identification of a new gene from the Bacillus subtilis B3 strain (aatB3), which comprises 1308 bp encoding a 436 amino acid protein with a monomer molecular weight of 49.1 kDa. Phylo- genetic analyses suggested that this enzyme is a member of the Ib subgroup of aspartate aminotransferases (AATs; EC 2.6.1.1), although it also has conserved active residues and thermostability characteristic of Ia-type AATs. The Asp232, Lys270 and Arg403 residues of AATB3 play a key role in transamination. The enzyme showed maximal activity at pH 8.0 and 45 (cid:2)C, had relatively high activity over an alkaline pH range (pH 7.0–9.0) and was stable up to 50 (cid:2)C. AATB3 catalyzed the transamination of five amino acids, with L-aspartate being the optimal substrate. The Km values were determined to be 6.7 mM for L-aspartate, 0.3 mM for a-ketoglutarate, 8.0 mM for L-glutamate and 0.6 mM for oxaloacetate. A 32-residue N-termi- nal amino acid sequence of this enzyme has 53% identity with that of Bacillus circulans AAT, although it is absent in all other AATs from differ- ent organisms. Further studies on AATB3 may confirm that it is poten- tially beneficial in basic research as well as various industrial applications.

(Received 4 December 2010, revised 20 January 2011, accepted 11 February 2011)

doi:10.1111/j.1742-4658.2011.08054.x Database The nucleotide sequence data have been deposited in the GenBank database under accession Numbers AY040867.1

Introduction

for

the malate-aspartate shuttle)

Aspartate aminotransferases (AAT; EC 2.6.1.1) cata- lyze the reversible reaction of transamination between four- and five-carbon dicarboxylic amino acids and the corresponding a-keto-acids by a ping-pong, bi-bi mechanism, with pyridoxal 5¢-phosphate (PLP) as an essential cofactor [1]. The enzyme plays a key role in the metabolic regulation of carbon and nitrogen metabolism in all organisms [2]. In eukaryotes, AAT along with malate dehydrogenase comprise a system

transporting (i.e. reducing equivalents across organellar membranes [3]. In prokaryotes, AAT represents a central enzyme in metabolism of the Krebs citric acid cycle intermedi- ates. For example, AAT converts newly-formed organic nitrogen to the nitrogen carriers, Glu and Asp, and the formation of Asp is used to generate several essential amino acids such as Asn, Met, Thr, Lys and Ile. AATs regenerate the carbon skeletons

FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS

1345

Abbreviations AAT, aspartate aminotransferase; PLP, pyridoxal 5¢-phosphate.

H.-J. Wu et al. Identification of a new aspartate aminotransferase

(a-ketoglutarate) for further primary nitrogen assimi- lation [4].

In Bacillus spp., AAT plays a very important role in the Krebs cycle, which synthesizes aspartate from oxaloacetate and is also involved in the synthesis of several essential amino acids [21]. AATs have been iso- lated and characterized from several Bacillus spp. In B. subtilis 168, the AAT is encoded by the aspB gene, which appears to be constitutively expressed [22]. However, there are four other putative AATs in B. sub- tilis 168 based on whole genome analysis. The AAT from alkalophilic Bacillus circulans contains an addi- tional N-terminal sequence of 32 amino acid residues, which functions to stabilize the structure over a wide pH range and to prevent aromatic fluorophores from quenching by water [23]. A preliminary X-ray structure of the AAT from Bacillus sp. YM-2 has been obtained [7]. More recently, aminotransferases were divided into six subgroups and classified from B. subtilis as members of the If subgroup instead of the Ia subgroup [24]. However, the generally accepted view is that AAT from B. subtilis is a member of the Ib subgroup.

AATs from many species have been classified into the aminotransferase family I and then divided into two subgroups, Ia and Ib, on the basis of their amino acid sequences [5,6]. The Ia subgroup contains AATs from eubacteria and eukaryotes, such as Escherichia coli, yeast, chickens and pigs, whereas Ib includes those from thermophilic eubacteria and thermoacido- philic archaebacteria, such as Thermus thermophilus HB8 [6], Bacillus sp. YM-2 [7] and Rhizobium meliloti [8]. More recently, a novel prokaryote-type AAT was identified in plants belonging to the Ib subfamily in eukaryotic organisms [2,9]. The amino acid sequence identities between subgroups Ia and Ib are only (cid:2) 15%. Up until now, the most extensively investi- gated AATs, with studies reported on their structure as well as their function, are those from subgroup Ia, whereas much less is known about AATs from sub- group Ib. Recently, the 3D structures of the subgroup Ib AATs from T. thermophilus, Phormidium lapideum and Thermotoga maritima were solved, showing that the structures of the enzymes in subgroups Ia and Ib are very similar [10–12] and that the active site residues are well-conserved [6].

In the present study, a new gene aatB3 (accession number AY040867) encoding an AAT was cloned from the B. subtilis B3 strain and analyzed phylogenetically. We also describe the expression in E. coli and charac- terization of the recombinant enzyme by determining the optimum pH and temperature, substrate specifici- ties, kinetic parameters and the active-site residues.

Results

DNA and protein sequence analysis

the

the protonated N(1) of

the above-mentioned conserved active

X-ray crystallographic studies in conjunction with site-directed mutagenesis experiments have elucidated the function of several conserved active residues of AAT. The Tyr70 is hydrogen bonded to the phos- phate group of the co-enzyme PLP and stabilizes the transition state [13]. The Asn194 and Tyr225 residues regulate the electron distribution through hydrogen- bonding to O (3¢) of the co-enzyme PLP [14]. Asp222 serves as a protein ligand tethering the co-enzyme in a productive mode within the active site and stabi- to lizes co-enzyme strengthen the electron-withdrawing capacity of the co-enzyme [15]. The active site Lys258 transfers a proton from the amino acid substrate to the cofactor and forms an internal Schiff base with the cofactor [16]. Arg292 of the large domain in subgroup Ia AAT recognizes the distal carboxyl groups of dicarb- oxylate substrates [17]; however, this residue is not found in the corresponding regions of subgroup Ib, and the Lys109 residue performs this function instead in subgroup Ib [18]. Arg386 of the small domain binding the a-COO) of the substrate plays a key role in the activity of the enzyme [19,20]. The functions of residues were all identified by using the AAT from E. coli as the template, except for that of the Lys109 residue in subgroup Ib, which was determined from the AAT of T. thermophilus.

The aatB3 gene and its regulatory element within a 3642 bp genomic region of B. subtilis B3 were previ- ously sequence (accession number AY040867) [25]. By analysis using software available online (as described in the Materials and methods), the sequence of the aatB3 including an gene was shown to comprise 1308 bp, ATG initiation codon and a TGA termination codon. The G+C ratio of the ORF is 48.6%, which is (cid:2) 2% and 6% higher than the genomic G+C ratio of Bacil- lus amyloliquefaciens FZB42 (46.4%) and B. subtilis 168 (43.5%) [26], respectively. The deduced 436 amino acid product of aatB3 was predicted to have a molecular weight of 49.1 kDa, which is slightly lower than the value obtained on SDS ⁄ PAGE ((cid:2) 55 kDa). This differ- ence is the result of an additional 38 amino acid sequence including a 6 · His tag fused to the N-termi- nus of AATB3. The calculated isoelectric point of AATB3 is (cid:2) 5.4. The putative promoter and ribosomal binding site regions were found upstream of the aatB3 gene. The promoter has a typical )35, )10 and transcription start site, and there is a rho-independent

FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS

1346

H.-J. Wu et al. Identification of a new aspartate aminotransferase

transcription terminator flanking the stop codon of the aatB3 gene.

The amino acid sequence of AATB3 showed 97– 98% identities with the putative AATs from other B. subtilis strains, although their enzymatic activities have not been identified. From the protein sequence alignment of AATB3 and ATTs from several other organisms (Fig. 1), the AATB3 showed 56% identity with B. circulans AAT, and 16% and 14% with Bacil- lus. sp. YM-2 and T. thermophilus HB8 AATs, respec- tively. The latter two AATs belong to subgroup Ib [5,6], although AATB3 showed 12% and 10% identi- ties, respectively, with the E. coli and pig cytosolic AATs, which belong to subgroup Ia [5,6]. Therefore, based on the results described above, it appeared that the AATs from B. subtilis and B. circulans should belong to subgroup Ib.

Expression and purification of AATB3 and its mutants

chromatography

To produce recombinant AATB3 and the three mutant proteins, the aatB3 gene and its mutants were expressed in E. coli. The recombinant proteins were purified by a single chromatographic step using Ni2+-nitrilotriacetic as affinity acid metal-chelating described in the Materials and methods. The purified enzyme and three mutants each migrated as a single band on SDS ⁄ PAGE with a molecular weight of (cid:2) 55.0 kDa (Fig. 2A), which is identical to the calcu- lated value. The sizes of the AATB3 protein and its mutant proteins were slightly larger than the natural forms (49.1 kDa) as a result of the additional 38 amino including a 6 · His Tag sequence for affinity acids, chromatography fused to the N-terminus.

Activities and functions of AATB and its mutants

Fig. 1. Alignment of sequences of AATs. Alignment was per- formed using CLUSTAL X [29]. B.B3, B. subtilis B3; B.circ., B. circu- lans; B.YM, Bacillus sp. YM2; T.th., T. thermophilus HB8; cPig, pig cytosolic. Gaps in the alignment are shown by gray dashes. Identi- cal residues are shown in black; similar residues are shown in gray.

l-aspartate,

(Fig. 3A)

and

To confirm which residues play key roles in the interaction between B. subtilis B3 AAT and PLP, the Asp232 and Lys270 residues (corresponding to Asp222 and Lys258 in E. coli AAT) were replaced with Asn and His using site-directed mutagenesis to obtain the mutants D232N and K270H, respectively. The Asp232 fi Asn replacement led to a loss of the nega- tive charge at position 232, and the Lys270 fi His replacement introduced an imidazole ring into the enzyme and changes the structure of the enzyme. No enzymatic activities were determined on native gels for the D232N and K270H mutant enzymes (Fig. 2C), spectrophotometry which is

consistent with the

To determine whether this new AAT from B. subtil- is B3 might also have AAT activity, the enzymatic activity of the recombinant AATB3 expressed and purified from E. coli was analyzed. Native PAGE anal- ysis showed that the wild-type AATB3 had AAT acti- vity when l-aspartate and the a-ketoglutarate were used as amino donor and acceptor, respectively (Fig. 2C). In the paper chromatography analysis of amino acids (Fig. 3), the AATB3 also demonstrated the ability to transfer the a-amino of the l-tryptophan to a-ketoglutarate and oxaloacetate to produce l-glu- tamate respectively (Fig. 3B). The results of the spectrophotometry analy- sis showed that AATB3 also has weak l-tyrosine and l-phenylalanine aminotransferase activities (Table 1).

FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS

1347

H.-J. Wu et al. Identification of a new aspartate aminotransferase

Table 1. Activity of purified AATB3 towards different amino acids and oxo acids. The reaction was performed at 25 (cid:2)C for 20–40 min. The activity was measured as described in the Materials and methods.

Concentration (mM) Relative activity (%)

30 30 6 6 6 100.0 46.7 1.7 0.4 0.3

a The AAT from B. subitilis B3 showed relative high activity toward L-aspartate and L-glutamate, although the activities were very weak toward three aromatic amino acid aminotransferases (L-tryptophan, L-tyrosine and L-phenylalanine). Therefore, 30 mM was used for L-aspartate and L-glutamate, and 6 mM for the three aromatic amino acid substrates. a-ketoglutarate (10 mM) was used as amino group acceptor except for the oxaloacetate (10 mM) used for L-glutamate. The activity of L-aspartate was adjusted to 100. b 30 mM L-aspartate was used as amino donor for a-ketoglutarate, and 30 mM L-gluta- mate was used as amino donor for oxaloacetate. The activity of a-ketoglutarate was adjusted to 100.

Amino donora L-aspartate L-glutamate L-tryptophan L-tyrosine L-phenylalanine Amino acceptorb a-ketoglutarate Oxaloacetate 10 10 100.0 81.5

Fig. 2. Purification and functional analysis of the recombinant wild- (A) Aliquots of purified type (WT) and mutant AATB3 enzymes. enzyme for the wild-type and each AATB3 mutant were separated by SDS ⁄ PAGE and stained with Coomassie Brilliant Blue. (B) Aliqu- ots of purified enzyme for the wild-type and each AATB3 mutant were separated by native PAGE and stained with Coomassie Bril- liant Blue. (C) Native PAGE gel was stained with Fast Blue in accor- dance with the method described by de la Torre et al. [9].

showed that

of Arg403 (corresponding to Arg386 in E. coli AAT) in B. subtilis B3, the R403Y mutant enzyme was con- structed. The Arg403 fi Tyr replacement disrupted the PLP-Asn194-Arg403 hydrogen-bond linkage system and changed the conformation of the active center of the enzyme. The enzyme activity analysis showed that the R403Y mutant also lost transamination activity the Asp232, (Fig. 2C). These results Lys270 and Arg403 residues of B. subtilis B3 AAT play key roles in transamination.

Comparison and alignment of AAT sequences

Fig. 3. Detection of L-tryptophan aminotransferase activity using paper chromatography of amino acids. (A) the a-ketoglutarate was used as the amino acceptor; L-Glu, standard L-Glu; L-Try, standard L-Try; 1-3, reaction sample. (B) The oxaloacetate was used as the amino acceptor; L-Asp, standard L-Asp; L-Try, standard L-Try; 1–3, reaction sample.

To confirm the exact contributions of the Asp232, Lys270 and Arg403 residues to the function of B. sub- tilis B3 AAT, the deduced amino acid sequence was compared with the five AATs identified from B. circu- lans, pig cytosolic, E. coli, T. thermophilus HB8 and Bacillus sp. YM-2. The alignment results revealed 19 invariant amino acids in these six AATs (Fig. 1). Among these conserved residues, the Tyr70, Asn194, Asp222, Tyr225, Lys258 and Arg266 residues in E. coli AAT (numbered on the basis of the pig cytosolic AAT) are involved in the binding of PLP, which acts as the co-enzyme [19,27]. The Asp232 and Lys270 resi- dues in B. subtilis B3 AAT correspond to Asp222 and in E. coli AAT. Together with Lys258, respectively,

analysis. These two mutants also lost their transamina- tion ability when using l-Trp and l-Phe as amino donors (data not shown). To determine the exact role

FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS

1348

H.-J. Wu et al. Identification of a new aspartate aminotransferase

analysis of the activities of the mutants D232N and K270H (Fig. 2C), we concluded that Asp232 in B. sub- tilis B3 AAT, which corresponds to Asp222 in E. coli AAT [15], is the residue that enhances the function of the enzyme-bound co-enzyme PLP. The Lys270 residue of B. subtilis B3 AAT serves the same function as Lys258 in E. coli AAT, which binds to PLP and forms an internal Schiff base [16].

the R403Y mutant confirmed that

zoa, archaebacteria and bacteria. Interestingly, plants also have Ib subgroup-prokaryote-type AATs [2,9]. Although the AATs from B. subtilis B3 and B. circu- lans belong to the Ib subgroup in our analysis, these new AATs show significant differences from other Ib subgroup-type AATs. They occupy a small separate branch at a far phylogenetic distance from AATs belonging to another large branch of the Ib subgroup. From the homology analysis, the identity between the two AATs from B. subtilis B3 and B. circulans was (cid:2) 56%, and the AAT from B. subtilis B3 showed rela- tively high identity ((cid:2) 19%) with the AAT from Syn- echocystis sp. compared to other AATs from the Ib subgroup.

Enzyme specificity and kinetics parameters

groups of dicarboxylate

carboxyl

temperature

retained in the

The conserved residues Asn194 and Arg386 in E. coli AAT participate in substrate binding [14,20], which correspond to Asn199 and Arg403, respectively, in B. subtilis B3 AAT. The loss of transamination the activity of B. subtilis B3 AAT utilizes the Arg403 residue to bind the a-COO) of the substrate, which is similar to the role of Arg386 in E. coli AAT. The Arg292 residue, which is the invariant residue in the subgroup Ia AATs [17] identified in the primary structure of B. subtilis B3 and B. circulans AATs, interacts directly with the dis- tal substrates (Fig. 1). However, this residue is not found in the cor- responding regions of subgroup Ib. By contrast, the conserved active residue Lys109 in subgroup Ib carries out the function of recognizing the substrates as does the Arg292 residue in subgroup Ia [18]. From the alignment, the Thr109 was shown also to be conserved in B. subtilis B3, B. circulans, E. coli and pig cytosolic AATs, and the Trp140 invariant among the six AATs (Fig. 1). These two residues provide hydrogen bonds to the phosphate group and distal carboxyl group of the substrate [27,28].

The purified AATB3 was optimally active at 45 (cid:2)C (at pH 7.2), and more than 80% of the maximum activity was range 25–55 (cid:2)C (Fig. 5A). After incubation at 50 (cid:2)C for 30 min, the enzyme had more than 85% of the maximum activity (Fig. 5B). When incubated at 60 (cid:2)C for 15 min, the enzyme also had 65% activity, although increasing the treatment time to 30 min caused the enzyme to lose almost all activity. Above 65 (cid:2)C, the stability of the enzyme decreased rapidly (Fig. 5B). The optimal pH for the enzyme activity was pH 8.0 at the optimal tem- perature (45 (cid:2)C) (Fig. 5C). The enzyme activity over the pH range 7.0–8.6 was more than 80% of the maxi- mum activity. From these results, we demonstrated that AATB3 tended to have relatively high activity and stability in alkaline environments.

Molecular phylogeny

Table 2 summarizes the effect of some metal ions on the activity of the purified aminotransferase. At a low concentration (1 mm), Cu2+ and Mn2+ could inhibit the activity of the purified aminotransferase, and other metal ions had no remarkable effects, although Ca2+ and Co2+ could promote the reaction to some extent. Partial inhibition was observed in the presence of some ions at 10 mm, and the order of the ions by metal enzyme inhibitory activity was Zn2+>Cu2+>Mg2+ >Mn2+. It could be concluded that the enzyme is not metal ion-dependent because EDTA had no inhibitory or stimulatory effects on the activity (Table 2).

AATB3 showed transamination activity between various amino acids and a-ketoglutarate (Table 1), with l-aspartate being the best substrate. Aromatic amino acids such as l-tryptophan, l-tyrosine and l-phenylalanine were weakly active as amino donors, transamination activity toward and the activity of l-tryptophan was relatively higher than the other two residues.

To examine the phylogenetic relationship of this new bacteria gene with AAT genes from plants, animals, protozoa, eubacteria and archeabacteria, a phylogram was constructed using the Neighbor-joining method with 44 full-length AAT amino sequences from Gen- Bank. As shown in Fig. 4, the AATs were divided into six main branches: animal mitochondrial, animal cyto- plasmic, plant mitochondrial, plant cytoplasmic and the two branches in bacteria. The AAT from B. subtil- is B3, clustering together with the AAT from B. circu- lans, is in the large branch of bacterial AATs. From the phylogenetic tree analysis, the AATs from different organisms can also be divided into two major sub- groups according to the classification system estab- lished by Jensen and Gu [5]. The Ia subgroup contains eubacterial and eukaryotic AATs, including enzymes from E. coli, Haemophilus influenzae, animals and plants. The Ib subgroup consists almost exclusively of AATs from prokaryotes, including AATs from proto-

FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS

1349

H.-J. Wu et al. Identification of a new aspartate aminotransferase

Fig. 4. Phylogenetic tree of AATs from dif- ferent organisms. The phylogenetic tree was constructed with full-length AAT amino acid sequences using the Neighbor-joining method of MEGA 4.0. Bootstrap values are expressed as percentages of 1000 replica- tions. Bar 0.1 sequence divergence. c, cyto- solic; ch, chloroplastic; cy, cytoplastimic; p, plastidic; m, mitochondrial. GenBank acces- sion numbers of the AATs are shown. The black circle represents the branch of AAT from B. subtilis B3 and B. circulans; the black triangle shows the prokaryote-type AATs from plants.

To further characterize the enzyme,

R403Y were almost inactive (Fig. 2C), and therefore no kinetic parameters could be determined.

Discussion

affinity

for

AATs that catalyze the tricarboxylic acid cycle inter- mediates to amino acids have been studied in a variety of organisms. These enzymes play a key role in aspar- tate catabolism and biosynthesis as well as in linking carbon metabolism with nitrogen metabolism. In the present study, we cloned and characterized such an AAT from the B. subtilis B3 strain. This enzyme con- sists of 436 amino acid residues and is encoded by the aatB3 gene. We found the typical promoter and termi- nator regions upstream and downstream, respectively, of this new gene.

the kinetic parameters Km, Vmax and kcat were determined for the purified AATB3. Values for Km and Vmax for both amino donors (l-aspartate and l-glutamate) and ac- ceptors (a-ketoglutarate and oxaloacetate) were calcu- lated from the double-reciprocal plots. The Km values of AATB3 were 6.7, 0.3, 8.0 and 0.6 mm for l-aspar- tate, a-ketoglutarate, l-glutamate and oxaloacetate, respectively. For the amino donors, AATB3 showed than l-glutamate, l-aspartate more whereas, for the amino acceptors, this enzyme had more affinity for a-ketoglutarate (Table 3). The calcu- lated Vmax for l-aspartate, a-ketoglutarate, l-gluta- mate and oxaloacetate were 0.23, 0.21, 0.07 and 0.11 mmÆmin)1, respectively (Table 3). The kcat ⁄ Km ratios listed in the Table 3, which represent the cata- the enzyme had relative lytic efficiency, show that higher catalytic efficiency for oxo acids than for amino acids. The enzyme variants D232N, K270H and

To examine explicitly the phylogenetic relationship between the AATB3 and other AATs from different organisms, a phylogenetic tree was constructed using

FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS

1350

H.-J. Wu et al. Identification of a new aspartate aminotransferase

ions on the activity of purified AATB3. Table 2. Effect of metal Values represent the means of triplicates relative to the untreated control samples.

Relative activity (%)

1 mM 10 mM Chemicals

None MgCl2 CaCl2 MnSO4 CuSO4 ZnSO4 CoCl2 EDTA 100 ± 0.6 96.9 ± 4.4 115.5 ± 2.7 90.1 ± 2.3 84.3 ± 2.0 99.7 ± 7.4 122.1 ± 2.5 106.4 ± 10.1 100 ± 0.6 34.7 ± 3.1 75.7 ± 3.0 42.8 ± 7.9 4.9 ± 1.3 3.1 ± 1.3 54.1 ± 4.5 99.3 ± 1.8

Table 3. Kinetic parameters for recombinant AATB3 from Bacil- lus subtilis B3. Kinetic parameters were obtained from double reci- procal plots as described in the Materials and methods. Values represent the mean ± SD of three determinations.

B. subtilis B3 AATB3

)1Æs)1)

L-aspartate L-glutamate a-ketoglutarate Oxaloacetate

Substrates kcat (s)1) kcat ⁄ Km (mM Vmax (mMÆL)1Æmin) Km (mM)

0.23 ± 0.03 0.07 ± 0.01 0.21 ± 0.01 0.11 ± 0.01 30 ± 3 14 ± 2 27 ± 1 22 ± 1 6.68 ± 1.45 8.00 ± 1.32 0.32 ± 0.08 0.60 ± 0.06 4.50 1.75 84.38 36.67

Fig. 5. Characterization of the purified AATB3. (A) Effect of tempera- ture on activity of AATB3 (pH 7.2). (B) Thermostability of AATB3. The enzyme was pre-incubated at 40, 50, 60 or 65 (cid:2)C for 5, 15 or 30 min before the assay. (C) Effect of pH on activity of AATB3. The assay was performed at 45 (cid:2)C in buffers with pH in the range 4.4–10.2.

the pig cytosolic AAT), which are conserved in AATB3 and Ia subgroup AATs, are not found in the Ib subgroup AATs. These three residues are all involved in the interaction with the substrate [27,28], especially the Arg292 residue, which plays a key role in recognizing the distal carboxylate of the substrate [17]. In subgroup Ib, the same role appears to be car- ried out by Lys109 [18]. Therefore, AATB3 is more similar to the AATs from the Ia subgroup than the Ib subgroup in structure.

previously characterized AAT sequences from animals, plants and prokaryotes. The AATs from B. subtilis B3 and B. circulans clustered together with other bacterial AATs and appeared to be more closely related to the Ib-type of bacterial AATs than to the Ia-type of other bacterial AATs (Fig. 4). However, AATB3 showed low identify with AATs from the Ib subgroup, and the highest identity was only (cid:2) 19% compared to AAT from Synechocystis sp. (Ib subgroup).

We used site-directed mutagenesis to determine the exact role of three residues in AATB3. The loss of the activity from the mutations together with the multiple alignment analysis indicated that the Asp232 residue of AATB3 enhances the function of the enzyme-bound coenzyme PLP and that the Lys270 residue mediates binding of PLP, whereas the Arg403 residue is respon- sible for recognizing the a-COO) of the substrate. These functions are performed by the corresponding residues of Asp222, Lys258 and Arg386 of the AAT from E. coli [15,16,19,20].

Multiple alignments, which were built using AATs of distant species, clearly show that most of the resi- dues interacting with the PLP and the substrates [27,29] are conserved in AATB3 (Fig. 1). From this comparison, the AATB3 tends to have more conserved active residues that belong to the Ia subgroup but do not exist in the Ib subgroup. For example, the Gly38, Thr109 and Arg292 residues (numbered on the basis of

We also described in detail the physicochemical and catalytic properties of AAT from B. subtilis B3. The purified enzyme was demonstrated to have an optimal temperature at 45 (cid:2)C and thermostability of only up to

FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS

1351

H.-J. Wu et al. Identification of a new aspartate aminotransferase

50 (cid:2)C. These characteristics are similar to those of the AAT from E. coli [30] and not of AATs from the Ib subgroup, which usually have high thermostability. The thermostability appears to be related to the amino acid composition of the AAT. Okamoto et al. [6] reported that the high Pro content of the Ib-type AAT from T. thermophilus (6.5%) will render the enzyme rigid and thermostable. The same features are also found in other subgroup Ib AATs, such as Thermus aquaticus [31] and Phormidium lapdideum YT1 AAT (7.0%) (6.1%), as well as the newly found Ib-prokaryote-type AAT in Pinus pinaster (6.4%) [9,11]. The Pro content of B. subtilis B3 AAT is 4.1%, which is similar to that of subgroup Ia E. coli AAT (3.8%) and is much lower than that of subgroup Ib T. thermophilus AAT. For this reason, the thermostability of B. subtilis B3 AAT is similar to that of E. coli AAT and is lower than that of T. thermophilus AAT by (cid:2) 20 (cid:2)C [6].

described in the present study may have arisen from the interaction between the Ia-type and Ib-type aat genes during evolution. A similar phenomenon is seen when the genome segment of B. subtilis B3 is com- pared with those of B. subtilis A1 ⁄ 3 and B. amylolique- faciens FZB42. The aatB3 gene frequently appears in the region between the srf operon and sfp gene. This region is the putative regulatory region relevant to bio- the lipopeptides, especially for the sfp synthesis of gene, which is essential for biosynthesis of the lipopep- tides [26]. We presume that the aat gene in this region can regulate the biosynthesis of the lipopeptides. The experiments performed in the present study showed that this AAT can form Glu and Asp, and the forma- tion of Glu and Asp is used to synthesize Gln and Asn, respectively. These four residues are common iturin components in lipopeptides, such as surfactin, and fengycin. Another interesting observation was that the B. subtilis B3 has another aat gene similar to aspB outside this region. This could be explained by the need to synthesize more AATs to provide adequate nutrients (carbon and nitrogen sources) and lipopep- tides so as to survive in complex environments and deal with competitors.

sequence was

industrial applications,

We showed that the AAT from B. subtilis B3 had an optimal pH at 8.0 and had relatively high activity over a wide alkaline pH range (pH 7.0–9.0). This character- istic is similar to that of the AAT from B. circulans. The B. circulans AAT has been reported to have high optimal pH and a wide pH stability range as a result of the N-terminal two a-helical segments, which con- tain an additional sequence of 32 acid residues not found in many AATs [23]. Interestingly, B. subtilis B3 AAT also has a similar additional N-terminal sequence of 32 acid residues (Fig. 1), which shows 53% identity with that of B. circulans AAT, and the additional N-terminus of B. subtilis B3 AAT appears to perform the same function as that of B. circulans AAT.

In summary, a new AAT with an additional N-ter- identified from B. subtilis B3. minal Having both Ia-type and Ib-type characteristics and a high activity over an alkaline pH range, this enzyme may regulate the biosynthesis of lipopeptides and has such as various potential in the synthesis of l-tyrosine, l-phenylalanine and l-homophenylalanine. A detailed characterization of the role of B. subtilis B3 AAT and its structure are in progress.

Materials and methods

substrate. However,

Bacterial strains, plasmids and growth conditions

The bacterial strains and plasmids used in the present study are described in Table 4. E. coli DH5a was used as the host for amplification of all plasmids, and recombinant proteins were expressed in E. coli BL21. B. subtilis B3 was used for cloning the aatB3 gene. LB broth was used for the growth of E. coli and B. subtilis strains. When required, antibiotics were added at the final concentrations: ampicillin (Amp), 100 lgÆmL)1; kanamycin (Km), 50 lgÆmL)1.

The results obtained in the present study indicate that the AAT from B. subtilis B3 can catalyze l-aspar- tate, l-glutamate, l-tryptophan, l-tyrosine and l-phen- ylalanine transamination, with l-aspartate being the best the activity of AATB3 toward three aromatic amino acids were weak, similar to that of AAT from Bacillus sp. YM-2 strain [32], and was unlike AAT from E. coli, which was shown to have 22% of the activity of the total tyrosine amino- transferase [33]. The Km values for AATB3 were 6.7, 0.3, 8.0 and 0.6 mm for l-aspartate, a-ketoglutarate, l-glutamate and oxaloacetate, respectively. Similar to the other AATs, the Km values for oxo acids are lower than that for the amino acids [9,32,34]. However, it is worth noting that both kcat and kcat ⁄ Km values are lower than those of AAT from E. coli [35].

DNA manipulation and transformation

The isolation and manipulation of recombinant DNA were performed using standard techniques. All enzymes used in the present study were purchased from Takara Bio Inc.

This new AAT phylogenetically belongs to subgroup Ib of AAT, although it also has conserved active resi- Ia-type dues and thermostability characteristic of AATs. Although our combined results appear to be the B. subtilis gene contradictory, we propose that

FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS

1352

H.-J. Wu et al. Identification of a new aspartate aminotransferase

Table 4. Bacterial strains and plasmids used in the present study. Resistance markers were: Ampr, ampicillin resistance; Kmr, kanamycin resistance.

Strain or plasmid Relevant genotype or characteristics Source or reference

)) gal dcm(DE3)

) mB

Strains E. coli F80dlacZ DM12 minirecA Stored in this laboratorya Stored in this laboratory DH5a BL21(DE3) F) F) ompT hsdSB(rB B. subtilis Wild-type; bacillomycin D and fengycin producer Present study B3 Plasmids T7 promoter-based expression vector; Kmr pET30a(+)

pUC19 pETAAT Novagen (Merck KGaA, Darmstadt, Germany) Stored in this laboratory Present study

pUCAAT Present study

pUCD232N pUCK270H pUCR403Y pETD232N Present study Present study Present study Present study

pETK270H Present study

pETR403Y Present study

a Key Laboratory of Monitoring and Management of Crop Diseases and Pest Insects, Ministry of Agriculture, Nanjing, China.

E. coli clone vector; lacZ; Ampr The aatB3 fragment was inserted into KpnI and EcoRI sites of pET30a(+) for the expression of protein AATB3; T7 promoter-based expression vector; Kmr The aatB3 fragment was inserted into KpnI and EcoRI sites of pUC19 for construction the mutant of AATB3 protein; Ampr pUC19 carrying a fragment encoding the D232N mutant; Ampr pUC19 carrying a fragment encoding the K270H mutant; Ampr pUC19 carrying a fragment encoding the R403Y mutant; Ampr The fragment from pUCD232N was inserted into KpnI and EcoRI sites of pET30a(+) for the expression of protein D232N; T7 promoter-based expression vector; Kmr The fragment from pUCK270H was inserted into KpnI and EcoRI sites of pET30a(+) for the expression of protein K270H; T7 promoter-based expression vector; Kmr The fragment from pUCR403Y was inserted into KpnI and EcoRI sites of pET30a(+) for the expression of protein R403Y; T7 promoter-based expression vector; Kmr

firmed by sequencing (Invitrogen Biotechnology Co., Ltd, Shanghai, China).

Table 5. Oligo DNA primers used in the present study. Restriction sites or mutation sites in primers are underlined.

Name Sequence of primers (5¢- to 3¢)

Site-directed mutagenesis via PCR

pUCD232N,

designated

(Otsu, Japan). The specific primers used for the PCR are described in Table 5.

Single mutations were introduced into the cloned AATB3 using the Takara MutanBEST Kit (Takara). Reactions were carried out using the primer pairs: for D232N, D232N-F and D232N-R; for K270H, K270H-F and K270H-R; and, for R403Y, R403Y-F and R403Y-R. The pUCAAT vector was used as a template. The introduced mutations in the aatB3 gene were confirmed by DNA sequencing. The resulting vec- pUCK270H and tors were pUCR403Y, and the three different DNA fragments carrying mutant aatB3 genes from these vectors were subcloned into the KpnI and EcoRI restriction sites of the pET30a(+) expression vector to obtain pETD232N, pETK270H and pETR403Y, respectively.

GGTACCATGAATGATGCAGCAAAAG (KpnI) GAATTCTCAGCCTGATATTTCCGCCT (EcoRI) CGTGCTCGTAAACGATGCGTATTAC ACAATCTCTTTGCCGGCCTCCGC GGCGCGACGCACGAAAATTACGC GTCTATTTTCACGCAAAGCACCCGGT AAACCGATTTGTACATCGCATTTTC CATTAATGGATATCGTTCCGATTCC P1 P2 D232N-F D232N-R K270H-F K270H-R R403Y-F R403Y-R

Expression and purification of recombinant wild-type and mutant AATB3 enzymes

strain BL21 (DE3) was

The E. coli transformed with pETAAT or the three expression plasmids carrying different

The original sequence of the aatB3 gene was obtained through the B. subtilis B3 gene library constructed in a pre- vious study (accession number AY040867) [25]. To express the recombinant AATB3 protein in E. coli, the entire aatB3 ORF was amplified using primers P1 and P2 using B. sub- tilis B3 chromosomal DNA as the template; the amplified product was digested with KpnI and EcoRI, and cloned into the same sites of the cloning vector pUC19 and expression vector pET30a(+), resulting in the plasmids pUCAAT and pETAAT, respectively. The entire cloned regions were con-

FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS

1353

A paper chromatography assay for amino acids was also used to detect the activity toward tryptophan. The reaction was performed as described above, and a-ketoglutarate and oxaloacetate were used as amino acceptors. At the end of the reaction, 10 lL of the reaction solution was spotted onto a filter paper and separated by chromatography (n-butyl alcohol ⁄ ethanol ⁄ water at 4 : 1 : 1, v ⁄ v). Subse- quently, the filter paper was sprayed with 0.1% ninhydrin. After drying, the products of the amino acid on the filter paper were displayed purple in color.

mutant aatB3 genes. The transformants were cultivated at 37 (cid:2)C with shaking in LB medium containing 50 lgÆmL)1 kanamycin until D600 of 0.5–0.7 was reached. Flasks con- taining the cultures were supplemented with isopropyl thio- b-d-galactoside at a final concentration of 1 mm. After incu- bation at 37 (cid:2)C for a further 6 h with vigorous shaking, the cells were harvested by centrifugation at 6000 g for 20 min. The cell pellets were resuspended in a buffer containing 20 mm potassium phosphate, 500 mm NaCl, 5% glycerol and 20 mm imidazole buffer at pH 7.3. Cells were lysed by sonication, and cell debris was removed by centrifugation at 10 000 g for 20 min. The recombinant enzymes were purified by a single chromatographic step using HisTrapHP (GE Healthcare, Milwaukee, WI, USA). The column was loaded with the bacterial cell lysate, and the non-adherent proteins were removed by rinsing with 20 volumes of wash buffer (20 mm potassium phosphate, pH 7.3, 5% glycerol, 500 mm NaCl, 20 mm imidazole). The proteins were eluted with a gradient of 10–500 mm imidazole in wash buffer. The purified enzymes were stored at )20 (cid:2)C after salt removal using the HiTrap Desalting columns (GE Healthcare). Pro- tein concentrations were measured with a BCA-100 protein quantitative analysis kit (Biocolor Biotech, Shanghai, China) using BSA as the standard.

To determine the effects of pH, temperature and inhibi- tors, l-aspartate and a-ketoglutarate were used as amino donor and acceptor, respectively, and the reactions were performed as described above. To investigate the effect of pH at the optimum temperature (45 (cid:2)C), three buffered systems at a final concentration of 50 mm were used: acetate ⁄ sodium acetate (pH 4.4–6.0), potassium phosphate (pH 6.0–8.0) and glycine ⁄ sodium hydroxide (pH 8.0–10.2). The temperature dependence was determined at pH 7.2, and the stability of the enzyme was examined by keeping the pure preparation for 5, 15 and 30 min at 40, 50, 60 and 65 (cid:2)C before the assay. The effect of inhibitors was established with the reaction system containing different metal ions at final concentrations of 1 and 10 mm. The specific activities for amino acids were analyzed under similar conditions.

H.-J. Wu et al. Identification of a new aspartate aminotransferase

Determination of enzyme activities

Kinetic experiments

AAT activity was assayed as described by Collier and Kohlhaw [36]. The assay mixture contained (in 0.8 mL total volume): 0.1 m potassium phosphate buffer (pH 7.2), 30 mm l-aspartate, 10 mm a-ketoglutarate, 38 lm pyridoxal 5¢-phosphate and enzyme. The stock solution of a-ketoglu- tarate was prepared daily, and its pH was adjusted to 7.2 with NaOH. The assay was performed at 25 (cid:2)C for 20– 40 min, and the reaction was stopped with 0.1 mL of 10 m NaOH. After 30 min at room temperature, the increase in absorbance at 265 nm was measured for the test sample, as well as a control to which NaOH had been added before the addition of a-ketoglutarate. A molar extinction coeffi- cient for oxaloacetate of 780 m)1Æcm)1 was used, and one unit of activity was defined as the amount of enzyme neces- sary to form 1 lmolÆmin)1 of oxaloacetate.

m

concentration

The aromatic amino acid aminotransferases were assayed according to Mavrides and Orr [37]. The assay was estab- lished for AAT except that aspartate was replaced with 6 mm tryptophan, tyrosine or phenylalanine, and the con- centration of the a-ketoglutarate was decreased to 10 mm. The increase in absorbance of the reaction solution was measured at 335, 330 and 315 nm. The molar extinction coefficients for the reaction products indole pyruvate, q-hy- droxyphenylpyruvate and phenylpyruvate were 10 000, 19 500 and 17 500 m)1Æcm)1, respectively. One unit of aro- matic amino acid aminotransferase activity was defined as the amount of enzyme necessary to form 1 lmol of indole pyruvate, q-hydroxyphenylpyruvate or phenylpyruvate.

For determination of kinetic parameters, an assay was established by coupling with malate dehydrogenase as described previously [38]. In the routine assay, the reaction contained 0.1 m potassium phosphate buffer mixture (pH 7.6), 25 lm pyridoxal 5¢-phosphate, 0.5 mm NADH, 0.08 U malate dehydrogenase and 0.5 lL of purified enzyme in a reaction volume of 200 lL. The temperature was 30 (cid:2)C. The reaction was monitored by the decrease in absorbance of NADH at 340 nm over 180 s with a Thermo Multiskan Ascent (Thermo Fisher Scientific Inc., Waltham, MA, USA) and the data were recorded every 20 s. AAT substrate concentrations were varied in the range 1–20 mm l-aspartate with a fixed concentration of 10 mm a-ketoglu- ) and in the range 0.5–10 mm a-ketogluta- tarate (for K L(cid:3)asp rate with a fixed concentration of 20 mm l-aspartate (for ). The kinetic parameters for l-glutamate and oxalo- K a(cid:3)KG m acetate were coupled to glutamate dehydrogenase [39]. Our assay was established using the same methods, and the contained l-glutamate, oxaloacetate, 200 lL reactions 1 mm NADH, 2 U of glutamate dehydrogenase and 12 mm NH4Cl (as second substrate for glutamate dehydrogenase) in 0.1 m potassium phosphate buffer (pH 7.6). AAT sub- strate concentrations were varied in the range 1.0–27 mm l-glutamate with a fixed concentration of 5 mm oxaloace- ) and in the range 0.5–20 mm oxaloacetate tate (for K L(cid:3)glu m 12 mm l-glutamate fixed with of a (for K OAA ). Km and Vmax values were estimated from the

m

FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS

1354

variation in initial reaction velocity with substrate concen- transformation [40]. The kcat tration using the Hanes parameter was defined as Vmax divided by the enzyme con- centration in the 200 lL reaction.

H.-J. Wu et al. Identification of a new aspartate aminotransferase

(2009DFA32740); the Specialized Research Fund for the Doctoral Program of Higher Education, P. R. China (20060307012); the National Transgenic Major Program (2009ZX08009-055B); and Youth Science and Technology Innovation Fund of Nanjing Agricultural University (KJ09007).

PAGE

References

1 Deu E, Koch KA & Kirsch JF (2002) The role of the conserved Lys68*:Glu265 intersubunit salt bridge in aspartate aminotransferase kinetics: multiple forced covariant amino acid substitutions in natural variants. Protein Sci 11, 1062–1073.

2 de la Torre F, De Santis L, Fernanda SM, Crespillo R & Canovas FM (2006) Identification and functional analysis of a prokaryotic-type aspartate aminotransfer- ase: implications for plant amino acid metabolism. Plant J 46, 414–425.

3 Wilkie SE, Lambert R & Warren MJ (1996) Chloro- plastic aspartate aminotransferase from Arabidopsis thaliana: an examination of the relationship between the structure of the gene and the spatial structure of the protein. Biochem J 319, 969–976.

4 Miesak BH & Coruzzi GM (2002) Molecular and physi-

cell PAGE was performed with a Mini Protean II in accordance with the (Bio-Rad, Hercules, CA, USA) manufacturer’s instructions. For SDS ⁄ PAGE, the separat- ing gel was made with 12% acrylamide and the stacking gel was made with 5% acrylamide. The Prestained Protein Marker (Fermentas China Co., Ltd, Shenzhen, China) was used as the molecular weight marker. Proteins were visual- ized by Coomassie Brilliant Blue staining. Native PAGE was carried out with discontinuous gels in which the sepa- rating gel consisted of 8% acrylamide and the stacking gel consisted of 5% acrylamide. The running buffer contained 25 mm Tris-HCl and 250 mm Gly (pH 8.3). The gels were run at 15 mA for 90 min at 4 (cid:2)C. They were then placed in a bath containing 50 mL of AAT substrate solution with gentle shaking for 5 min. AAT activity was detected when the AAT substrate supplemented with solution was 1 mgÆmL)1 Fast Blue (Sigma-Aldrich Shanghai Trading Co., Ltd, Shanghai, China). The composition of the AAT substrate solution (pH 7.4) was 2.2 mm a-ketoglutarate, 8.6 mm Asp, 0.5% (w ⁄ v) polyvinylpyrrolidone-40, 1.7 mm EDTA and 100 mm Na2HPO4 [9].

oligical analysis of Arabidopsis mutants defective in cytosolic or chloroplastic aspartate aminotransferase. Plant Physiol 129, 650–660.

Sequence analysis

5 Jensen R & Gu W (1996) Evolutionary recruitment of biochemically specialized subdivisions of Family I within the protein superfamily of aminotransferases. J Bacteriol 178, 2161–2171.

6 Okamoto A, Kato R, Masui R, Yamagishi A, Oshima T & Kuramitsu S (1996) An aspartate aminotransferase from an extremely thermophilic bacterium, Thermus thermophilus HB8. J Biochem 119, 135–144.

7 Sung MH, Tanizawa K, Tanaka H, Kuramitsu S,

Alignments of DNA and protein sequences were conducted with blastn and blastp software, respectively (http:// www.ncbi.nlm.nih.gov/BLAST/). Genes were predicted using genemark (http://exon.gatech.edu/GeneMark/). The pro- moter and terminator were predicted using the online tools neural network promoter prediction (http://www. fruitfly.org/seq_tools/promoter.html) and findterm (http:// linux1.softberry.com/berry.phtml), respectively.

Kagamiyama H, Hirotsu K, Okamoto A, Higuchi T & Soda K (1991) Thermostable aspartate aminotransferase from a thermophilic Bacillus species. Gene cloning, sequence determination, and preliminary x-ray charac- terization. J Biol Chem 266, 2567–2572.

Additional aminotransferase sequences were obtained from GenBank and aligned by using clustal x, followed by manual adjustments [41]. Aligned sequences were visual- ized with genedoc [42]. Phylogenetic trees were constructed using the Neighbor-joining algorithm [43] in mega 4.0 [44], with its reliability assessed by 1000 bootstrap repetitions.

Acknowledgements

8 Watson RJ & Rastogi VK (1993) Cloning and nucleo- tide sequencing of Rhizobium meliloti aminotransferase genes: an aspartate aminotransferase required for symbiotic nitrogen fixation is atypical. J Bacteriol 175, 1919–1928.

9 de la Torre F, Moya-Garcia AA, Suarez MF,

Rodriguez-Caso C, Canas RA, Sanchez-Jimenez F & Canovas FM (2009) Molecular modeling and site-direc- ted mutagenesis reveal essential residues for catalysis in a prokaryote-type aspartate aminotransferase. Plant Physiol 149, 1648–1660.

This work was supported by grants from the National Natural Science Fund of China (30570041); the National 863 Program of China (2006AA10Z172; 2006AA10A203); the Special Nonprofit Scientific Research Program, P. R. China (3-23); the Program of International Science and Technology Cooperation

FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS

1355

10 Nakai T, Okada K, Akutsu S, Miyahara I,

(Sonenshein AL ed), pp 203–231. ASM Press, Washing- ton, DC.

22 Iijima T, Diesterhaft MD & Freese E (1977) Sodium

Kawaguchi S, Kato R, Kuramitsu S & Hirotsu K (1999) Structure of Thermus thermophilus HB8 aspartate aminotransferase and its complex with maleate. Biochemistry 38, 2413–2424.

11 Kim H, Nakaoka M, Yagi M, Ashida H, Hamada K,

effect of growth on aspartate and genetic analysis of a Bacillus subtilis mutant with high aspartase activity. J Bacteriol 129, 1440–1447.

23 Kravchuk Z, Tsybovsky Y, Koivulehto M, Vlasov A,

Chumanevich A, Battchikova N, Martsev S & Korpela T (2001) Truncated aspartate aminotransferase from al- kalophilic Bacillus circulans with deletion of N-terminal 32 amino acids is a non-functional monomer in a par- tially structured state. Protein Eng 14, 279–285. 24 Berger BJ, English S, Chan G & Knodel MH (2003) Methionine regeneration and aminotransferases in Bacillus subtilis, Bacillus cereus, and Bacillus anthracis. J Bacteriol 185, 2418–2431.

25 Yao S, Gao X, Fuchsbauer N, Hillen W, Vater J &

Shibata H & Sawa Y (2003) Cloning, structural analysis and expression of the gene encoding aspartate amino- transferase from the thermophilic cyanobacterium Phormidium lapideum. J Biosci Bioeng 95, 421–424. 12 Schwarzenbacher R, Jaroszewski L, von Delft F, Abd- ubek P, Ambing E, Biorac T, Brinen LS, Canaves JM, Cambell J, Chiu HJ et al. (2004) Crystal structure of an aspartate aminotransferase (TM1255) from Thermoto- ga maritima at 1.90 A˚ resolution. Proteins 55, 759–763. 13 Inoue K, Kuramitsu S, Okamoto A, Hirotsu K, Higu- chi T & Kagamiyama H (1991) Site-directed mutagene- sis of Escherichia coli aspartate aminotransferase: role of Tyr70 in the catalytic processes. Biochemistry 30, 7796–7801.

Wang J (2003) Cloning, sequencing, and characteriza- tion of the genetic region relevant to biosynthesis of the lipopeptides iturin A and surfactin in Bacillus subtilis. Curr Microbiol 47, 272–277.

26 Chen XH, Koumoutsi A, Scholz R, Eisenreich A,

Schneider K, Heinemeyer I, Morgenstern B, Voss B, Hess WR, Reva O et al. (2007) Comparative analysis of the complete genome sequence of the plant growth-pro- moting bacterium Bacillus amyloliquefaciens FZB42. Nat Biotechnol 25, 1007–1014.

14 Yano T, Mizuno T & Kagamiyama H (1993) A hydro- gen-bonding network modulating enzyme function: asparagine-194 and tyrosine-225 of Escherichia coli aspartate aminotransferase. Biochemistry 32, 1810–1815. 15 Yano T, Kuramitsu S, Tanase S, Morino Y & Kagam- iyama H (1992) Role of Asp222 in the catalytic mecha- nism of Escherichia coli aspartate aminotransferase: the amino acid residue which enhances the function of the enzyme-bound coenzyme pyridoxal 5¢-phosphate. Biochemistry 31, 5878–5887.

27 Okamoto A, Higuchi T, Hirotsu K, Kuramitsu S & Ka- gamiyama H (1994) X-ray crystallographic study of pyridoxal 5¢-phosphate-type aspartate aminotransferases from Escherichia coli in open and closed form. J Bio- chem 116, 95–107.

28 Ja¨ ger J, Moser M, Sauder U & Jansonius JN (1994)

16 Jeffery CJ, Gloss LM, Petsko GA & Ringe D (2000) The role of residues outside the active site: structural basis for function of C191 mutants of Escherichia coli aspartate aminotransferase. Protein Eng 13, 105–112.

Crystal structures of Escherichia coli aspartate amino- transferase in two conformations: comparison of an unliganded open and two liganded closed forms. J Mol Biol 239, 285–305.

17 Almo SC, Smith DL, Danishefsky AT & Ringe D (1994) The structural basis for the altered substrate specificity of the R292D active site mutant of aspartate aminotransferase from E. coli. Protein Eng 7, 405–412. 18 Nobe Y, Kawaguchi SI, Ura H, Nakai T, Hirotsu K,

29 Rhee S, Silva MM, Hyde CC, Rogers PH, Metzler CM, Metzler DE & Arnone A (1997) Refinement and com- parisons of the crystal structures of pig cytosolic aspar- tate aminotransferase and its complex with 2- methylaspartate. J Biol Chem 272, 17293–17302. 30 Yagi T, Kagamiyama H, Motosugi K, Nozaki M &

Kato R & Kuramitsu S (1998) The novel substrate rec- ognition mechanism utilized by aspartate aminotransfer- ase of the extreme thermophile Thermus thermophilus HB8. J Biol Chem 273, 29554–29564.

19 Matharu A, Hayashi H, Kagamiyama H, Maras B &

Soda K (1979) Crystallization and properties of aspar- tate aminotransferase from Escherichia coli B. FEBS Lett 100, 81–84.

31 O’Farrell PA, Sannia G, Walker JM & Doonan S

John RA (2001) Contributions of the substrate-binding arginine residues to maleate-induced closure of the active site of Escherichia coli aspartate aminotransfer- ase. Eur J Biochem 268, 1640–1645.

20 Danishefsky AT, Onnufer JJ, Petsko GA & Ringe D

(1997) Cloning and sequencing of aspartate aminotrans- ferase from Thermus aquaticus YT1. Biochem Biophys Res Commun 239, 810–815.

(1991) Activity and structure of the active-site mutants R386Y and R386F of Escherichia coli aspartate amino- transferase. Biochemistry 30, 1980–1985.

21 Belitsky BR (2002) Biosynthesis of amino acids of the glutamate and aspartate families, alanine, and polyam- ines. In Bacillus subtilis and its Closest Relatives

32 Sung MH, Tanizawa K, Tanaka H, Kuramitsu S, Kagamiyama H & Soda K (1990) Purification and characterization of thermostable aspartate aminotrans- ferase from a thermophilic Bacillus species. J Bacteriol 172, 1345–1351.

FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS

1356

H.-J. Wu et al. Identification of a new aspartate aminotransferase

33 Mavrides C & Orr W (1974) Multiple forms of pluri-

39 Turano FJ, Wilson BJ & Matthews BF (1990) Purifica- tion and characterization of aspartate aminotransferase isoenzymes from carrot suspension cultures. Plant Phys- iol 92, 587–594.

specific aromatic: 2-oxoglutarate (oxaloacetate) amino- transferase (transaminase A) in Escherichia coli and selective repression by L-tyrosine. Biochem Biophys Acta 336, 70–78.

40 Price NC & Stevens L (1989) Fundamentals of Enzymol- ogy, 2nd edn, pp. 143–146. Oxford University Press, New York.

41 Thompson JD, Higgins DG & Gibson TJ (1994)

CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weight- ing, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673–4680.

42 Nicholas KB, Nicholas HB Jr & Deerfield DW II

34 Wilkie SE & Warren MJ (1998) Recombinant expres- sion, purification, and characterization of three isoen- zymes of aspartate aminotransferase from Arabidopsis thaliana. Protein Expr Purif 12, 381–389. 35 Ko¨ hler E, Seville M, Ja¨ ger J, Fotheringham I, Hunter M, Edwards M, Jansonius JN & Kirschner K (1994) Significant improvement to the catalytic properties of aspartate aminotransferase: role of hydrophobic and charged residues in the substrate binding pocket. Biochemistry 33, 90–97.

(1997) GeneDoc: Analysis and Visualization of Genetic Variation. EMBnet. news 4(2), 1–4.

43 Saitou N & Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4, 406–425.

44 Tamura K, Dudley J, Nei M & Kumar S (2007)

36 Collier RH & Kohlhaw G (1972) Nonidentity of the aspartate and the aromatic aminotransferase compo- nents of transaminase A in Escherichia coli. J Bacteriol 112, 365–371.

MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software, version 4.0. Mol Biol Evol 24, 1596–1599.

37 Mavrides C & Orr W (1975) Multispecific aspartate and aromatic amino acid aminotransferases in Escherichia coli. J Biol Chem 250, 4128–4133.

38 Yagi T, Kagamiyama H, Nozaki M & Soda K (1985)

Glutamate-aspartate transaminase from microorgan- isms. Methods Enzymol 113, 83–89.

FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS

1357

H.-J. Wu et al. Identification of a new aspartate aminotransferase