intTypePromotion=1
ADSENSE

Giám định và đánh giá đa dạng di truyền loài xá xị (Cinnamomum parthenoxylon (Jack) Meisn)

Chia sẻ: _ _ | Ngày: | Loại File: PDF | Số trang:12

5
lượt xem
1
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Bài viết Giám định và đánh giá đa dạng di truyền loài xá xị (Cinnamomum parthenoxylon (Jack) Meisn) nghiên cứu sự đa dang di truyền loài xá xị tại Vườn Quốc gia Tam Đảo, tỉnh Vĩnh Phúc để đưa ra chiến lược bảo tồn và phát triển nguồn gen loài cây có giá trị này.

Chủ đề:
Lưu

Nội dung Text: Giám định và đánh giá đa dạng di truyền loài xá xị (Cinnamomum parthenoxylon (Jack) Meisn)

  1. Công nghệ sinh học & Giống cây trồng GIÁM ĐINH ̣ VÀ ĐÁNH GIÁ ĐA DẠNG DI TRUYỀN LOÀ I XÁ XI ̣ (Cinnamomum parthenoxylon (Jack) Meisn) TẠI VƯỜN QUỐC GIA TAM ĐẢO BẰNG CHỈ THI ̣ ADN MÃ VẠCH Hà Bı́ch Hồ ng1, Nguyễn Thế Hưởng1, Nguyễn Thị Lan Anh2, Phùng Văn Phê1, Hoàng Văn Sâm1, Nguyễn Xuân Vinh3 1 Trường Đại học Lâm nghiê ̣p 2 Công ty TNHH Vestergaard Frandsen Vietnam 3 Trường THPT Chương Mỹ A TÓM TẮT Xá xị (Cinnamomum parthenoxylon (Jack) Meisn) là loài cây gỗ cao cấp cho giá trị kinh tế cao, có nguồ n gen hiếm được xếp trong nhóm IIA (Nghị định 06/2019/NĐ-CP của Chính phủ năm 2019) và nhóm CR cực kỳ nguy cấp. Loài cây này có khả năng tái sinh tự nhiên kém và bi ̣ khai thác bừa bãi để cất tinh dầu nên chúng đang đứng trước nguy cơ tuyệt chủng và cầ n đươ ̣c bảo tồ n, phát triể n trong tự nhiên. Trong nghiên cứu này, ba chı̉ thi ̣ ADN mã va ̣ch là matK, rbcL, và trnH-psbA đươ ̣c sử du ̣ng để giám đinh ̣ và phân tı́ch đa da ̣ng di truyề n của các cây Xá xi ̣ điề u tra đươ ̣c ta ̣i vườn quố c gia Tam Đảo, tı̉nh Vıñ h Phúc. Kế t quả cho thấ y cả ba chı̉ thi ̣ ADN mã va ̣ch đề u cho hiê ̣u quả giám đinh ̣ loài Xá xi,̣ trong đó chı̉ thi ̣ trnH-psbA có hiê ̣u quả giám đinh ̣ loài thấ p hơn so với chı̉ thi ̣ matK và rbcL. Trı̀nh tự trnH-psbA đươ ̣c cho là chı̉ thi ̣ hiê ̣u quả trong phân tı́ch đa da ̣ng di truyề n giữa các cây Xá xi ̣ta ̣i Vườn quố c gia Tam Đảo, cu ̣ thể vi ̣trı́ nucleotide bảo thủ (không biế n đổ i) giữa 07 mẫu nghiên cứu là 453 nucleotide, còn số vi ̣trı́ biế n đổ i là 10 nucleotide với 06 vi ̣trı́ có ý nghıã tiế n hóa thể hiê ̣n sự khác biê ̣t giữa ba mẫu trở lên. Chı̉ số đa da ̣ng haplotype tương đố i cao (Hd = 0,9524) và chı̉ số đa da ̣ng nucleotide thấ p (Pi = 0,00926). Kế t quả về giám đinh ̣ và đánh giá đa da ̣ng di truyề n loài Xá xi ̣ ta ̣i Vườn quố c gia Tam đảo là cơ sở khoa ho ̣c để đưa ra giải pháp bảo tồ n và phát triể n hữu hiê ̣u loài cây này. Từ khóa: đa da ̣ng di truyề n, ADN mã va ̣ch, Xá xi,̣ Cinnamomum parthenoxylon. 1. ĐẶT VẤN ĐỀ hình bầu dục thuôn; đầu có mũi nhọn, ngắn; Xá xi ̣ (Cinnamomum parthenoxylon (Jack) gốc hình nêm hay nêm rộng; hai mặt nhẵn; gân Meisn) là loài cây gỗ, kích thước trung bình bên 3-8 đôi; cuống lá dài 1,2-3 cm. Cụm hoa hoặc lớn; thân hình trụ thẳng, cao 20-25 m, dạng chuỳ hay tán; mọc ở đầu cành hay nách đường kính thân 40-70 cm; gốc cây phình to và lá; mỗi cụm mang khoảng 10 hoa. Quả mọng, đôi khi có bạnh gốc. Vỏ ngoài màu nâu, nâu hình cầu, đường kính 0,6-1 cm; đế hình chén, xám đến xám đậm, thường nứt dọc và bong ra có khía răng, khi chín màu xanh vàng hoặc tím từng mảng; thịt vỏ có màu nâu đỏ nhạt. Lá đơn đen (Hı̀nh 1). nguyên, mọc cách; phiến lá hình trứng hay Hın ̀ h 1. Cành mang hoa và quả cây Xá xị ở Tam Đảo, Vĩnh Phúc (Phùng Văn Phê, 2019) Ta ̣i Vườn quố c gia Tam Đảo tı̉nh Vĩnh Phúc, cầm máu, chữa đau dạ dày, phong thấp, mẩn Xá xị phân bố rải rác chủ yếu thuộc kiểu rừng ngứa ngoài da. Quả được dùng chữa cảm, sốt, lỵ, thứ sinh nhân tác. Số lượng cá thể Xá xị tìm thấy ho gà. Tinh dầu Xá xị được sử dụng rộng rãi ở đây còn rất ít khoảng 10 cây (Phùng Văn Phê, trong công nghệ hoá mỹ phẩm, thực phẩm và 2019). Xá xị cho gỗ tốt, có vân đẹp, khi khô ít bị dược phẩm, do đó có giá tri ̣ thương ma ̣i rấ t lớn nứt nẻ hay biến dạng, không bị mối mọt, chịu trên thi ̣trường thế giới (Nguyễn Tiế n Bân, 2003; nước, dễ gia công chế biến. Lá dùng làm thuốc Pha ̣m Hoàng Hô ̣, 1999). TẠP CHÍ KHOA HỌC VÀ CÔNG NGHỆ LÂM NGHIỆP SỐ 6 - 2021 13
  2. Công nghệ sinh học & Giống cây trồng Là loài cây có giá tri ̣ kinh tế cao lại cộng và kế t luâ ̣n rằ ng ADN mã va ̣ch là mô ̣t trơ ̣ giúp thêm khả năng tái sinh tự nhiên kém, bi ̣ khai đáng kể trong đánh giá đa da ̣ng sinh ho ̣c và xác thác bừa bãi để cất tinh dầu làm cho loài Xá xi ̣ đinh ̣ các quầ n thể cây ngay cả khi chúng không đang đứng trước nguy cơ tuyệt chủng. Do vậy, thể phân biê ̣t đươ ̣c tấ t cả các loài trong lô bảo tồn nguồn gen Xá xị là việc làm hết sức (Costion et al., 2011). ADN mã va ̣ch đươ ̣c sử cấp thiết. Tuy nhiên, để công tác bảo tồn có du ̣ng để giải quyế t vấ n đề bảo tồ n đa da ̣ng sinh hiệu quả, cần phối hợp đồng bộ cả biện pháp ho ̣c theo hai cách sau: (1) Là mô ̣t phương tiê ̣n bảo tồn ngoại vi và bảo tồn nội vi. Trong đó giám sát đa da ̣ng sinh ho ̣c chıń h xác và nhanh giải pháp tối ưu và thiết thực nhất đó là nghiên chóng cả trước và sau các hành đô ̣ng bảo tồ n, cứu phát triển cùng với các chương trình trồng (2) Cung cấ p dữ liê ̣u để hỗ trơ ̣ trong viê ̣c ước rừng (Sách Đỏ Viê ̣t Nam, 2007). Những tıń h sự đa da ̣ng phát sinh loài để thiế t lâ ̣p các nghiên cứu về đă ̣c điể m sinh ho ̣c, sinh thái và ưu tiên bảo tồ n (Krishnamurthy và mô ̣t số biê ̣n pháp nhân giố ng của loài Xá xi ̣ đã Francis, 2012). đươ ̣c thực hiê ̣n (Lê Đı̀nh Khả, 2003; Phùng Trên đố i tươ ̣ng các loài thuô ̣c ho ̣ Long Não Văn Phê, 2012). Tuy nhiên, những nghiên cứu (Lauraceae), nhóm nghiên cứu của Liu (Liu et về đinḥ danh loài và đánh giá đa da ̣ng di truyề n al., 2016) đã sử du ̣ng 04 trıǹ h tự ADN mã va ̣ch dựa trên các chı̉ thi ̣ phân tử của cây Xá xi ̣ la ̣i là matK, rbcL, trnH-psbA và ITS2 để đánh giá chưa đươ ̣c thực hiê ̣n ta ̣i Viê ̣t Nam. Do đó, mu ̣c hiê ̣u quả phân biê ̣t loài. Kế t quả cho thấ y, trıǹ h tiêu của đề tài là đinh ̣ danh và nghiên cứu sự tự ITS2 không phù hơ ̣p để làm mã va ̣ch cho đa da ̣ng di truyề n loài Xá xi ̣ta ̣i Vườn Quố c gia các loài thuô ̣c ho ̣ Long naõ . Trı̀nh tự matK và Tam Đảo, tın̉ h Vıñ h Phúc để đưa ra chiế n lươ ̣c rbcL có tỷ lê ̣ đinh ̣ danh loài thành công lầ n bảo tồ n và phát triể n nguồ n gen loài cây có giá lươ ̣t là 30,9% và 25,0%. Trong khi đó trıǹ h tự tri ̣này. trnH-psbA có khả năng xác đinh ̣ loài tố t với tỷ Hiê ̣n nay, ADN mã va ̣ch đã đươ ̣c chứng lê ̣ đa ̣t 84,0%. Nghiên cứu cũng cho thấ y viê ̣c minh là những chı̉ thi ̣ phân tử có đô ̣ chı́nh xác sử du ̣ng chı̉ thi ̣ trnH-psbA có hiê ̣u quả xác cao trong viê ̣c đinh ̣ danh loài và đánh giá đa đinh ̣ loài trong ho ̣ Long naõ cao hơn hẳ n các da ̣ng di truyề n. Đặc điểm quan trọng nhất của chı̉ thi ̣ matK, rbcL, hay sự kế t hơ ̣p của cả ADN mã va ̣ch là phải phổ biến và đặc hiệu matK và rbcL. Sudmoon et al. (2014) đã sử trong các biến dị và dễ dàng sử dụng. Điều này dụng các vùng rpoB, rbcL và matK để xác có nghĩa là các đoạn gen được sử dụng như định bảy loài đã biết là Cinnamomum một mã va ̣ch nên thích hợp cho nhiều đơn vị aromaum (dầu cassia), C. camphora (dầu cây phân loại, có sự biến đổi giữa các loài nhưng xá xị và lá ho), C. bejolghota, C. tamala, C. ổn định và bảo thủ cao bên trong loài hoặc biến zeylanicum (C. verum) và C. burmannii và bảy đổi không đáng kể. Do đó, ADN mã va ̣ch lý loài chưa biết là các loài quế (họ Long não). So tưởng là một đoạn ADN có trình tự nucleotide sánh với một số trình tự từ Ngân hàng gen, ngắn, bắt cặp được với cặp mồi được thiết kế khoảng cách di truyền ở các vùng gen matK, đặc hiệu để dễ dàng khuếch đại bằng PCR. Ở rbcL và rpoB lần lượt là 0,00 đến 0,52; 0,00 thực vâ ̣t, các đoa ̣n ADN mã va ̣ch có thể là đến 0,36 và 0,00 đến 0,30. Nhưng ba vùng những đoa ̣n ADN nằ m trong hê ̣ gen nhân (28S rpoB, rbcL và matK không thể được sử dụng rDNA, ITS,…) (Baharum, 2012; Chen, 2010; để xác định nhóm loài Cinnamomum vì không Schoch et al., 2012) hoă ̣c hê ̣ gen lu ̣c la ̣p (matK, có sự khác biệt về trình tự giữa nhiều loài khác rbcL, trnH – psbA, rpo, trnL-trnF, ycf, ...) (Yu nhau. et al., 2011; Hollingsworth, 2011). Ba mã va ̣ch Mô ̣t số nghiên cứu về đa da ̣ng di truyề n các ADN là rbcL, matK, trnH-psbA đươ ̣c sử du ̣ng loài Cinnamomum dựa trên chı̉ thi ̣ RAPD đố i để đánh giá sự đa da ̣ng của các loài cây trong với loài C. zeylanicum cho thấ y 89% biế n đổ i mô ̣t lô rừng mưa nhiê ̣t đới ta ̣i Queensland, Ú c di truyề n giữa các mẫu nghiên cứu 14 TẠP CHÍ KHOA HỌC VÀ CÔNG NGHỆ LÂM NGHIỆP SỐ 6 - 2021
  3. Công nghệ sinh học & Giống cây trồng (Sandigawad và Patil, 2011), chı̉ thi ̣ EST-SSR khác biê ̣t di truyề n đáng kể giữa các quầ n thể đố i với loài C. camphora ta ̣i miề n Nam Trung đươ ̣c phát hiê ̣n (Zhang et al., 2021). Quố c sử du ̣ng chı̉ thi ̣ EST-SSR cho thấ y sự 2. PHƯƠNG PHÁP NGHIÊN CỨU khác biê ̣t di truyề n giữa các quầ n thể là thấ p, 2.1. Lựa chọn mẫu và cách lấy mẫu chı̉ 17% biế n đổ i đươ ̣c quan sát giữa các quầ n Lá của 07 cây Xá xi ̣đươ ̣c thu thâ ̣p từ Vườn thể (Zhong et al., 2019), kế t hơ ̣p chı̉ thi ̣ EST- Quố c gia Tam Đảo, tı̉nh Vıñ h Phúc. Các mẫu SSR và cpADN loài C. chago ta ̣i tın ̉ h Vân đươ ̣c kı́ hiê ̣u như sau: VP 01, VP 02, VP 03, Nam, Trung Quố c cho thấ y 5 quầ n thể nghiên VP 04, VP 05, VP 07, và VP 12 (Bảng 1). cứu có mức đa da ̣ng di truyề n thấ p nhưng sự Bảng 1. Điạ điể m và thời gian thu thâ ̣p các mẫu Xá xi ta ̣ ̣i vườn Quố c gia Tam Đảo Thời gian Tọa độ STT Ký hiêụ mẫu Địa điểm thu nhận mẫu thu mẫu Kinh độ (m) Vĩ độ (m) 1 VP 01 Minh Quang – Tam Đảo 9/2019 565059 2372626 2 VP 02 Minh Quang – Tam Đảo 9/2019 565617 2371482 3 VP 03 Hồ Sơn – Tam Đảo 9/2019 565599 2371517 4 VP 05 Hồ Sơn – Tam Đảo 9/2019 565154 2371501 5 VP 06 Hồ Sơn – Tam Đảo 9/2019 565144 2372595 6 VP 07 Hồ Sơn – Tam Đảo 9/2019 563635 2371620 7 VP 12 Tam Quan – Tam Đảo 9/2019 565800 2373831 o (Sử dụng hê ̣ tọa độ VN2000 múi chiế u 3 tı̉nh Vıñ h Phúc) Yêu cầ u về mẫu lá và cách bảo quản: cắ t PCR TC1000-G (Biologix) với thành phần bao những lá bánh tẻ, xanh và không bi ̣ sâu bê ̣nh. gồ m: 10l PCR master mix 2X, 1l mồ i xuôi Sau đó bảo quản mẫu lá trong túi nilon có chứa (10M ) và 1l mồ i ngươ ̣c (10M), 1l ADN ha ̣t hút ẩ m silica gel, vâ ̣n chuyể n về phòng thı́ khuôn (50ng), bổ sung H2O deion tới 20l . nghiê ̣m ngay trong ngày. Các mẫu lá đươ ̣c bảo Chương trıǹ h nhiê ̣t đô ̣ của phản ứng PCR như quản trong tủ la ̣nh -20oC cho đế n khi đươ ̣c sử sau: biế n tı́nh ở 95oC trong 5 phút; 35 chu kì du ̣ng để tách chiế t ADN tổ ng số . lă ̣p la ̣i của ba bước 95oC – 30 giây, 51oC-52oC 2.2. Phương pháp tách chiết ADN tổ ng số (tùy mồ i) – 30 giây, 72oC – 1 phút; kế t thúc ADN tổ ng số được tách chiết từ mẫu lá Xá tổ ng hơ ̣p ở 72oC trong 5 phút; bảo quản sản xi theo ̣ hướng dẫn sử du ̣ng của bô ̣ kit tách chiế t phẩ m PCR ở 4oC. Tên mồ i, trình tự nucleotide ADN thực vâ ̣t “DNA mini kit Qiagen” của các mồi ADN mã va ̣ch và nhiê ̣t đô ̣ gắ n mồ i của hañ g Qiagen, CHLB Đức. Các mẫu ADN tổ ng các mồ i sử dụng trong nghiên cứu đươ ̣c thể số sau khi tách chiế t đươ ̣c bảo quản ở nhiê ̣t đô ̣ hiê ̣n ở bảng 2. -20oC. Sản phẩm PCR được điện di trên gel 2.3. Phương pháp khuyếch đại PCR và xác agarose 1,0% có bổ sung thuố c nhuô ̣m axit đinh ̣ trình tự nucleotide nucleic (Redsafe). Sau khi điện di, bản gel Phản ứng PCR được thực hiện trên máy agarose được soi dưới đèn UV và chụp ảnh. Bảng 2. Danh sách và trình tự nucleotide của các cặp mồi Kí hiệu Ta Kı́ch thước Gen Trın ̀ h tư ̣ mồ i (5’-3’) Tham khảo mồi (OC) đoa ̣n gen matK_F ACCCAGTCCATCTGGAAATCTGGTTC (bp) Kress and matK 52 850 Erickson, 2007 matK_R CGTACAGTACTTTTGTGTTTACGAG trnH- trnH_F CGCGCATGGTGGATTCACAATCC Sang et al., 51 460 psbA psbA_R GTTATGCATGAACGTAATGCTC 1997 rbcL_F ATGTCACCACAAACAGAGACTAAAGC Kress and rbcL 52 600 rbcL_R GTAAAATCAAGTCCACCTCG Erickson, 2007 TẠP CHÍ KHOA HỌC VÀ CÔNG NGHỆ LÂM NGHIỆP SỐ 6 - 2021 15
  4. Công nghệ sinh học & Giống cây trồng Những sản phẩm PCR sau khi khuếch đại số khác nhau nhưng đề u không thành công. thành công sẽ được tinh sạch sử du ̣ng bô ̣ kit Qua đây có thể thấ y phương pháp CTAB Prification Kit của hãng InTRON – Hàn Quố c. không phù hơ ̣p để tách chiế t ADN tổ ng số từ Sau khi tinh sạch, sản phẩm PCR được gửi mẫu lá loài Xá xi.̣ cho phòng thí nghiệm 1st Base ở Malaysia để Sau đó quá trình tách chiết ADN được thực giải trình tự nucleotide theo cả hai chiề u xuôi hiện theo chỉ dẫn của bộ Kit tách chiết ADN và ngươ ̣c. Trình tự nucleotide của đoạn ADN tổng số “DNA mini kit Qiagen” của Đức. Khi được xác định bằng máy giải trình tự tự đô ̣ng sử dụng phương pháp này ADN tổ ng số thu dựa trên nguyên lý của Sanger, sử dụng bộ Kit được không còn nhớt, dung dich ̣ ADN hòa tan BigDye® Terminator v3.1 Cycle Sequencing. có màu trong chứ không có màu vàng nâu như 2.4. Phương pháp phân tích dữ liệu ADN mã vạch phương pháp CTAB. Do đặc tính của cây Xá Các trıǹ h tự nucleotide đươ ̣c phân tıć h và xử xị (trong cây có tinh dầu) nên trong quá trình lý bằ ng phầ n mề m tin sinh BioEdit 7.2.5 (Hall, tách chiết ADN tổng số thu được rất ít lượng 1999), Mega7 (Kumar et al., 2015), và các công ADN, do đó không thể hiển thị được băng cu ̣ trên NCBI (http://www.ncbi.nlm.nih.gov). ADN tổng số trên bản gel agarose 1,0%. Khi Cây quan hê ̣ di truyề n đươ ̣c xây dựng dựa trên đo các mẫu ADN tổ ng số tách chiế t đươ ̣c bằ ng phương pháp Maximum likelihood, với số lầ n phương pháp quang phổ trên máy Scandrop lă ̣p là 1000. Đa da ̣ng nucleotide (Pi) và đa da ̣ng cho kế t quả về nồ ng đô ̣ và đô ̣ tinh sa ̣ch cũng haplotype (Hd) đươ ̣c tı́nh toán dựa trên phầ n không tố t (nồ ng đô ̣ rấ t thấ p chı̉ từ 1,0 đế n 3,0 mề m DnaSP v.5.0 (Librado và Rozas, 2009). ng/µl và đô ̣ tinh sa ̣ch tương ứng với chı̉ số 3. KẾT QUẢ VÀ THẢO LUẬN A260/A280 đa ̣t dưới 1,5) nên chúng tôi phải 3.1. Tách chiết ADN tổng số tiế n hành kiểm tra hiê ̣u quả của viê ̣c tách chiế t Bước đầ u chúng tôi thử nghiê ̣m phương ADN bằng phản ứng PCR với cặp mồi pháp tách chiế t ADN tổng số từ các mẫu lá matK_F/R. Kết quả thu được tất cả các mẫu theo phương pháp CTAB (Saghai-Maroof và ADN tổng số đều xuấ t hiê ̣n sản phẩ m PCR là cộng sự, 1984), sử dụng hai nồ ng đô ̣ đệm băng ADN có kích thước khoảng 850bp. Từ CTAB khác nhau là 2% và 4% nhưng đề u kế t quả PCR này khẳng định đã tách chiết không thu được ADN tổ ng số . Nguyên nhân có thành công ADN tổng số từ 07 mẫu lá Xá Xị thể là do lá cây Xá xị có nhiều tinh dầu, khi ủ ở sử du ̣ng bộ Kit “DNA mini kit Qiagen” của nhiệt độ 65oC cùng với đệm CTAB thı̀ hỗn hơ ̣p Đức. Các mẫu ADN này đươ ̣c sử du ̣ng trực trở nên đặc quánh, dich ̣ thu đươ ̣c sau khi ly tiế p cho thı́ nghiê ̣m nhân bản các trıǹ h tự ADN tâm cũng có đô ̣ nhớt rấ t cao. Do đó, hiê ̣u quả mã va ̣ch ở loài Xá xi ̣nghiên cứu. thu nhâ ̣n ADN tổng số không cao ở các bước 3.2. Kết quả nhân gen với các đoạn ADN mã tiế p theo. Kế t quả tách chiế t ADN tổ ng số vạch bằng kĩ thuật PCR không thành công này đã đươ ̣c kiể m nghiê ̣m 07 mẫu ADN tổng số được tách chiết từ lá thông qua phản ứng PCR sử du ̣ng că ̣p mồ i của 07 cây Xá xi ̣ được sử dụng làm khuôn để matK_F/R (như trong bảng 1). Chúng tôi thực nhân bản đoạn gen matK, rbcL và trnH-psbA hiê ̣n phản ứng PCR với các nồ ng đô ̣ ADN tổ ng bằng kỹ thuật PCR với các cặp mồi đặc hiệu. Hın ̀ h 2. Kết quả nhân bản 03 đoa ̣n trın ̀ h tư ̣ ADN mã va ̣ch của 07 mẫu Xá xi ta ̣ ̣i Tam Đảo, Vıñ h Phúc ((A): Trı̀nh tự matK, (B): Trı̀nh tự rbcL, (C): Trı̀nh tự trnH-psbA. Giế ng 1-7: mẫu VP 01, VP 02, VP 03, VP 04, VP 05, VP 07, và VP 12; M: Thang đo ADN 100bp) 16 TẠP CHÍ KHOA HỌC VÀ CÔNG NGHỆ LÂM NGHIỆP SỐ 6 - 2021
  5. Công nghệ sinh học & Giống cây trồng Că ̣p mồ i matK_F/R đươ ̣c sử du ̣ng để thực đoa ̣n gen matK của mẫu VP 01 làm đa ̣i diê ̣n để hiê ̣n phản ứng PCR nhân bản đoa ̣n gen matK so sánh với các trình tự tương đồ ng trên trong 07 mẫu Xá xi,̣ kế t quả PCR đươ ̣c thể GenBank. Kết quả so sánh trình tự đoạn gen hiê ̣n trên hı̀nh 2A. Từ kế t quả điê ̣n di sản phẩ m matK của các mẫu Xá xi ̣ta ̣i Tam Đảo (đa ̣i diê ̣n PCR nhân bản đoa ̣n gen matK cho thấ y cả 07 là mẫu VP 01) và 06 trıǹ h tự matK của các loài mẫu Xá xi ̣ đề u xuấ t hiê ̣n mô ̣t băng ADN đă ̣c thuô ̣c chi Cinnamomum đươ ̣c thể hiê ̣n trên hiê ̣u với kıć h thước khoảng 850 bp như dự hıǹ h 3. Trình tự đoa ̣n gen matK của mẫu VP 01 kiế n. Mẫu đố i chứng âm, trong đó ADN khuôn có tỉ lệ tương đồng 100% với loài đươ ̣c thay bằ ng nước không xuấ t hiê ̣n băng Cinnamomum parthenoxylon (KJ510895.1). ADN. Kế t quả này thể hiê ̣n că ̣p mồ i matK_F/R Mẫu VP 01 có mức độ sai khác rất nhỏ so với rấ t đă ̣c hiê ̣u và đoa ̣n gen matK đươ ̣c nhân bản loài Cinnamomum aromaticum (NC046019.1); thành công ở tấ t cả các mẫu Xá xi ̣nghiên cứu. Cinnamomum yabunikkei (NC044864.1); Từ kế t quả điê ̣n di sản phẩ m PCR nhân bản Cinnamomum reticulatum (MF651971.1); đoa ̣n gen rbcL cho thấ y cả 07 mẫu Xá xi ̣ đề u Cinnamomum polyadephum (AB924731.1); xuấ t hiê ̣n mô ̣t băng ADN đă ̣c hiê ̣u với kı́ch Cinnamomum chekiangense (HQ427409.1) với thước khoảng 600 bp, băng ADN tương đố i rõ tỷ lê ̣ phầ n trăm sai khác về trıǹ h tự nucleotide nét và tương đồng nhau như dự kiế n (Hı̀nh cùng là 0.13%. Vi ̣ trı́ sai khác của mẫu Xá xi ̣ 2B). Kế t quả này thể hiê ̣n că ̣p mồ i rbcL_F/R nghiên cứu với 05 loài khác cùng thuô ̣c chi rấ t đă ̣c hiê ̣u và hiê ̣u quả nhân bản rấ t cao ở các Cinnamomum đươ ̣c thể hiê ̣n ta ̣i vi ̣ trı́ số 414, mẫu Xá xi ̣nghiên cứu. trong đó mẫu Xá xi ̣ nghiên cứu và loài C. Hıǹ h 2C cho thấy cả 07 mẫu Xá xi ̣đều xuất parthenoxylon (KJ510895.1) là nucleotide loa ̣i hiện băng sản phẩ m PCR đă ̣c hiê ̣u của că ̣p mồi T, còn 05 loài còn la ̣i là nucleotide loa ̣i G. Sự trnH_F/psbA_R, băng ADN rõ và tương đồng khác nhau về mô ̣t vi ̣ trı́ nucleotide duy nhấ t nhau, kích thước băng ADN khoảng 460 bp giữa mẫu VP 01 và loài Cinnamomum (khi so sánh với thang ADN chuẩn 100 bp). parthenoxylon với 05 loài còn la ̣i có thể giả Kết quả này cho thấ y cặp mồi trnH_F/psbA_R thuyế t là do mô ̣t đô ̣t biế n thay thế đồ ng nghıã đặc hiệu và có khả năng nhân bản thành công ở đã dẫn đế n sự hıǹ h thành các loài mới trong chi tấ t cả các mẫu Xá xị nghiên cứu. Long Naõ và các loài này có cùng nguồ n gố c. 3.3. Phân tích trình tự nucleotide các đoạn Như vâ ̣y, đoa ̣n trıǹ h tự mã va ̣ch matK sử du ̣ng ADN mã vạch trong nghiên cứu này tuy không phân biê ̣t đươ ̣c Các sản phẩm PCR đều được tinh sạch bằng 5 loài trong chi Cinnamomum trên GenBank bộ kit PCR Purification Kit của InTRON – (C. aromaticum (NC046019.1); C. yabunikkei Hàn Quố c theo hướng dẫn của nhà sản xuấ t và (NC044864.1); C. reticulatum (MF651971.1); trình tự nucleotide của các đoa ̣n gen đươ ̣c xác C. polyadephum (AB924731.1); C. đinh ̣ bởi công ty 1st BASE - Malaysia. chekiangense (HQ427409.1)) nhưng la ̣i có khả 3.3.1. Phân tı́ch trình tự nucleotide đoa ̣n gen năng phân biê ̣t đươ ̣c loài Xá xi ̣ với đô ̣ chıń h matK xác cao và tương đồ ng với kế t quả đinh ̣ danh Sau khi xác đinh ̣ trıǹ h tự nucleotide bằ ng dựa theo hıǹ h thái do Phùng Văn Phê mô tả phương pháp tự đô ̣ng và xử lý trı̀nh tự bằng (2012). Ta ̣i Viê ̣t nam, nghiên cứu đa da ̣ng di phầ n mề m BioEdit, chúng tôi thu đươ ̣c đoạn truyề n mô ̣t số giố ng hhañ dựa trên trıǹ h tự gen matK với kích thước 784 bp với chấ t matK cho thấ y mô ̣t vi ̣ trı́ đô ̣t biế n di ̣ hoán lươ ̣ng giải trı̀nh tự tố t. Vì vậy, chúng tôi sử (T>G) đã có ý nghıã trong viê ̣c nhâ ̣n da ̣ng 11 dụng đoa ̣n trıǹ h tự có kích thước 784 bp của giố ng nhañ (Nguyễn Thi ̣ Ngo ̣c Lan et al., đoạn gen matK để thực hiê ̣n phân tích, so sánh. 2019). Vı̀ vâ ̣y, đoa ̣n trı̀nh trự matK sử du ̣ng Kế t quả so sánh 07 trình tự đoa ̣n gen matK của trong nghiên cứu này có hiê ̣u quả đố i với mu ̣c 07 mẫu Xá xi ̣ (VP 01, VP 02, VP 03, VP 05, tiêu giám đinh ̣ loài nhưng đoa ̣n trı̀nh tự này VP 06, VP 07 và VP 12) cho thấ y tấ t cả 07 không phân biê ̣t đươ ̣c các cây Xá xi ̣ ta ̣i vườn mẫu có sự tương đồ ng 100%. Các trı̀nh tự này quố c gia Tam Đảo vı̀ trı̀nh tự nucleotide của tấ t đươ ̣c đăng ký lên GenBank với mã số cả các mẫu đề u giố ng nhau. MZ821041. 3.3.2. Phân tı́ ch trình tự nucleotide đoa n ̣ Từ kế t quả này, chúng tôi lựa cho ̣n trình tự gen rbcL TẠP CHÍ KHOA HỌC VÀ CÔNG NGHỆ LÂM NGHIỆP SỐ 6 - 2021 17
  6. Công nghệ sinh học & Giống cây trồng Sau khi xử lý trıǹ h tự, doạn gen rbcL với A. Còn 03 loài C. dubium,C. heyneanum,C. kích thước 526 bp của 07 mẫu Xá xi ̣ nghiên malabatrum ở vị trí 45,46 lần lượt là cứu (VP 01, VP 02, VP 03, VP 05, VP 06, VP nucleotide loại A và nucleotide loại G. Vị trí 07, VP 12) đươ ̣c so sánh và cho kết quả tương 261 ở mẫu VP 01 và 05 loài C. parthenoxylon, đồng 100% về trıǹ h tự nucleotide, đươ ̣c đăng C. burmannii, C. dubium,C. heyneanum, C. ký trên GenBank với mã số MZ821043. Vı̀ malabatrum đều là nucleotide loại T, loài C. vâ ̣y, mẫu VP 01 đươ ̣c sử du ̣ng làm đại diện aromaticum là nucleotide loại C (Hıǹ h 4). Qua cho tấ t cả 07 mẫu Xá xi ̣ nghiên cứu để so sánh phân tı́ch sự khác nhau ta ̣i các vi ̣ trı́ nucleotide với các trình tự trên Genbank. cho thấ y mẫu VP01 và loài C. parthenoxylon Mẫu VP 01 và 05 loài C. parthenoxylon, C. có trı̀nh tự nucleotide đoa ̣n gen rbcL tương aromaticum, C. dubium, C. heyneanum, C. đồ ng 100%, loài C. burmannii và C. malabatrum ở vị trí 38 đều là nucleotide loại A aromaticum có mức đô ̣ tương đồ ng rấ t cao (chı̉ chỉ có loài C. burmannii là nucleotide loại C. khác 1 nucleotide), còn ba loài C. dubium,C. Ở vị trí 45 và 46 của mẫu VP 01 và 03 loài C. heyneanum và C. malabatrum tương đồ ng parthenoxylon, C. burmannii, C. aromaticum 100%. lần lượt là nucleotide loại G và nucleotide loại Hın ̀ h 3. So sánh trıǹ h tư ̣ nucleotide của đoa ̣n gen matK giữa mẫu VP 01 với 06 trın ̀ h tư ̣ tương đồ ng trên ngân hàng gen 18 TẠP CHÍ KHOA HỌC VÀ CÔNG NGHỆ LÂM NGHIỆP SỐ 6 - 2021
  7. Công nghệ sinh học & Giống cây trồng Kế t quả cho thấ y mẫu VP 01 có sự tương cứu với các loài trong chi Cinnamomum trên đồ ng rấ t cao với loài Cinnamomum GenBank không nhiề u, sự tương đồ ng 100% parthenoxylon (KX546848.1) (100%) và cao của 07 mẫu Xá xi ̣ với loài C. parthenoxylon với mô ̣t số loài thuô ̣c chi Cinnamomum đươ ̣c thể hiê ̣n rấ t rõ ràng trong hı̀nh 3 và hı̀nh 4 (99,62% đế n 99,81%): tương đồ ng với C. khi so sánh trı̀nh tự nucleotide. Do đó, cây burmannii (KX546826.1) và C. aromaticum quan hê ̣ di truyề n thể hiê ̣n sự tương đồ ng di (KP094936.1) là 99,81%; với loài C. dubium truyề n cũng như mố i quan hê ̣ gầ n gũi của 07 (MK243402.1), C. heyneanum (KY945255.1), mẫu Xá xi ̣ nghiên cứu với loài C. và C. malabatrum (KY945245.1) là 99,62%. parthenoxylon và các loài khác thuô ̣c chi Sự sai khác về trı̀nh tự nucleotide của hai đoa ̣n Cinnamomum là không cầ n thiế t. gen matK và rbcL giữa các mẫu Xá xi ̣ nghiên Hın ̀ h 4. So sánh trıǹ h tư ̣ nucleotide đoa ̣n gen rbcL của mẫu VP 01 với 06 trın ̀ h tư ̣ tương đồ ng trên ngân hàng gen ADN mã va ̣ch đươ ̣c sử du ̣ng rô ̣ng raĩ trong phân loa ̣i có quan hê ̣ gầ n nhau (Chen et al., sinh ho ̣c thực vâ ̣t để phân loa ̣i các đơn vi ̣ phân 2015). Sudmoon et al. (2014) cho rằ ng đoa ̣n loa ̣i gầ n nhau. Sự sai khác về trı̀nh tự trı̀nh tự matK và rbcL có hiê ̣u quả thấ p trong nucleotide trong các vùng tiêu chuẩ n đủ để viê ̣c phân biê ̣t các loài trong chi Cinnamomum phân biê ̣t thâ ̣m chı́ cả những đơn vi ̣ phân loa ̣i vı̀ rấ t nhiề u loài không có sự sai khác về trıǹ h gầ n nhau. Tuy nhiên, trong vài trường hơ ̣p, sự tự nucleotide. Chandrasekara et al. (2021) ghi sai khác về trıǹ h tự nucleotide trong các vùng nhâ ̣n mô ̣t vi ̣ trı́ nucleotide sai khác duy nhấ t tiêu chuẩ n là không đủ để phân biê ̣t các đơn vi ̣ trong vùng rbcL giữa mô ̣t mẫu của loài C. TẠP CHÍ KHOA HỌC VÀ CÔNG NGHỆ LÂM NGHIỆP SỐ 6 - 2021 19
  8. Công nghệ sinh học & Giống cây trồng ovalifolium với mô ̣t số loài khác thuô ̣c chi trı́ nucleotide khác biê ̣t trên trı̀nh tự của mô ̣t Cinnamomum ta ̣i Sri Lanka và đó là mô ̣t sự mẫu VP01 với tấ t cả các mẫu còn la ̣i (vi ̣ trı́ thay thế đồ ng nghıã . Trıǹ h tự matK cho thấ y 207, 300, 351, và 436) và 6 vi ̣ trı́ nucleotide có sự sai khác ta ̣i 4 vi ̣ trı́ nucleotide trong khi đó sự khác biê ̣t từ hai mẫu trở lên và đây là vi ̣ trı́ trı̀nh tự trnH-psbA xuấ t hiê ̣n 11 vi ̣ trı́ sai khác nucleotide biế n đổ i mang thông tin tiế n hóa nucleotide giữa các loài Cinnamomum nghiên (parsimony informative sites) ta ̣i các vi ̣ trı́ cứu. Cả ba trıǹ h tự ADN mã va ̣ch đề u không nucleotide số 133, 175, 265, 314, 339 và 408. đủ để phân loa ̣i 8 loài Cinnamomum đă ̣c hữu Trıǹ h tự trnH-psbA là trıǹ h tự không mã hóa ta ̣i Sri Lanka mă ̣c dù kế t quả phân tı́ch trı̀nh tự nên có sự biế n đổ i giữa các cá thể cùng loài nucleotide của từng chı̉ thi ̣ ADN mã va ̣ch cho cũng như biế n đổ i lớn giữa các loài (Kress and thấ y sự gầ n gũi về mă ̣t di truyề n của 8 loài Erickson, 2007). nghiên cứu và sự đa da ̣ng bên trong loài khá Chı̉ số haplotype (h) là 6, bao gồ m cao ở mô ̣t số loài. haplotype 1: VP 01, haplotype 2: VP 02, Trong nghiên cứu này hai đoa ̣n trı̀nh tự haplotype 3: VP 03, haplotype 4: VP 05, matK và rbcL cũng cho thấ y sự sai khác rấ t haplotype 5: VP 06 và VP07, haplotype 6: VP nhỏ giữa các loài trong chi Cinnamomum, do 12. Đa da ̣ng haplotype (Hd) là 0,9524, chı̉ số các gen này đề u là những gen chức năng nên đa da ̣ng nucleotide (Pi) là 0,00926. Kế t quả trıǹ h tự rấ t bảo thủ, các vi ̣ trı́ sai khác đề u là này cho thấ y đa da ̣ng di truyề n của quầ n thể những đô ̣t biế n thay thế đồ ng nghıã . Trı̀nh tự Xá xi ̣ ta ̣i Vườn Quố c gia Tam Đảo tương đố i matK chı̉ sai khác mô ̣t vi ̣ trı́ nucleotide giữa cao, do đó loài này vẫn có tiề m năng phát triể n loài Xá xi ̣ C. parthenoxylon với 05 loài khác ngoài tự nhiên khi môi trường thay đổ i. Đa thuô ̣c chi Cinnamomum trên GenBank, mă ̣c dù da ̣ng di truyề n bi ̣ ảnh hưởng bởi mô ̣t số yế u tố cả 05 loài này tương đồ ng 100% về trıǹ h tự như tuổ i đời, pha ̣m vi phân bố , khả năng sinh nucleotide của đoa ̣n gen matK. Còn trı̀nh tự sản và hê ̣ thố ng sinh sản của loài (Nybom, rbcL cho thấ y sự sai khác từ mô ̣t đế n hai 2004; Wu et al., 2015). Đố i với quầ n thể Xá xi ̣ nucleotide. Kế t quả này bổ sung thêm những ta ̣i Vườn Quố c gia Tam Đảo, có thể do hoa ̣t bằ ng chứng về viê ̣c sử du ̣ng hiê ̣u quả các trıǹ h đô ̣ng khai thác quá mức và khả năng tái sinh tự ADN mã va ̣ch ở các loài khác nhau là rấ t kém mà loài này có số lươ ̣ng cá thể ıt́ và phân khác nhau, cho dù là các loài cùng thuô ̣c mô ̣t bố rải rác. Zhang et al. (2021) nghiên cứu đoa ̣n chi. Tuy nhiên, cầ n tiế p tu ̣c nghiên cứu thêm trı̀nh tự trnH-psbA dài 452 bp của 5 quầ n thể mô ̣t số trıǹ h tự ADN mã va ̣ch khác để có thể loài C. chago ta ̣i Trung Quố c cho thấ y sự đa khẳ ng đinh ̣ về sự phân biê ̣t giữa loài C. da ̣ng nucleotide ta ̣i 13 vi ̣ trı,́ có 4 haplotype parthenoxylon với các loài khác cùng chi. trong các quầ n thể nghiên cứu. Đa da ̣ng di 3.3.3. Phân tı́ch trình tự nucleotide đoạn gen truyề n của loài C. chago thấ p hơn nhiề u so với trnH-psbA các loài phân bố rô ̣ng trong ho ̣ Long naõ như Đa da ̣ng di truyề n giữa 07 mẫu Xá xi dư ̣ ̣a C. camphora. Trong nghiên cứu này, tác giả trên trın ̀ h tự trnH-psbA cho rằ ng các hoa ̣t đô ̣ng gây xáo trô ̣n thường Trình tự đoa ̣n gen trnH-psbA của 7 mẫu Xá xuyên của con người như sự tàn phá và phân xi ̣ có sự sai khác ta ̣i 10 vi ̣ trı́ nucleotide (Hı̀nh cách môi trường số ng tự nhiên trong quầ n thể 5). Ta ̣i các vi ̣ trı́ sai khác có thể nhâ ̣n thấ y mẫu có tương quan chă ̣t chẽ với mức đô ̣ đa da ̣ng di VP 06 và VP 07 có trıǹ h tự tương đồ ng nhau truyề n thấ p của loài C. chago. 100%, còn các mẫu khác có sự sai khác mô ̣t Giám đinh ̣ loài Xá xi ̣ dưạ trên trın ̀ h tự cách ngẫu nhiên. Phân tı́ch trı̀nh tự nucleotide trnH-psbA của vùng trnH-psbA ở các mẫu Xá xi ̣ cho kế t Sử du ̣ng trı̀nh tự trnH-psbA của 07 mẫu Xá quả vùng bảo tồ n là 453/463 nucleotide, vùng xi ̣ nghiên cứu để BLAST, chúng tôi xác đinh ̣ biế n đổ i là 10/463 nucleotide, trong đó có 4 vi ̣ đươ ̣c 07 loài thuô ̣c chi Cinnamomum trên 20 TẠP CHÍ KHOA HỌC VÀ CÔNG NGHỆ LÂM NGHIỆP SỐ 6 - 2021
  9. Công nghệ sinh học & Giống cây trồng GenBank có mức đô ̣ tương đồ ng cao để xây có cùng xuất xứ. Trong đó, 07 mẫu Xá xi ̣ ta ̣i dựng cây quan hê ̣ di truyề n. Vườn Quố c gia Tam Đảo có mố i quan hê ̣ gầ n Cây quan hệ di truyền được chia làm hai nhấ t với loài C. parthenoxylon, sau đó là hai nhóm chính. Nhóm thứ nhất gồm 07 mẫu Xá xi ̣ loài C. aromaticum và C. chago, và xa hơn là nghiên cứu VP 01, VP 02, VP 03, VP 05, VP hai loài C. camphora và C. micranthum. Loài 06, VP 07, VP 12 và 05 loài của chi Cascabela thevetia đươ ̣c sử du ̣ng như mô ̣t loài Cinnamomum với đô ̣ tin câ ̣y cao (boostrap bên ngoài (outgroup) để thể hiê ̣n rõ hơn mố i 100%). Các mẫu Xá xị nghiên cứu không có sự quan hê ̣ gầ n gũi giữa các loài cùng thuô ̣c chi sai khác nhiều về trình tự nucleotide do chúng Cinnamomum (Hı̀nh 6). Hın ̀ h 5. So sánh trình tự nucleotide của đoa ̣n gen trnH-psbA ở 07 mẫu Xá xi ̣ ta ̣i Vườn Quố c gia Tam Đảo Như vậy, đoa ̣n trıǹ h tự mã va ̣ch trnH-psbA khác nhau có sự sai khác về trıǹ h tự cũng cho thấ y hiê ̣u quả trong viê ̣c giám đinh ̣ nucleotide. Kế t quả này cũng tương tự như kế t loài Xá xi ̣ nhưng tỷ lê ̣ lương đồ ng với loài C. quả của dự án “Xây dựng bô ̣ cơ sở dữ liê ̣u parthenoxylon không cao như hai trı̀nh tự ADN mã va ̣ch phu ̣c vu ̣ công tác quản lý giố ng matK và rbcL ở trên. Tuy nhiên, đoa ̣n trı̀nh tự cây lâm nghiê ̣p đã đươ ̣c công nhân là giố ng mã va ̣ch này la ̣i có hiê ̣u quả trong sự đánh giá Quố c gia” do Hà Văn Huân chủ nhiê ̣m đã đa da ̣ng di truyề n giữa các cá thể trong cùng ̣ đoa ̣n trıǹ h tự trnH-psbA là trıǹ h tự khẳ ng đinh xuấ t xứ, trong cùng mô ̣t vùng điạ lý các cá thể hiê ̣u quả nhấ t trong nghiên cứu đa da ̣ng di TẠP CHÍ KHOA HỌC VÀ CÔNG NGHỆ LÂM NGHIỆP SỐ 6 - 2021 21
  10. Công nghệ sinh học & Giống cây trồng truyề n ở mức dưới loài. Trı̀nh tự trnH-psbA là thủ như rbcL sẽ làm giảm bớt những sai sót trıǹ h tự không mã hóa và biế n đổ i nhiề u nên (Kress và Erickson, 2007). viê ̣c kế t hơ ̣p với mô ̣t trıǹ h tự mã hóa và bảo Hın ̀ h 6. Cây qua hệ di truyền giữa 07 mẫu Xá xi ta ̣ ̣i Vườn Quố c gia Tam Đảo và 05 loài tương đồ ng trên Genbank 4. KẾT LUẬN da ̣ng nucleotide thấ p (Pi = 0,00926). Hai trıǹ h - Đã xác đinḥ đươ ̣c 03 trıǹ h tự ADN mã tự matK và rbcL không thể hiê ̣n bấ t kỳ sự đa va ̣ch là trıǹ h tự matK (mã GenBank: da ̣ng di truyề n nào giữa các cây Xá xi ̣ nghiên MZ821041), rbcL (MZ821043), trnH-psbA cứu. (MZ821045 và MZ821046) cho loài Xá xi ̣ Lời cảm ơn (Cinnamomum parthenoxylon (Jack) Meisn). Kinh phı́ thực hiê ̣n đề tài đươ ̣c hỗ trơ ̣ bởi Trong đó, bước đầ u đánh giá hai trıǹ h tự matK nhiê ̣m vu ̣ cấ p Quố c gia “Bảo tồ n và phát triể n và rbcL có thể sử du ̣ng để giám đinh ̣ loài Xá xi ̣ nguồ n gen Xá xi ̣ (Cinnamomum parthenoxylon mă ̣c dù sự sai khác chı̉ là 1 hoă ̣c 2 nucleotide, (Jack) Meisn) ta ̣i mô ̣t số tı̉nh miề n Bắ c” với còn trı̀nh tự trnH-psbA cho thấ y khả năng mã số NVQG-2019/ĐT.14 giám đinh ̣ loài Xá xi ̣thấ p hơn. TÀI LIỆU THAM KHẢO - Bước đầ u đánh giá đươ ̣c sự đa da ̣ng di 1. Lê Đình Khả (2003) Chọn tạo giống và nhân giống cho một số loài cây trồng rừng chủ yếu ở Việt truyề n của các cây Xá xi ̣ ta ̣i Vườn Quố c gia Nam. Nhà xuấ t bản Nông nghiệp, Hà Nội. Tam Đảo, tı̉nh Vıñ h Phúc dựa trên trı̀nh tự 2. Nguyễn Thi ̣ Ngo ̣c Lan, Nguyễn Thi ̣ Lan Hoa, trnH-psbA, trong đó vi ̣ trı́ nucleotide bảo thủ Nguyễn Thi ̣ Thanh Thủy, Lã Tuấ n Nghıã (2019) Nghiên (không biế n đổ i) giữa 07 mẫu nghiên cứu là cứu đa da ̣ng di truyề n của đoa ̣n gen matK ở mô ̣t số nguồ n gen nhãn Viê ̣t Nam. Ta ̣p chı́ KH&CN Viê ̣t Nam 453 nucleotide, còn số vi ̣ trı́ biế n đổ i là 10 61 (2): 61-64. nucleotide. Trong số 10 vi ̣ trı́ nucleotide sai 3. Nguyễn Tiến Bân (2003) Danh lục các loài khác thı̀ có 04 vi ̣ trı́ khác biê ̣t giữa hai mẫu và thực vật Việt Nam, Tập II. Nhà xuất bản Nông nghiệp, 06 vi ̣ trı́ khác biê ̣t giữa 3 mẫu trở lên, đa da ̣ng Hà Nội. 4. Phạm Hoàng Hộ (1999) Cây cỏ Việt Nam, haplotype tương đố i cao (Hd = 0,9524) và đa Quyển 1. Nhà xuất bản Trẻ, Tp. Hồ Chí Minh. 22 TẠP CHÍ KHOA HỌC VÀ CÔNG NGHỆ LÂM NGHIỆP SỐ 6 - 2021
  11. Công nghệ sinh học & Giống cây trồng 5. Phùng Văn Phê (2012) Nghiên cứu giâm hom Bioinformatics 25: 1451–1452. cây Xá xị (Cinnamomum parthenoxylon (Jack) Meisn.) 17. Liu Z. F., Ci X.Q, Li L., Li H.W., Conran J. G., làm cơ sở cho công tác bảo tồn ở Vườn quốc gia Tam Li J. (2016) DNA barcoding evaluation and imlication Đảo, tỉnh Vĩnh Phúc. Tạp chí Khoa học và Công nghệ for phylogenetic relationships in Lauraceae from China. 50 (6): 645-652. PLoS ONE 12 (4): e0175788. 6. Chandrasekara CHWMRB, Naranpanawa 18. Nybom H. (2004) Comparison of different DNU, Bandusekara BS, Pushpakumara DKNG, nuclear DNA markers for estimating intraspecific Wijesundera DSA, Bandaranayake PCG (2021) genetic diversity in plants. Mol. Ecol. 13: 1143–1155. Universal barcoding regions, rbcL, matK and trnH-psbA 19. Saghai-Maroof M. A, Soliman K. M, Jorgensen do not discriminate Cinnamomum species in Sri Lanka. R. A, Allard R. W (1984) Ribosomal DNAsepacer- PLoS ONE 16(2): e0245592. length polymorphism in barley: mendelian inheritance, 7. Chase M.W., Cowan R.S., Hollingsworth P.M., chromosomal location, and population dynamics. Proc Berg C.V.D., Madriñán S., Petersen G., Seberg O., Natl Acad Sci 81: 8014–8019. Jørgsensen T., Cameron K.M., Carine M., Pedersen N., 20. Sandigawad A.M., Patil C.G. (2011) Genetic Hedderson T.A.J., Conrad F., Salazar G.A., Richardson diversity in Cinnamomun zeylanicum Blume. J.E., Hollingsworth M.L., Barraclough T.G., Kelly L., (Lauraceae) using random amplified polymorphic DNA Wilkinson M. (2007) A proposal for a st ADN ardised (RAPD) markers. African Journal of Biotechnology 10: protocol to barcode all DNA plants. Taxon 56 (2): 295- 3682-3688. 299. 21. Sang T., Crawford D.J., Stuessy T.F. (1997) 8. Chen S., Yao H., Han J., Liu C., Song J., Shi Chloroplast DNA phylogeny, reticulate evolution, and L., Zhu Y., Ma X., Gao T., Pang X., Luo K., Li Y., Li biogeography of Paeonia (Paeoniaceae). Am J Bot 84: X., Jia X., Lin Y., Leon C. (2010) Validation of the 1120-1136 ITS2 region as a novel DNA barcode for identifying 22. Schoch C.L., Seifert K.A. (2012) Nuclear medicinal plant species. PloS One 5 (1): e8613. ribosomal internal transcribed spacer (ITS) region as a 9. Chen J., Erickson D. L., Xia N., Kress W. J. universal DNA barcode marker for Fungi. Proceedings (2015) Testing DNA barcodes in closely related species of the National Academy of Sciences 109 (16): 6241- of Curcuma (Zingiberaceae) from Myanmar and China. 6246. Mol Ecol Resour 15 (2): 337-348. 23. Sudmoon R., Chaveerach A., Sanublo A., 10. Costion C, Ford A, Cross H, Crayn D, Harrington Monkheang P., Kwanda N., Aungkapatatamgul S., M, Lowe A. (2011). Plant DNA barcodes can accurately Tanee T., Noikotr K., Chuachan C., Kaewdoungdee N. estimate species richness in poorly known floras. PLoS (2014) Identifying Efficiency in Herbal Medicine ONE 6: e26841. Cinnamomum Species (Lauraceae) Using Banding 11. Hall TA. (1999) BioEdit: A User-Friendly Patterns and Sequence Alignments of rpoB, rbcL and Biological Sequence Alignment Editor and Analysis matK Regions. Chiang Mai J. Sci. 41(5.1): 1094-1108, Program for Windows 95/98/NT. Nucleic Acids Contributed Paper. Symposium Series 41: 95-98. 24. Wu F.Q., Shen S.K., Zhang X.J., Wang Y.H., 12. Hollingsworth M.L., Clark A. (2009) Selecting Sun W.B. (2015) Genetic diversity and population barcoding loci for plants: evaluation of seven structure of an extremely endangered species: the cDNAidate loci with species‐level sampling in three world’s Rhododendron. AoB Plants 7: 10696–10700. divergent groups of land plants. Molecular Ecology 25. Yu, J., Xue J.H., Zhou S.L. (2011) New Resources 9 (2): 439-457. universal matK primers for DNA barcoding 13. Kumar S., Stecher G., Tamura K. (2015) angiosperms. Journal of Systematics DNA Evolution 49 MEGA7: Molecular Evolutionary Genetics (3): 176-181. Analysis version 7.0. Molecular Biology and Evolution 26. Zhang X., Yang L., Liu Y.H., Zhou X. L., 30: 2725-2729. Zhang L.Q., Wang Y.H., Shen S.K. (2021) Genetic 14. Kress WJ., Erickson DL. (2007) A Two-Locus diversity, genetic structure, and demographic history of Global DNA Barcode for Land Plants: The Coding rbcL Cinnamomum chago, a plant species with extremely Gene Complements the Non-Coding trnH-psbA Spacer small populations in China. Global Ecology and Region. PLoS ONE 2(6): e508. Conservation 31: e01808. 15. Krishnamurthy PK, Francis RA. (2012) A critical 27. Zhong Y., Yang A., Li Z., Zhang H., Liu L., review on the utility of DNA barcoding in biodiversity Wu Z., Li Y., Liu T., Xu M., Yu F. (2019) Genetic conservation. Biodiversity and Conservation 21: 1901– diversity and population genetic structure of 1919. Cinnamomum camphora in South China revealed by 16. Librado P., Rozas J. (2009) DnaSP v5: a software EST-SSR markers. Forests 10: f10111019. for comprehensive analysis of DNA polymorphism data. TẠP CHÍ KHOA HỌC VÀ CÔNG NGHỆ LÂM NGHIỆP SỐ 6 - 2021 23
  12. Công nghệ sinh học & Giống cây trồng IDENTIFICATION AND GENETIC DIVERSITY ASSESSMENT OF CINNAMOMUM PARTHENOXYLON IN TAM DAO NATIONAL PARK BY DNA BARCODE MARKERS Ha Bich Hong1, Nguyen The Huong1, Nguyen Thi Lan Anh2, Phung Van Phe1, Hoang Van Sam1, Nguyen Xuan Vinh3 1 Vietnam National University of Forestry 2 Vestergaard Frandsen Vietnam Company Limited 3 Chuong My A High School SUMMARY Cinnamomum parthenoxylon (Jack) Meisn) is a high-grade tree with high economic value, with rare genetic resources, classified in group IIA (Decree 06/2019/ND-CP of the Government in 2019) and critically endangered CR group (Vietnam Red Book 2007). This species has a poor natural regeneration ability along with the indiscriminate exploitation of C. parthenoxylon to store essential oil, making this tree species in danger of extinction. Therefore, this species should be preserved and developed in the wild. In this study, three DNA barcode markers matK, rbcL, and trnH-psbA were used to identify and analyze the genetic diversity of C. parthenoxylon investigated in Tam Dao National Park, Vinh Phuc Province. The results showed that all three DNA barcode markers showed high efficiency in the identification of C. parthenoxylon species, in which the trnH-psbA marker had lower species identification efficiency than matK and rbcL markers. The trnH-psbA sequence was found to be an effective marker in the analysis of genetic diversity among C. parthenoxylon plants in Tam Dao National Park, specifically, the conserved nucleotide position between 07 samples is 453 nucleotides, and the number of variable sites is 10 nucleotides with 6 parsimony informative sites showing differences between three or more samples. The haplotype diversity index was relatively high (Hd = 0.9524) and the nucleotide diversity index was low (Pi = 0.00926). The results of the genetic diversity assessment of C. parthenoxylon in Tam Dao National Park are the scientific basis for an effective conservation solution for this plant. Keywords: Cinnamomum parthenoxylon, Genetic diversity, DNA barcode. Ngày nhận bài : 23/8/2021 Ngày phản biện : 20/9/2021 Ngày quyết định đăng : 22/10/2021 24 TẠP CHÍ KHOA HỌC VÀ CÔNG NGHỆ LÂM NGHIỆP SỐ 6 - 2021
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2