Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ

A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ Fanjie Meng, Thomas M. Suchyna and Frederick Sachs

Center for Single Molecule Biophysics, Department of Physiology and Biophysics, State University of New York at Buffalo, NY, USA

Keywords Cerulean; fluorescence resonance energy transfer; relative orientation factor; Venus; a-helix linker

Correspondence F. Sachs, Center for Single Molecule Biophysics, Department of Physiology and Biophysics, State University of New York at Buffalo, 3435 Main Street, Buffalo, NY, 14214 USA Fax: +1 716 829 2569 Tel: +1 716 829 3289 ext. 105 E-mail: sachs@buffalo.edu

(Received 15 December 2007, revised 9 April 2008, accepted 11 April 2008)

doi:10.1111/j.1742-4658.2008.06461.x

To measure mechanical stress in real time, we designed a fluorescence reso- nance energy transfer (FRET) cassette, denoted stFRET, which could be inserted into structural protein hosts. The probe was composed of a green fluorescence protein pair, Cerulean and Venus, linked with a stable a-helix. We measured the FRET efficiency of the free cassette protein as a function of the length of the linker, the angles of the fluorophores, temperature and urea denaturation, and protease treatment. The linking helix was stable to 80 (cid:2)C, unfolded in 8 m urea, and rapidly digested by proteases, but in all cases the fluorophores were unaffected. We modified the a-helix linker by adding and subtracting residues to vary the angles and distance between the donor and acceptor, and assuming that the cassette was a rigid body, we calculated its geometry. We tested the strain sensitivity of stFRET by linking both ends to a rubber sheet subjected to equibiaxial stretch. FRET decreased proportionally to the substrate strain. The naked cassette expressed well in human embryonic kidney-293 cells and, surprisingly, was concentrated in the nucleus. However, when the cassette was located into host proteins such a-actinin, nonerythrocyte spectrin and filamin A, the labeled hosts expressed well and distributed normally in cell lines such as 3T3, where they were stressed at the leading edge of migrating cells and relaxed at the trailing edge. When collagen-19 was labeled near its middle with stFRET, it expressed well in Caenorhabditis elegans, distributing simi- larly to hosts labeled with a terminal green fluorescent protein, and the worms behaved normally.

stress

the most

is one of

the cytoskeleton of

influential Mechanical physical factors in biology and one of the least charac- terized. Whereas it is obvious from molecular dyna- mics [1–4] and force spectroscopy [5–12] that forces deform molecules, the mechanics of cells are much more complicated, involving the interaction of hetero- geneous polymers and membranes and their interaction with both two-dimensional heterogeneous liquid mem- branes [13,14] and three-dimensional cytoplasmic solu- tions, where signaling factors can vary in time and space [15–17]. Mechanical interactions at the levels of

cells, organs and organisms are responsible for such familiar physiological functions as motor function, hearing [18], touch [19], and the regulation of blood pressure [20], but the interactions are also deeply embedded in the biochemistry of the cell, affecting such varied processes as the phenotype of stem cells [21], DNA transcription [22,23], translation of cellular components by motor proteins such as kinesin [5], stress-induced changes of structure, such as occur in shear stress modulation of the endothelia [24,25], and more general interactions due

Abbreviations CFP, cyan fluorescent protein; COL-19, collagen-19; D ⁄ A ratio, donor emission to acceptor emission ratio; DIC, differential interference contrast; E, fluorescence resonance energy transfer energy transfer efficiency; FRET, fluorescence resonance energy transfer; GFP, green fluorescent protein; HEK, human embryonic kidney; YPF, yellow fluorescent protein.

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3072

F. Meng et al.

Mechanical stress sensor

Results

to the physical chemistry of concentrated protein solu- tions [26]. To dissect which stresses affect which func- tions, we need labels that are sensitive to mechanical stress and that can be attached to specific proteins.

General configuration and FRET spectra of stFRET and its variants

To meet

that need, we designed a

cassette that can be inserted into struc- (denoted stFRET) strain via tural proteins and reports molecular changes in fluorescence resonance energy transfer (FRET), and, with appropriate calibration, molecular stress. The cassette consists of the green fluorescent (GFP) monomers Cerulean protein and Venus [27–31], linked by a stable a-helix [32]. This article characterizes the properties of the probes, and shows that they can be efficiently incorporated into struc- tural proteins such as collagen-19 (COL-19), nonery- throcyte spectrin, a-actinin and filamin A within living cells, and that the FRET from this cassette changes with stress in situ.

increases

Figure 1 is a diagram of stFRET geometry as deduced from the procedure described in Modeling and calibra- tion in the Experimental procedures. Figure 2A shows the general configuration of six stFRET variants. The inward arrows show the excitation wavelength, and the outward arrows show the emission wavelength. Width of arrows denotes light intensity. Figure 2B shows the alignment of the DNA sequence of the linker with five modified versions (the predicted geometrical changes are shown in Table 1). As shown in Table 1, according to the general property of a-helices, one amino acid deletion produces a change ()100(cid:2)) in angle with negli- gible change ()1.5 A˚ ) in length. A five residue deletion of the helix rotates the structure by 360(cid:2) but shrinks the helix by 2.7 nm. Deletion or addition of two and a half turns of the helix twists the structure by )180(cid:2) or the length by +180(cid:2) and decreases or 1.35 nm. Figure 2C gives the amino acid sequence and the segments of the helix linker that we modified. Deletion of 18 amino acids eliminates five turns of the helix, and a nine amino acid deletion eliminates two and half turns.

Figure 3A shows the emission spectrum of stFRET with excitation at 433 nm. There are peaks at 475 nm

The efficiency of energy transfer for a FRET pair is E (cid:3) 1 ⁄ [1 + (R ⁄ RO)6], where R is the distance between the dipoles and RO is the characteristic distance for 50% energy transfer [33]. The maximal sensitivity for changes in R occurs at R = RO. For Venus and Cerulean, RO is (cid:2) 5 nm [34], so we linked them with a 5 nm a-helix. The efficiency is affected by the angle between the transition dipoles as well as the distance between them, and we estimated the probe geometry by varying the number of residues in the linker. Removing one residue caused a large change in angle with a small change in distance, and adding or removing a full turn produced a change in distance with no change in angle. We used six mutants to solve for the three relevant angles of the dipoles, assuming that the cassette was rigid. stFRET was stable over temperature and mild urea denaturing conditions, but with 8 m urea, the linker unfolded and the fluorophores remained stable. Thus, stFRET is robust.

Fig. 1. Geometry of stFRET. D and A are donor and acceptor dipole vectors, and r is the length of the linker. The three angles (hA, hD, U) are the unknown parameters. RA–D is the distance between acceptor and donor chromophores.

Table 1. Changes in stFRET geometry caused by adding and delet- ing amino acids. Positive symbols indicate an increasing amount, and negative symbol indicate a decreasing amount.

No. amino acids added or subtracted

Change in length of linker (nm)

Change in angle of linker (radians)

)1 )2 +9 )9 )18

)0.15 )0.3 +1.35 )1.35 )2.7

5p ⁄ 9 10p ⁄ 9 p p 0

stFRET expressed well in various biological systems, including 3T3 and human embryonic kidney (HEK)- 293 cells and in Caenorhabditis elegans. After insertion into a variety of structural host proteins such as colla- gen, filamin, actinin and spectrin, it distributed in the same manner as the same hosts with terminal GFP tags. stFRET changed FRET with the spontaneous movement of motile cells, decreasing efficiency in in regions regions under tension and increasing it expected to be free of significant stress. By axially stretching C. elegans, we could demonstrate acute reversible changes in FRET associated with tension and relaxation. stFRET opens the door to studying in real time many physiological processes that are modu- lated or driven by mechanical stress.

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3073

F. Meng et al.

Mechanical stress sensor

A

B

C

Fig. 2. Construction of stFRET protein and five variants. (A) Schematic structure of stFRET. Cyan is the donor, Cerulean; yellow is the acceptor, Venus. The height of the b-can structure is 4.2 nm. The black helix is the linker, and it nominal length is 5.0 nm. Incoming arrows indicate excitation, and outgoing arrows indicate emission, with the wavelength marked next to them; the width of the arrows is proportional to the light intensity. (B) Alignment of the primary and modified linker DNA sequences. (C) Modifi- cations to the linker with DNA and amino acid sequences.

ratio = 0.47 ± 0.02, showing efficient energy transfer (for E and D ⁄ A ratio calculation, see Experimental procedures).

Calibration of three angles and j2

Confident in the origin of stFRET energy transfer, we purified the other five variants and measured their flu- orescence (Fig. 4A). All mutants exhibited robust FRET (Table 2). stFRET itself had 44 ± 2.5% energy transfer, and the 5T construct had the highest effi- ciency, E = 56 ± 4.5%, the 2.5T construct increased

for

and 527 nm, with the 475 nm emission from the donor Cerulean and 527 nm from the acceptor Venus having robust energy transfer. A 100 lm solution of unlinked donor and acceptor (1 : 1 mixture, green filled squares and line with 433 nm excitation) had a small emission at 527 nm due to the bleed-through from Cerulean, the donor (blue filled inverted triangle and line) and some direct excitation of the acceptor Venus by 433 nm (black triangle and line). The donor and accep- tor mixture had E = 0 and donor emission to acceptor emission ratio (D ⁄ A ratio) = 2.47 ± 0.05 (Fig. 3B). stFRET, E = 44 ± 2.5% and D ⁄ A However,

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3074

F. Meng et al.

Mechanical stress sensor

E to 47 ± 2.1%, whereas the 2.5I construct decreased E to 37 ± 0.9%. FT1AA and FT2AA, presumably only having their angles changed, decreased E to 29 ± 7.1% and 38 ± 4.3%, respectively (Fig. 4B). Table 2 summarizes the apparent change of angles and distances obtained by modifying the linker and the corresponding energy transfer efficiency.

1.95 over 30 min (Fig. 7B), as compared to a change from 0.46 to only 1.21 when the protein was treated with 8 m urea (Fig. 5B). Similar behavior was found for all six constructs (data not shown). The donor and acceptor fluorophore spectra were unaffected by pro- teinase K after 30 min of digestion (Fig. 7C,D). Figures 5E and 7E are diagrammatic models summa- rizing the energy transfer between donor and acceptor under different treatments (the width of the arrows represents signal intensity).

In vitro measurement of strain sensitivity

If we assume that a single residue alters the linker length by a translation of 0.15 nm and 100(cid:2), and that the structure is rigid, we can use the data in Table 2 to solve for the probe geometry (see Experimental proce- solutions gave hA = 3.83, dures). The numerical hD = )0.78 and U = 1.97 radians, and j2 = 0.86, which is 30% higher than 2 ⁄ 3, the j2 value that one would obtain assuming random rotation of the donor and acceptor (Fig. 1). However, it should be pointed out that a value of j2 (cid:2) 2 ⁄ 3 does not necessarily imply that the probes are moving randomly.

Stability of the linker as perturbed by urea, temperature, and proteinase K

To verify the strain responsiveness, we bonded the ends of derivatized stFRET to a silicone rubber sheet using StreptagII–Streptactin and stretched the sheet equibiaxially on the fluorescence microscope. When the C-terminal and N-terminal ends of stFRET were derivatized so that it would be stretched with the sheet, there was a reversible (cid:2) 11% decrease in the D ⁄ A ratio (Fig. 8). As a control, we measured FRET from stFRET that was derivatized at one end only so that it was simply immobilized but not stretched and there was no significant change in FRET with strain (Fig. 8). Nonspecific binding of double-tagged stFRET to an untreated silicone surface also produced no sig- nificant change in FRET with strain. Thus, stFRET is sensitive to strain, as expected from the solution assays and the design of the probe.

Eukaryotic expression and targeting property of stFRET

We did a number of tests to assess linker integrity. If the linker was an a-helix, then melting would increase the end–end spacing and the efficiency would decrease. With urea as a denaturant [35,36], Fig. 5A shows that the efficiency of stFRET declined with concentration up to 8 m, and the previously quenched donor emis- sion recovered. Remarkably, the fluorophore spectra were almost unaffected by urea, with < 10–15% change in amplitude (Fig. 5C,D). Figure 5B shows that 1–8 m urea caused the D ⁄ A ratio to increase from 0.46 to 1.21, as expected if the helix unfolded into a random coil allowing the donor and acceptor to move further apart and reducing energy transfer (Fig. 5E).

Before inserting stFRET into host proteins, we placed the gene under a eukaryotic promoter (human cyto- megalovirus) and transiently transfected HEK cells with stFRET alone. Control transfections with Venus or Cerulean monomers showed no preferential locali- zation and no obvious energy transfer (Fig. 9A–F). Cells transfected with stFRET displayed significant energy transfer (Fig. 9I). stFRET localized to the nucleus with an extremely high density in the nucleoli (Fig. 9K).

by

10–12

amino

separated

to the nuclear

clusters

similar

As a second test of the helix stability, we tried to melt stFRET at elevated temperatures, but the protein proved stable up to 80 (cid:2)C. Figure 6A shows the tem- 100 lm perature dependence of fluorescence of stFRET protein excited at 433 nm from room temper- ature to 80 (cid:2)C. Donor and acceptor emission both declined somewhat as the temperature increased, prob- ably due to a direct change in quantum efficiency, but there was no significant change in transfer efficiency from 60 (cid:2)C to 80 (cid:2)C, the upper limit of our measure- ments, so that the linker structure can be considered to be quite robust. As a final

test of

Nuclear targeting proteins have a consensus amino acid sequence of lysine ⁄ arginine [K ⁄ R(4–6)] or smaller clusters acids: [K ⁄ R(2)X(10–12)K ⁄ R(3)] [37]. The linker has multiple arginine targeting sequence, but simply removing one or the other fluoro- phores from stFRET produced a uniform cytoplasmic distribution showing that the linker’s sequence alone was not sufficient for targeting. These unexpected nuclear targeting properties of stFRET may provide

linker integrity, we digested stFRET with proteases that cut the linker but left the fluorophores intact. Figure 7 shows that proteinase K led to a rapid fall in efficiency that was complete within 1 min. The D ⁄ A ratio changed from 0.42 to

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3075

F. Meng et al.

Mechanical stress sensor

A

A

B

B

C

Fig. 3. FRET efficiency and D ⁄ A ratio (mean ± SD). (A) Spectra of stFRET, Cerulean and Venus monomers and Cerulean and Venus in a 1 : 1 mixture. Venus + Cerulean mixture, green filled squares. Donor Cerulean, blue inverted triangles and line. Acceptor Venus, black triangles and line. Pure stFRET protein, red filled circles and line. (B) FRET efficiency and D ⁄ A ratio of stFRET with Cerulean and Venus in a 1 : 1 mixture. Data were obtained with protein from three separate purifications. CV is Cerulean and Venus in a 1 : 1 mixture. FT, stFRET. Excitation 433 nm; emission 460–550 nm.

tool

for understanding nuclear protein

a useful transport.

Fig. 4. Modification of the linker change FRET efficiency of six con- structs. (A) Fluorescence spectra of stFRET and its five variants (scan parameters as in Fig. 3). (B) FRET efficiency of the six con- structs. (C) SDS ⁄ PAGE gel of the purified proteins, and Cerulean and Venus monomers. FT stands for stFRET; 5T and 2.5T are con- structs with five-turn or 2.5-turn deletions from the linker; 2.5I is the construct with a 2.5-turn insert; FT1AA and FT2AA are the con- structs with one amino acid or two amino acid deletions. All values are means ± SD, and the data were obtained with proteins from three separate purifications.

Host proteins of stFRET with normal expression showing stress sensitivity

and

filamin A (Fig. 10C),

located in the cytoplasm and ⁄ or the cell membrane, depending on the host (Fig. 10A,C,E). We expressed the construct of the most abundant collagen in C. elegans, COL-19, and the protein was properly assem- bled, showing the typical striated pattern, and the worms behaved normally. When we stretched the worm with micromanipulators, the labeled COL-19 showed a decrease in FRET efficiency with stretch, and in convex regions as it actively wiggled (Fig. 10G,H).

Figure 11 indicates

that

stFRET integrated into actinin and filamin can sense tension in situ. Migrating

We inserted stFRET into various host proteins, inclu- spectrin ding COL-19 (Fig. 10G), nonerythrocyte (Fig. 10E), a-actinin (Fig. 10A), and expression systems including HEK-293, 3T3 and C. elegans, and the insertion locations were optimized to obtain protein distributions similar to those observed for the host protein C-terminus tagged with GFP or Cerulean (Fig. 10B,D,F,H). Inserting stFRET into host proteins eliminated nuclear targeting. The fluorescence of stFRET in cultured cells was

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3076

F. Meng et al.

Mechanical stress sensor

Table 2. Values of parameters in Eqn (8) of six stFRET variants as described in Fig. 4.

Protein constructs

Energy transfer efficiency (E) (%)

r (linker length) (nm)

Z (H ⁄ 2 of b-Can) (nm)

hA (unknown parameter 1)

hD (unknown parameter 2)

U (unknown parameter 3)

2.1 No change

hA No change

hD No change

stFRET 5T 2.5T 2.5I FT1AA FT2AA

44 ± 2.5 56 ± 4.5 47 ± 2.1 37 ± 0.9 29 ± 7.1 38 ± 4.3

5.0 5.0 – 2.7 = 2.3 5.0 – 1.35 = 3.65 5.0 + 1.35 = 6.35 5.0 – 0.15 = 4.85 5.0 – 0.3 = 4.7

U U U + p U + p U + 5p ⁄ 9 U + 10p ⁄ 9

Fig. 5. Melting the linker. (A) Spectra from stFRET treated with 1–8 M urea (scan parameters as in Fig. 3B). (B) D ⁄ A ratio of stFRET after treatment with different con- centrations of urea (means ± SD, n = 3 in each treatment); increasing D ⁄ A ratio indi- cates the recovery of donor emission and decrease of energy transfer. (C) Cerulean monomer fluorescence with urea treat- ments (scan parameters as in Fig. 3). (D) Venus monomer fluorescence with urea (excitation at 515 nm and scan 520– 600 nm). (E) Urea melts the linker and leaves the donor and acceptor intact, decreasing FRET energy transfer as donor emission recoverers and D ⁄ A ratio increases (definitions as in Fig. 2A).

3T3 cells have a characteristic leading and lagging edge, and Fig. 11A–C shows the donor, acceptor and FRET images from three confocal microscopy chan-

nels. stFRET was distributed evenly across the cyto- plasm as visualized with a 16-color pseudocolor map actinin–stFRET (Fig. 11C,D).

Transfection with

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3077

F. Meng et al.

Mechanical stress sensor

A

Figure 11K is the FRET efficiency image in which three domains were selected. The efficiency in the red- outlined domain is twice as high as that in the blue and green domains (Fig. 11L). These data suggest that tension in both actinin and filamin is lower in domains close to the lagging edge (where adhesion to the sub- strate is released), and higher at the leading edge where adhesions pull the cell forward.

Discussion

B

Designed to be an in situ stress sensor, stFRET has robust and predictable energy transfer both in vitro and in vivo. We were able to explore the geometry of stFRET by perturbing the linker length and terminal angles using the known properties of a-helices. FRET efficiency changed in a predictable manner with the postulated geometry, suggesting that the fluorophores are not free to rotate. A recent molecular dynamics simulation study of FRET in lysozyme found that j and RO could be correlated by as much as 0.8, so that FRET measurements that assume random rotational freedom are likely to be in error [38]. The ability to change angle and distance by varying the linker can be used in vivo to examine the effect of host proteins on probe geometry. Regardless of the coupling of the flu- orophores to the linker, all of the host proteins that we studied were coiled-coiled dimers or trimers, so that the fluorophores of stFRET would not be able to rotate freely.

Fig. 6. a-Helix linker in stFRET is resistant to temperature melting. (A) stFRET spectra obtained at 60 (cid:2)C for 2 min, 60 (cid:2)C for 5 min, 70 (cid:2)C for 5 min and 80 (cid:2)C for 5 min (scan parameters as in Fig. 3). (B) stFRET D ⁄ A ratio after different temperature treatments (means ± SD, n = 3 in each treatment). Temperatures are given in degrees Celsius; roomtem, room temperature.

and U = 1.97,

hD = )0.78,

cells

the lagging edge revealed that during migration, showed higher energy transfer than the leading edge (Fig. 11E,F), i.e. it was relaxed. We measured the effi- ciency of various domains in the lagging and leading edges from 14 confocal image stacks. The lagging edges (the red-outlined domain) nearly doubled the FRET efficiency as compared to the leading edge (blue- and green-outlined domains). Multiple cells had the same behavior, but because of the complexity of the various shapes it was difficult to arrive at any use- ful statistic for frequency. We have shown a typical cell with different domains as an internal control. The same phenomenon was observed in filamin–stFRET- (Fig. 11G–L). Figure 11G–I transfected 3T3 shows three confocal image channels, and Fig. 11J is the pseudocolor image of stFRET protein distribution.

Figure 2A shows the predicted mean structure of free stFRET. The three unknown angles of Eqn (8) (see Experimental procedures) were solved using data for the six mutants using the least squares equation solver in maple. The solutions were stable to perturba- tions of the starting values, suggesting that we were measuring a constrained system. Our final solution was yielding hA = 3.83, j2 = 0.86. There will be bending and flexing motions of the structure in solution, but we obtained consistent answers from the overdetermined set of equations, sug- gesting that the calculated mean values are at least self-consistent. The geometric values that we have cal- culated would represent mean values weighted by the efficiency. Fluctuations that bring the dipoles closer are more heavily weighted than those that move them further away, although the probability of occupancy of these conformations is another weighting factor. A detailed molecular dynamics simulation would be use- ful, but is not essential for the use of stFRET as a probe of molecular stress, as the most important vari- ables are the differences in efficiency, i.e. the gradients of stress.

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3078

F. Meng et al.

Mechanical stress sensor

A

B

C

D

E

Proteinase K

Fig. 7. Two units of proteinase K (1 unitÆlL)1) digests the linker but not Cerulean or Venus. (A, C, D) Spectra of stFRET protein (A), Cerulean (C) and Venus (D) digested for 20 s, 1 min, 2 min, 3 min, 5 min, 10 min, 15 min and 30 min at room temperature with 200 lL of 100 lM protein. (B) Time course of D ⁄ A ratio for protein- ase K digestion of stFRET. (E) Proteinase K cleaved the linker and eliminated FRET in stFRET protein. PK, proteinase K; S, seconds; M, minutes; n = 3.

stFRET and provide misleading results. We saw no evidence of protease activity in HEK or 3T3 cells or C. elegans. However, the presence of intracellular proteases has been associated with acute pancreatitis, proposed to arise from trypsin overactivation in large endocytotic vacuoles of acinar cells [42]. Thus, to study pancreatitis, stFRET may be a useful probe (Fig. 7).

The robust nature of stFRET was clear from the melting experiments. stFRET was thermally stable up to at least 80 (cid:2)C, with the FRET efficiency being virtu- ally unchanged. Melting the linker with urea (Fig. 5) [39] left the fluorophores untouched (Fig. 5C,D), but decreased the energy transfer, consistent with unfold- ing of the linker (Fig. 5B,E). Two models have been proposed for urea-induced protein denaturation: the binding model, in which the denaturant binds weakly but specifically to sites exposed by the unfolded pro- teins [40], and a solvent exchange model, in which the interaction of the solvent and the denaturant is a one- for-one substitution reaction at particular sites [41]. stFRET might serve as a useful probe to examine these alternatives.

The sensitivity of stFRET to protease cleavage has both positive and negative implications. If proteases they could cleave are accidentally present

in situ,

Having established the basic physical properties of stFRET, we expressed it in HEK cells (Fig. 9) and evaluated the energy transfer by Xia’s method [43], using confocal microscopy. The surprising localization of stFRET to the nucleus was proved not to be a result of the linker possessing a consensus nuclear tar- geting sequence, as deletion of either fluorophore from the construct destroyed localization. This adaptability suggests that stFRET can serve as a useful probe of nuclear targeting.

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3079

F. Meng et al.

Mechanical stress sensor

100 mmHg

incorporated it

into host proteins,

1 s

spectrin,

3.0

11%

o

i t

2.5

a r T E R F

2.0

1.5

Untreated - double Strep-Tag2 Strep-tactin treated - double Strep-Tag2 Strep-tactin treated - single Strep-Tag2

Knowing how native stFRET itself distributes, including we nonerythrocyte filamin A and a-actinin (Fig. 10A,C,E) in 3T3 cells, and COL-19 in C. elegans (Fig. 10G). The distribution of the probe depended upon where the cassette was placed within the host. When it was inserted towards the middle, the fluores- cence distribution appeared similar to that of the host protein tagged with GFP or cyan fluorescent protein (CFP) at the C-terminus (Fig. 10B,D,F,H). Insertion of the cassette towards the termini of the host led to different spatial distributions. There is no gold stan- dard for the proper localization of proteins in cells, as fixation and exposure to various tracer ligands can produce changes in structure, but, to first order, the stFRET probes placed in the middle of the hosts appeared to cause minimal perturbation.

Fig. 8. Double Streptag II-tagged stFRET shows a decrease in FRET ratio when stretched on silicone rubber disks. Single and dou- ble Streptag II-tagged stFRETs were allowed to bind to either untreated or Strep-tactin-modified silicone disks. The FRET ratio was monitored in 10 spots on each disk during application of the suction stimulus shown. Only the disks with Strep-tactin-treated surfaces and stFRET proteins with Streptag tags at both the C-ter- minus and N-terminus showed a significant change in FRET ratio when stretched.

Under physiological conditions, FRET efficiency varied in different regions of the cells (Fig. 11), and these seemed to be correlated with the anticipated distribution of stress. Efficiency should be reduced when the host is under tension. Actinin–stFRET and filamin–stFRET generally showed lower efficiency than free stFRET (Fig. 3B), suggesting that those proteins were normally under tension (Fig. 11E,F,K,L, green-

B

A

C

D

E

F

H

G

I

J

K

L

Fig. 9. stFRET expressed in HEK-293 cells exhibits efficient FRET. (A–C) Confocal refer- ence image of Cerulean taken from the CFP channel (A) and the DIC channel (B), with the overlap in (C). (D–F) Reference image of Venus from the YFP (D) and DIC channels (E), with the overlap in (F). (G–K) Images of stFRET using the CFP channel (G), YFP channel (H), FRET channel (I) and DIC chan- nel (J), with the overlap of these four chan- nels in (K). (L) The vFRET index was calibrated pixel by pixel using Xia’s method [43]. Hollow black regions were excluded from the calculation because of intensity saturation. stFRET is localized in the nucleus and especially concentrated in the nucleoli (arrowheads).

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3080

F. Meng et al.

Mechanical stress sensor

A

B

efficiency associated with increased tension in the lead- ing edge as the cell was pulled forward.

D

C

F

E

To turn stFRET from a strain sensor into a stress sensor, we need to measure its force–distance properties. At the current time, we only have estimates from pub- lished atomic force microscopy data on the stretching of the coiled-coil myosin II [44]. Schweiger et al. [45] obtained a three-phase force–distance relationship: a linear phase of (cid:2) 1 mNÆm)1, a plateau of (cid:2) 25 pN, and a wormlike chain phase as the helices were stretched closer to the contour length. The presence of a force plateau implies that if monomeric stFRET was sub- jected to a force of > 10–25 pN, it would unfold in an all-or-none manner for about 3 nm, producing a large drop in FRET. We do not see this, probably in part because the in situ probes are not homomers, but are coiled coils where the stress is shared with labeled and unlabeled neighbors. It may be possible to knock down the background hosts to at least create homogeneously labeled hosts. In addition, stress is shared between different proteins within the cell, and at the current time, we are only probing one of those components.

H

G

stFRET can be applied to any biological system with large covalently bonded proteins. It is possible to examine the role of stress in selected proteins within cells or even within free-ranging organisms. With organ targeting in small organisms such as C. elegans and zebrafish, it should be possible to develop high- contrast video images of specific parts of the organism during controlled or natural behavior. We look for- ward to finding out how mechanical stress is coupled to biochemistry and to cell biology.

Experimental procedures

Gene construction and protein purification

Fig. 10. Normal expression of stFRET in various host proteins. a-Actinin–stFRET (A), a-actinin–GFP (B), filamin A–stFRET (C), filam- in A–CFP (D), spectrin–stFRET (E) and spectrin–CFP (F) in 3T3 fibro- blast cells; Collagen-19–stFRET (G) and COL-19–GFP (H) in C. elegans (with assistance of R. Gronostajski; Biochemistry Department, State University of New York at Buffalo, NY, USA). Arrowheads indicate the striated expression pattern and central line in the worm cuticle.

the with from pECFP-C1

line and blue-line domains). However, as cells migrate, the stress in the leading and trailing edges changes. Connections to the extracellular matrix in the lagging edge must be disengaged and the connections at the leading edge put under tension. Figure 11E,F,K,L shows increased FRET efficiency in the lagging edge as the filopodia were released from the substrate and tension decreased (red-line domains), and decreased

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3081

pEYFP-C1 Venus and pECFP-C1 Cerulean plasmids were generous gifts from D. W. Piston (Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, Nashville, TN, USA) [45]. The Cerulean gene was subcloned primers 5¢-GCAGGTGTGAATTCCATGGTGAGCAAGGGCGAG GAGC-3¢ and 5¢-CCAGATCGCGGCCGCCTTGTACAG CTCGTCATGCCGAGAG-3¢; EcoRI and ApaI restriction enzyme sites were introduced into the 5¢-end and 3¢-end of the Cerulean DNA fragment. This DNA fragment was inserted into multiple cloning sites of pEYFP-C1 Venus by EcoRI and ApaI digestion and ligation. The resulting vector has Venus followed closely by Cerulean, and between them there are two restriction enzyme sites, BglII and EcoRI, which then were employed to insert the a-helix linker. The a-helix linker DNA, 5¢-GGCCTGCGCAAGCGCTTACG

F. Meng et al.

Mechanical stress sensor

C

A

B

D

E

F

I

G

H

J

K

L

Fig. 11. stFRET senses the strain change in actinin and filamin. Actinin–stFRET-transfected 3T3 fibroblast confocal images were taken in three channels: (A) CFP donor channel, (B) FRET channel, and (C) YFP acceptor channel. Actinin–stFRET protein expression levels were displayed by applying the IMAGE J lookup table (LUT) 16-color color map to the YFP acceptor channel image. Arrows show the leading edge, lagging edge, and the cell domains with missing filopodia (D). FRET efficiency was calculated by E = nF ⁄ (nF + ID), in which nF is the net FRET from the FRET channel, and ID is the donor intensity from the donor channel. (E) The E-value was shown by the IMAGE J LUT 16-color color map. (F) Three cell domains were selected for statistical analysis of E, and 14 confocal stacks of each domain were measured and analyzed. (G–L) Histogram bars have the same colors as the related domains in (E). Filamin–stFRET confocal images. Three scan channels (G, H, I) are as for actinin–stFRET images. Arrangements and statistics of filamin–stFRET images (J, K, L) are as for actinin–stFRET images.

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3082

F. Meng et al.

Mechanical stress sensor

the into expression prokaryotic

pepstatin fluoride, 10 lgÆmL)1

IL, USA)

primer,

Cell culture and transfection

Plasmid DNA of six proteins constructs and Venus and Cerulean monomers were transformed into Escherichia coli cells [BL21(DE3pLacI) from Novagen, Gibbstown, NJ, USA] for expression. Proteins were purified as previously described [45]. Five hundred milliliters of LB broth contain- ing 50 mgÆmL)1 ampicillin was inoculated with 5 mL of overnight cell culture from a single colony of each construct. Cells were cultured at 37 (cid:2)C and with 250 r.p.m orbital shaking until the attenuance value reached 0.6. Isopropyl thio-b-d-galactoside (1 mm final concentration) (Sigma, St Louis, MO, USA) was applied to the culture to induce pro- tein expression, and the temperature was adjusted to 30 (cid:2)C for overnight expression. The cells were harvested by centri- fugation at 4000 g for 10 min at 4 (cid:2)C. The pellets were stored at )20 (cid:2)C for later use, or used immediately for the lysis step. Five milliliters of bugbuster protein extraction (Novagen) containing 25 unitsÆmL)1 Benzonase reagent (Novagen), 1000 unitsÆmL)1 rLysozyme(Sigma), 1 mm phen- and ylmethylsulfonyl 20 lgÆmL)1 leupeptin was used for protein extraction from each gram cell pellet. Cells were kept at room temperature for 30 min for the lysis. Soluble proteins were separated by centrifuging for 30 min at 10 000 g at 4 (cid:2)C. Ni–nitrilotriace- tic acid His-tag elution buffer (250 mm imidazole, 300 mm NaCl, 50 mm Na2HPO4, 0.2% Tween-20, pH 8.0) was added to the protein solution to give a final concentration of imidazole of 20 mm. One milliliter of Ni–nitrilotriacetic acid His.bind slurry (Novagen) was used per 4 mL of clear lysate, and gently mixed by shaking at 4 (cid:2)C for 60 min. The solution was loaded on a column and washed with 10 bed volumes of washing buffer (20 mm imidazole, 300 mm NaCl, 50 mm Na2HPO4, 0.2% Tween-20, pH 8.0) by grav- ity flow. Proteins retained on the column were washed off with elution buffer. The protein concentration was deter- mined with a bicinchoninic acid protein kit (Pierce, Rock- and measured with an ND-1000 ford, spectrophotometer (Nanodrop, Wilmington, DE, USA). SDS ⁄ PAGE analysis was used to check the protein purity. Proteins with > 95% purity were used for further assays; otherwise, proteins were dialyzed against Tris ⁄ HCl buffer (10 mm Tris ⁄ HCl, 1 mm dithiothreitol, 50 mm NaCl, 0.2% Tween-20, pH 7.4), and then the Ni–nitrilotriacetic acid His-tag purification procedure was repeated to achieve a purity of 95%. All purified proteins were finally exchanged into 10 mm Tris ⁄ HCl buffer with a Spectra ⁄ Pro Dispodya- lyzer (Spectrum, relative molecular mass cut-off 10 000) for further spectroscopy measurements.

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3083

AAAATTTAGAAACAAGATTAAAGAAAAGCTTAAA AAAATTGGTCAGAAAATCCAGGGTTTCGTGCCGAA ACTTGCAGGTGT-3¢, was synthesized by Operon (Hunts- ville, Alabama, USA) and amplified by PCR, and BglII and EcoRI sites were introduced into the 5¢-end and 3¢-end. The final construct with a-helix connecting Venus and Cerulean was named stFRET and was ready for eukaryotic expres- sion. In order to purify the protein, stFRET gene was vector subcloned PinPoint Xa-3 (Promega, Madison, WI, USA), using BamHI and NotI restriction sites, which were introduced into FRET DNA fragment by using the following prim- ers: 5¢-GCTTCAGCTGGGATCCGGTGGTATGGTGAG CAAGG-3¢; and 5¢-CCAGATCGCGGCCGCTTAGTGG TGATGATGGTGGTGATGATGCTTGTACAGCTCGT CC-3¢. Following the His8-tag, a TAA stop codon was inserted in front of the NotI site, to ensure that the His-tag was located in the C-terminus and was well exposed to the solution. By modifying the linker in PinPoint–stFRET con- structs, we created five other constructs and named them on the basis of the modification. They are: 5T, with five turns of the peptide chain truncated off the a-helix; 2.5T, with 2.5 the linker turns truncated off; 2.5I, with 2.5 turns of duplicated and inserted back into the a -helix; and FT1AA and FT2AA, with one and two amino acid residues deleted from the linker. The primers used for PCR were as follows: 5T sense primer, 5¢-GCGCAAGCGCTTACGAA AATTCGTGCCGAAACTTGCA-3¢; 5T antisense primer, 5¢-TTTTCGTAAGCGCTTGCGCTGCAAGTTTCGGCAC GAA-3¢; 2.5T sense primer, 5¢-GCGCAAGCGCTTACG ACTTAAAAAAATTGGTCAGAAAATCCAGG-3¢; 2.5T antisense primer, 5¢-CCTGGATTTTCTGACCAATTTTT TTAAGTCGTAAGCGCTTGCGC-3¢; 2.5I sense primer, 5¢-GAAACAAGATTAAAGAAAAGAAAATTTAGAAAC AAGATTAAAGAAAAGCTTAAAAAAATTGGTCAGA AAATC-3¢; 2.5I antisense primer, 5¢-GATTTTCTGAC CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA ATTTTCTTTTCTTTAATCTTGTTTC-3¢; FT1AA sense 5¢-GATTAAAGAAAAGCTTAAAATTGGTCA primer, 5¢-GGA GAAAATCC-3¢; FT1AA antisense TTTTCTGACCAATTTTAAGCTTTTCTTTAATC-3¢; FT2AA sense primer, 5¢-CAAGATTAAAGAAAAGCT TATTGGTCAGAAAATCC-3¢; FT2AA antisense primer, 5¢-GGATTTTCTGACCAATAAGCTTTTCTTTAATCT TG-3¢. All the insertions and deletions were performed with a site-directed mutagenesis kit from Stratagene (La Jolla, CA, USA). As host proteins for stFRET, the COL-19 gene was subcloned into the Pinpoint Xa-3 vector, and the filamin A, a-actinin and nonerythrocytic spectrin genes were subcloned into the pEYFP-C1 vector in which the yellow fluorescent protein (YFP) gene was deleted. Different sites in these host proteins were tested to maximally retain their function after integrating stFRET into them. All constructs were confirmed by sequencing data from Roswell Park Cancer institute (Buffalo, NY, USA). HEK-293 and 3T3 fibroblast cells were cultured in DMEM (Gibco, Gaithersburg, MD, USA) supplemented with 10% fetal bovine serum and antibiotics. Cells were spread on 3.5 mm coverslips and allowed to grow for 24 h, and 1.0 lg of plasmid DNA for each coverslip was delivered

F. Meng et al.

Mechanical stress sensor

D=ARatio ¼

ð2Þ

IDð475Emission;433ExcitationÞ IAð527Emission;433ExcitationÞ

Confocal microscopy and data analysis

into cells with a Fugene6 kit (Roche, Indianapolis, IN, USA). After 24–36 h of growth, cells displaying significant fluorescent protein expression were used for confocal microscopy.

Modeling and calibration

! is the donor dipole vector and G B

In Eqn (1), IDFree was obtained from a Cerulean ⁄ Venus 1 : 1 mixture, and IDA is the fluorescence intensity of the donor when it is linked to the acceptor; in Eqn (2), ID is the donor emission at 475 nm, and IA is the acceptor emis- sion at 527 nm. Excitation and emission wavelengths for data acquisition are shown in parentheses.

Cerulean-, Venus- and stFRET-transfected HEK cells were visualized with an LSM510 META confocal microscope (Carl Zeiss, Jena, Germany) 48 h after transfection. Ar laser (458 and 514 nm) lines were employed for excitation of FRET donor and acceptor. One multichannel stack of the confocal images of Cerulean, Venus and FRET was obtained with an oil-merged 63·, 1.4 numerical aperture apochromat objective lens (Carl Zeiss) and CFP, YFP or FRET filter sets; meanwhile, differential interference con- trast (DIC) images were taken. The sensitized emission method was used to collect the images from the donor channel, acceptor channel and FRET channel. Data acqui- sition and processing were performed with FRET plus macro with Xia’s method [43]. The normalized FRET index was calculated pixel by pixel with the equation

p NFRET ¼ IFRET (cid:3) IYFP (cid:4) a (cid:3) ICFP (cid:4) b ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi IYFP (cid:4) ICFP

! is equal and parallel to F E ! . B F ! . C E

RA(cid:3)D ¼ 2Z2ð1 (cid:3) sinhAsinhDcos/ þ coshAcoshDÞ

In vitro fluorescence energy transfer measurement

ð3Þ

þ 2rZðcoshD þ coshAÞ þ r2

in which the numerator is the net fluorescence energy trans- fer nFRET and constants a and b are the ratios of bleed- through of the YFP signal into the FRET channel and the CFP signal into the FRET channel [46]. For an a-helix, deletion of one amino acid changes the length by 0.15 nm and the angle between the termini by 100(cid:2). Assuming that the cassette was a rigid body, we made six mutants that would have known spacing and angles to calculate the probe geometry. Figure 1 is a diagram of stFRET geometry as deduced from the following proce- ! is the dure. H C ! acceptor dipole vector. RD–A (B C ) is the distance between ! donor and acceptor, and r (GH ) is the length of the linker. hA is the angle between the acceptor and the linker axis, and hD is the angle between donor and linker axis. hT is the angle between the acceptor and donor. U is the dihedral angle between plane (D. r) and plane (A. r). In the dia- ! , and both are perpen- gram, B I ! ! is is parallel and equal to I E dicular to line GH ! . Let CH = GB = Z; then Z is also perpendicular to E I the half-height of the Cerulean and Venus b-cans. After some trigonometry and algebra, we found that:

The relative orientation factor j2 and coshT are defined in [49] as:

ð5Þ

coshT ¼ sinhDsinhAcos/þcoshDcoshA

ð4Þ j2 ¼ ðcoshT (cid:3) 3coshDcoshAÞ2

We used a fluorescence spectrometer (Aminco, Bowman Series 2) to measure the fluorescence of purified proteins in solution. All purified proteins were exchanged into 10 mm Tris ⁄ HCl buffer before processing. The efficiency was usu- ally measured at room temperature with 200 lL of 100 lm protein. The spectrometer was set as follows: bandpass, 4 nm, 1 nm step size, and emission scan range 450–550 nm for measuring FRET, 450–500 nm for Cerulean monomer, and 520–600 nm for Venus monomer. Cerulean excitation was at 433 nm and Venus excitation was at 515 nm. The distance Ro, at which E = 50%, is given implicitly by [50]:

FRET efficiency

o ¼

0

Z 1 R6 f ðkÞeðkÞk4dk ¼ j2C ð6Þ 9000ðln10Þj2/d 128p5Nn4 We used two indexes of energy transfer; first [47]:

6 ⁄ (2 ⁄ 3) = 4.96 ⁄ (2 ⁄ 3). As

E ¼

ð7Þ

6

R6

R6 o o þ RA(cid:3)D

E ¼ IDFreeð475Emission;433ExcitationÞ (cid:3) IDAð475Emission;433ExcitationÞ IDFreeð475Emission;433ExcitationÞ where C is a constant characteristic of the spectral proper- ties of Cerulean and Venus and Ro = 4.9 nm [34], so that C = Ro ð1Þ

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3084

substituting Eqns (3,4,5,6) into Eqn (7) yielded: in which IDFree is the signal intensity of free donor, and IDA is the donor fluorescence intensity when connected to acceptor, and second [48]:

F. Meng et al.

Mechanical stress sensor

EstFRET ¼

ðsinhDsinhAcos/(cid:3)2coshDcoshAÞ2C ðsinhDsinhAcos/(cid:3)2coshDcoshAÞ2C þ ½ðZsinhDÞ2 þ ðZsinhAÞ2 (cid:3) 2Z2sinhDsinhAcos/þðr þ ZcoshAþZcoshDÞ2(cid:5)3 ð8Þ

Testing of the linker in purified stFRET

There are only three unknowns in Eqn (8), hA, hD and U, which determine the orientation factor j2 as well as the global configuration of the protein. With six linker mutants, we had six equations to calculate the three unknowns, which we did with a least squares solution in maple.

with suction from an HSPC-1 Pressure Clamp (ALA Instruments, Westbury, NY, USA) controlled by Axon Instruments pclamp software (Molecular Devices, Sunny- dale, CA, USA). Application of )200 mmHg of suction produced 10–15% strain (strained diameter ⁄ initial diame- ter). CFP–YFP emission intensities were monitored on an Axiovert 135 microscope (Zeiss) equipped with a Dual- View DV-CC beam splitter (Photometrics, Ottobrunn, Germany) with CFP–YFP splitter optics and an iXon DV- 887 EM cooled CCD camera (Andor, UK). The FRET ratio was determined using imagej software (NIH) to ana- lyze and process the video data of the stretched membrane. FRET ratio = (I535 – I535 CFP Bleed) ⁄ I470, where I470 = emission intensity at 470 nm, I535 = emission intensity at 535 nm, and I535 CFP Bleed = calculated fractional bleed of CFP fluorescence (0.9 · I470) into the 535 nm channel. The equibiaxial strain was measured by placing fiducial marks on the rubber and measuring the resulting strain.

Acknowledgements

Stretching stFRET on a silicone rubber sheet

We acknowledge the assistance of the Confocal Micro- scope and Flow Cytometry Facility in the School of Medicine and Biomedical Sciences, University at Buffalo, and Mr Jeff Niggel for assistance with the spectrofluorometer. We thank Dr Richard M. Grono- stajski and Dr Elena Lazakovitch for helping us to make transgenic worms. This work was supported by the NIH.

Purified proteins were subjected to proteinase K digestion, temperature and or urea melting. One unit of proteinase K (500 unitsÆmL)1) was used to digest 200 lL of protein solu- tion (100 lm) in Hepes buffer (100 mm Hepes, 100 mm NaCl, 10 mm Na2HPO4, pH 7.4) for 20 s, 1 min, 2 min, 5 min, 10 min or 30 min. Cerulean and Venus monomers were also treated with proteinase K under the same condi- tions as used for controls. For urea treatment, we used 10 lL of protein (10 mgÆmL)1 in 10 mm Tris ⁄ HCl buffer) diluted into 200 lL of 8 m, 7 m, 6 m, 5 m, 4 m, 3 m, 2 m, 1 m of Hepes buffer or Hepes buffer only, and incubation at room temperature for 10 min. Thermal melting was done by heating the stFRET solutions to 60 (cid:2)C, 70 (cid:2)C and 80 (cid:2)C for 2–5 min and immediately measuring the fluorescence energy transfer with a spectrometer.

References

1 Ortiz V, Nielsen SO, Klein ML & Discher DE (2005) Unfolding a linker between helical repeats. J Mol Biol 349, 638–647.

Silicone rubber disks with amino modified surfaces (Flexcell International, Hillsborogh, NC, USA) were converted to carboxyl groups with 0.1 mm methyl N-succinimidyl adi- pate in NaCl ⁄ Pi for 1 h at room temperature. These groups were converted to crosslinkers by treating them with 2 mm 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochlo- ride and 5 mm N-hydroxysuccinimide in 0.1 m Mes buffer (pH 6) for 15 min. Strep-tactin (a streptavidin variant; IBA, St Louis, MO, USA) at 1 mgÆmL)1 in NaCl ⁄ Pi was then crosslinked to the surface for 2 h at room tempera- ture.

2 Craig D, Gao M, Schulten K & Vogel V (2004) Struc- tural insights into how the MIDAS ion stabilizes inte- grin binding to an RGD peptide under force. Structure 12, 2049–2058.

3 Kosztin I, Bruinsma R, O’Lague P & Schulten K (2002) Mechanical force generation by G proteins. Proc Natl Acad Sci USA 99, 3575–3580. 4 Marszalek PE, Lu H, Li H, Carrion-Vazquez M, Obe-

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3085

(Flexcell rhauser AF, Schulten K & Fernandez JM (1999) Mechanical unfolding intermediates in titin modules. Nature 402, 100–103. Derivatized stFRET proteins were constructed with Streptag II linked to the C-terminaus for single-tagged stFRET and to the C-terminus and N-terminus for double- tagged stFRET. These proteins were allowed to bind over- night to untreated and to Strep-tactin-modified disks in NaCl ⁄ Pi ⁄ 0.05% Tween-20 ⁄ 1% BSA. The disks were then washed three times for 2 h with NaCl ⁄ Pi ⁄ 0.05% Tween- 20 ⁄ 1% BSA. Membranes were placed on a modified Stage- Flexer International, Hillsborogh, NC, USA), which allowed us to apply equibiaxial strain to the disks

F. Meng et al.

Mechanical stress sensor

5 Carter NJ & Cross RA (2006) Kinesin’s moonwalk. stem cell differentiation. Proc Natl Acad Sci USA 104, 15619–15624. Curr Opin Cell Biol 18, 61–67. 22 Rief M, Clausen-Schaumann H & Gaub HE (1999)

6 Gosse C & Croquette V (2002) Magnetic tweezers: micromanipulation and force measurement at the molecular level. Biophys J 82, 3314–3329. Sequence-dependent mechanics of single DNA mole- cules. Nat Struct Biol 6, 346–349. 7 Wang MD, Yin H, Landick R, Gelles J & Block SM

(1997) Stretching DNA with optical tweezers. Biophys J 72, 1335–1346. 23 Clausen-Schaumann H, Rief M, Tolksdorf C & Gaub HE (2000) Mechanical stability of single DNA mole- cules. Biophys J 78, 1997–2007. 8 Brown AEX, Litvinov RI, Discher DE & Weisel JW 24 Inai T, Mancuso MR, McDonald DM, Kobayashi J,

(2007) Forced unfolding of coiled-coils in fibrinogen by single-molecule AFM. Biophys J 92, L39–L41. 9 Lu ZY, Nowak W, Lee GR, Marszalek PE & Yang Nakamura K & Shibata Y (2004) Shear stress-induced upregulation of connexin 43 expression in endothelial cells on upstream surfaces of rat cardiac valves. Histo- chem Cell Biol 122, 477–483.

WT (2004) Elastic properties of single amylose chains in water: a quantum mechanical and AFM study. J Am Chem Soc 126, 9033–9041. 10 Walther KA, Brujic J, Li H & Fernandez JM (2006) 25 Papadaki M & Eskin SG (1997) Effects of fluid shear stress on gene regulation of vascular cells. Biotechnol Prog 13, 209–221. 26 Garcia-Perez AI, Lopez-Beltran EA, Kluner P, Luque

Sub-angstrom conformational changes of a single mole- cule captured by AFM variance analysis. Biophys J 90, 3806–3812. 11 Sarkar A, Caamano S & Fernandez JM (2005) The J, Ballesteros P & Cerdan S (1999) Molecular crowding and viscosity as determinants of translational diffusion of metabolites in subcellular organelles. Arch Biochem Biophys 362, 329–338.

elasticity of individual titin PEVK exons measured by single molecule atomic force microscopy. J Biol Chem 280, 6261–6264.

27 Erickson MG, Alseikhan BA, Peterson BZ & Yue DT (2001) Preassociation of calmodulin with voltage-gated Ca(2+) channels revealed by FRET in single living cells. Neuron 31, 973–985.

12 Li H & Fernandez JM (2003) Mechanical design of the first proximal Ig domain of human cardiac titin revealed by single molecule force spectroscopy. J Mol Biol 334, 75–86. 13 Lele TP, Sero JE, Matthews BD, Kumar S, Xia S, 28 Tolar P, Sohn HW & Pierce SK (2005) The initiation of antigen-induced B cell antigen receptor signaling viewed in living cells by fluorescence resonance energy transfer. Nat Immunol 6, 1168–1176.

29 Joo C, McKinney SA, Nakamura M, Rasnik I, Myong S & Ha T (2006) Real-time observation of RecA fila- ment dynamics with single monomer resolution. Cell 126, 515–527. 30 Qiao W, Mooney M, Bird AJ, Winge DR & Eide DJ Montoya-Zavala M, Polte T, Overby D, Wang N & Ingber DE (2007) Tools to study cell mechanics and mechanotransduction. Cell Mechanics 83, 443–472. 14 Matthews BD, Thodeti CK & Ingber DE (2007) Activa- tion of mechanosensitive ion channels by forces trans- mitted through integrins and the cytoskeleton. Mechanosensitive Ion Channels A 58, 59–85. 15 Discher DE, Boal DH & Boey SK (1998) Simulations (2006) Zinc binding to a regulatory zinc-sensing domain monitored in vivo by using FRET. Proc Natl Acad Sci USA 103, 8674–8679. 31 Ha T, Rasnik I, Cheng W, Babcock HP, Gauss GH, of the erythrocyte cytoskeleton at large deformation. II. Micropipette aspiration. Biophys J 75, 1584–1597. 16 Boey SK, Boal DH & Discher DE (1998) Simulations

Lohman TM & Chu S (2002) Initiation and re-initiation of DNA unwinding by the Escherichia coli Rep helicase. Nature 419, 638–641. of the erythrocyte cytoskeleton at large deformation. I. Microscopic models. Biophys J 75, 1573–1583. 17 Discher DE, Mohandes N & Evans EA (1994) Molecu-

lar maps of red cell deformation: hidden elasticity and in situ connectivity. Science 266, 1032–1036.

18 Hudspeth AJ, Choe Y, Mehta AD & Martin P (2000) Putting ion channels to work: mechanoelectrical trans- duction, adaptation, and amplification by hair cells. Proc Natl Acad Sci USA 97, 11765–11772. 32 Chen C, Brock R, Luh F, Chou PJ, Larrick JW, Huang RF & Huang TH (1995) The solution structure of the active domain of CAP18 – a lipopolysaccharide binding protein from rabbit leukocytes. FEBS Lett 370, 46–52. 33 Fo¨ rster T (1949) Experimentelle und theoretische Un- tersuchung des zwischenmolekularen Ubergangs von Elektronenanregungsenergie. Z Naturforsch A 4, 321– 327.

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3086

34 Patterson GH, Piston DW & Barisas BG (2000) Forster distances between green fluorescent protein pairs. Anal Biochem 284, 438–440. 19 Gillespie PG & Walker RG (2001) Molecular basis of mechanosensory transduction. Nature 413, 194–202. 20 Acher R (2002) Water homeostasis in the living: molec- ular organization, osmoregulatory reflexes and evolu- tion. Ann D Endocrinol 63, 197–218. 21 Pajerowski JD, Dahl KN, Zhong FL, Sammak PJ & 35 Courtenay ES, Capp MW, Saecker RM & Record MT Jr (2000) Thermodynamic analysis of interactions between denaturants and protein surface exposed on Discher DE (2007) Physical plasticity of the nucleus in

F. Meng et al.

Mechanical stress sensor

43 Xia Z & Liu Y (2001) Reliable and global measurement of fluorescence resonance energy transfer using fluores- cence microscopes. Biophys J 81, 2395–2402. 44 Schwaiger I, Sattler C, Hostetter DR & Rief M (2002) unfolding: interpretation of urea and guanidinium chlo- ride m-values and their correlation with changes in accessible surface area (ASA) using preferential interac- tion coefficients and the local-bulk domain model. Pro- teins (Suppl. 4), 72–85. The myosin coiled-coil is a truly elastic protein struc- ture. Nat Materials 1, 232–235.

36 Tezuka-Kawakami T, Gell C, Brockwell DJ, Radford SE & Smith DA (2006) Urea-induced unfolding of the immunity protein Im9 monitored by spFRET. Biophys J 91, L42–L44. 45 Rizzo MA, Springer GH, Granada B & Piston DW (2004) An improved cyan fluorescent protein variant useful for FRET. Nat Biotechnol 22, 445–449. 37 Christophe D, Christophe-Hobertus C & Pichon B

(2000) Nuclear targeting of proteins: how many differ- ent signals? Cell Signalling 12, 337–341.

46 Youvan DC, Silva CM, Bylina EJ, Coleman WJ, Dil- worth MR & Yang MM (1997) Calibration of fluores- cence resonance energy transfer in microscopy using genetically engineered GFP derivatives on nickel chelat- ing beads. Biotechnol Alia 3, 1–18. 38 Vanbeek DB, Zwier MC, Shorb JM & Krueger BP (2007) Fretting about FRET: correlation between {kappa} and R. Biophys J 92, 4168–4178.

47 Gordon GW, Berry G, Liang XH, Levine B & Herman B (1998) Quantitative fluorescence resonance energy transfer measurements using fluorescence microscopy. Biophys J 74, 2702–2713. 48 Yudushkin IA, Schleifenbaum A, Kinkhabwala A, Neel 39 Scholtz JM, Barrick D, York EJ, Stewart JM & Bald- win RL (1995) Urea unfolding of peptide helices as a model for interpreting protein unfolding. Proc Natl Acad Sci USA 92, 185–189. 40 Schellman JA (1987) Selective binding and solvent denaturation. Biopolymers 26, 549–559. BG, Schultz C & Bastiaens PI (2007) Live-cell imaging of enzyme–substrate interaction reveals spatial regula- tion of PTP1B. Science (NY) 315, 115–119.

41 Schellman JA (1990) A simple model for solvation in mixed solvents. Applications to the stabilization and destabilization of macromolecular structures. Biophys Chem 37, 121–140. 42 Sherwood MW, Prior IA, Voronina SG, Barrow SL, 49 Dale RE, Eisinger J & Blumberg WE (1979) The orien- tational freedom of molecular probes. The orientation factor in intramolecular energy transfer. Biophys J 26, 161–193. 50 Forster VT (1948) Zwischenmolekulare energiewande- rung und fluoreszenz. Ann Phys 6, 54–75.

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3087

Woodsmith JD, Gerasimenko OV, Petersen OH & Tep- ikin AV (2007) Activation of trypsinogen in large endo- cytic vacuoles of pancreatic acinar cells. Proc Natl Acad Sci USA 104, 5674–5679.