Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1)

Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) Wenjie Wu1,*, Edward G. Niles1, Hirohisa Hirai2 and Philip T. LoVerde1

1 Department of Microbiology and Immunology, School of Medicine and Biomedical Science, State University of New York, Buffalo, NY,

USA

2 Primate Research Institute, Kyoto University, Inuyama, Japan

Keywords nuclear receptors; Schistosoma mansoni; SmNR1 ⁄ SmRXR1 interactions

Correspondence P. T. LoVerde, Southwest Foundation for Biomedical Research, PO Box 760549, San Antonio, TX, 78245–0549, USA Fax: +1 210 6703322 Tel: +1 210 2589852 E-mail: ploverde@sfbr.org

*Present address Southwest Foundation for Biomedical Research, PO Box 760549, San Antonio, Texas 78245-0549, USA

Note The nucleotide sequences reported in this paper have been submitted to the GenBank under accession number: AY395037, AY395051-AY395057

A cDNA encoding a nuclear receptor subfamily I member in the platy- helminth Schistosoma mansoni (SmNR1) was identified and characterized. SmNR1 cDNA is 2406 bp long and contains an open reading frame encoding a 715 residue protein. Phylogenetic analysis demonstrates that SmNR1 is a divergent member of nuclear receptor subfamily I with no known orthologue. SmNR1 was localized to S. mansoni chromosome 1 by fluorescent in situ hybridization. Gene structure of SmNR1 was deter- mined showing it to consist of eight exons spanning more than 14 kb. Quantitative real-time RT-PCR showed that SmNR1 was expressed throughout schistosome development with a higher expression in eggs, sporocysts and 21-day worms. SmNR1 contains an autonomous transacti- vation function (AF1) in the A ⁄ B domain as demonstrated in a yeast one-hybrid assay; it interacts with SmRXR1 in a yeast two-hybrid assay and in a glutathione S-transferase pull-down assay. Electrophoretic mobil- ity shift assay showed that SmNR1 could form a heterodimer with SmRXR1 to bind to DNA elements containing the half-site AGGTCA, a direct repeat of the half-site separated by 0–5 nucleotides (DR1-DR5) and a palindrome repeat of the half-site not separated by nucleic acids transfection in mammalian COS-7 cells showed that (Pal0). Transient SmNR1 ⁄ SmRXR1 could enhance the transcriptional activation of a DR2-dependent reporter gene. Our results demonstrate that SmNR1 is a partner of SmRXR1.

(Received 25 September 2006, revised 6 November 2006, accepted 9 November 2006)

doi:10.1111/j.1742-4658.2006.05587.x

Nuclear receptors (NRs) belong to a superfamily of transcriptional factors that regulate homeostasis, dif- ferentiation, metamorphosis and reproduction in meta- zoans. Members of the nuclear receptor superfamily are characterized by a modular structure: a conserved DNA-binding domain (DBD) that contains two zinc finger motifs binding to the cis-regulatory region of a target gene, and a conserved ligand-binding domain (LBD) that is involved in transcriptional activation of

the target gene via ligand and coregulator binding. Some NRs have no known ligand and are called orphan receptors [1,2]. A DNA core motif recognized by a NR is known as a hormone response element. The typical hormone response element is a consensus hexameric sequence AGGTCA, which is called a half-site. NRs can bind to the half-site in different orientations or repeats either as a monomer, a homo- dimer or a heterodimer [2]. For heterodimer binding,

Abbreviations BAC, bacterial artificial chromosome; DBD, DNA-binding domain; GST, glutathione S-transferase; LBD, ligand-binding domain; NR, nuclear receptor; RAR, retinoic acid receptor; SD, synthetic dropout.

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

390

W. Wu et al.

S. mansoni NR1

the nuclear receptor Retinoic X Receptor (RXR) acts as a critical partner and thus plays a central role in a variety of nuclear signaling pathways [3–6].

Schistosoma mansoni

that

is a multicellular eukaryotic parasite with a complex life cycle that involves mam- malian and snail hosts. Study of schistosome NRs enables us to understand how they regulate signaling pathways in the schistosome itself and to understand the molecular relationship between the schistosome and vertebrate and snail hosts. Recently two S. man- soni RXR homologues, SmRXR1 [7] and SmRXR2 [8,9], have been identified and characterized. SmRXR1 demonstrated that it may have an important role in regulation female-specific p14 genes [7]. SmRXR2 also showed a pattern of recognition of cis-sequences pre- sent in the p14 gene [10]. SmRXR1 and SmRXR2 are expressed throughout schistosome development sug- gesting that they play a pleiotropic role in the regula- tion of a number of genes [7–10]. Study of SmRXR partners will add to our knowledge of nuclear receptor gene regulation in schistosomes and to an understand- ing of the evolution of RXR’s function. We present herein the characterization of a nuclear receptor sub- family I member from S. mansoni (SmNR1) and dem- onstrate its interaction with SmRXR1.

in SmNR1 (Fig. 1B);

is present

Results

cDNA isolation

LBD. However, the DBD terminates at amino acid 332 and the signature sequence of the LBD (Ts) starts at amino acid 513 (Fig. 1B). The end of the hinge region to Ts is usually (cid:2)40 amino acids in most NRs, and the length of the hinge in SmNR1 thus can be estimated to be (cid:2)140 amino acids. The role of the large hinge in schistosome NRs remains unknown. The degree of conservation of the LBD in SmNR1 is lower, helices 1–2 are highly divergent as mentioned above, in other S. mansoni NRs like [7–9,11–14]. Although the LBD of SmNR1 is less conserved, the consensus signature of LBD (F,WY)(A,SI)(K,R,E,G) (Q,K)XX(L,V)(L,I,F) XXX(F,L)XX(L,V,IXXX(D,S) [15,16] (from the C-terminus of helix 3 to the middle of helix 5) and the consensus motif II EFXXXLXXLX LDXXEXALLKAIXLFSXDRXGLXXXXXVEXLQE XXXXALXXY [17] (from helix 7 to helix 9) is highly conserved (Fig. 1B). One amino acid in helix 10 has been demonstrated to have an important role in het- erodimer formation with RXRs. In SmNR1, a methi- onine that occurs at position 668 may be an amino acid that corresponds to the amino acids found in hRARc and LXRa [18]. This suggests that helix 10 of SmNR1 is probably involved in forming a dimer with SmRXR (Fig. 1B). A putative AF2 activating domain it core (AF2-AD) exhibits a high degree of conservation (represented by CLKEFL) in comparison with the common consensus AF2-AD core structure of FFXEFF, where F denotes a hydrophobic residue [19,20].

Phylogenetic analysis

tree was

constructed using

A 2343 bp cDNA containing the 5¢-UTR, entire open reading frame, 3¢UTR and poly A tail was isolated by PCR. An additional 62 bp 5¢ UTR was extended by 5¢ RACE generating a 2406 bp cDNA. The sequence was confirmed as belonging to a single mRNA species by sequencing the products of PCR on single-stranded cDNA using primers within the 5¢-and 3¢ UTR.

the A phylogenetic maximum likelihood method under the Jones–Taylor– Thornton substitution model, with a gamma distribu- tion of rates between sites (eight categories, parameter alpha). Support values for the tree were obtained by bootstrapping 100 replicates (Fig. 2). The result shows that SmNR1 is a divergent member belonging to NR subfamily I. The same result was obtained by Bayesian inference and neighbor-joining distance analysis (sup- plementary Figs S1 and S2). Even though SmNR1 was clustered with Onchocerca volvulus NR1 on the maxi- mum likelihood tree, the low bootstrap value (29%) did not support SmNR1 to be an orthologue to O. volvulus NR1 (Fig. 2).

Chromosome localization and gene organization

receptors

The cDNA of SmNR1 encodes an open reading frame of 2145 bp corresponding to a 715 amino acid protein. The DNA binding domain (DBD) is highly conserved, the P-box (EGCKG), which is involved in determining DNA binding specificity, is identical to most members of nuclear receptor subfamily I, for instance retinoic acid receptor (RAR) and vitamin D3 receptor. In a C-terminal extension of the DBD, the T-box which corresponds to a dimerization interface is highly conserved, but the A-box showed less conserva- tion (for example, 33.3% similarity to hRAR gamma and 22.2% to dHR3) (Fig. 1A). The hinge region (D domain) of SmNR1 is unusually long, similar to other [7–9,11–14]. reported schistosome nuclear The precise length of the D domain was not deter- mined due to the highly divergent helices 1–2 in the

A bacterial artificial chromosome (BAC) library of S. mansoni [21] was screened with a SmNR1-specific probe, and three positive clones (SmBAC1 28A22,

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

391

W. Wu et al.

S. mansoni NR1

A

DNA binding domain

B Ligand binding domain

Fig. 1. Sequence alignment. (A) Alignment of DNA binding domain (C domain) and its C-terminal extension. (B) Alignment of ligand binding domain (E domain) (after helix 2). Helices as described in [60] are boxed. The putative autonomous activation domain (AF2-AD) is also indicated. The number at the end of each line indicates residue position in the original sequence. H3-H12, helices 3–12.

SmBAC1 121N20 and SmBAC1 41A19) were identi- fied. SmBAC1 41A19 was used as a probe for fluores- cent in situ hybridization and SmNR1 was localized to chromosome 1 (Fig. 3).

(supplementary Table S1). The 5¢-UTR is encoded by two exons, A ⁄ B, C (DBD), hinge and E–F domain (LBD) are each encoded by 2–3 exons, respectively (Fig. 4B).

Gene organization of SmNR1 was determined by sequencing BAC DNA (SmBAC1 41A19) and by cDNA alignment with a 24 kb genomic DNA contig (Contig_0012771) obtained from WTSI S. mansoni WGS database (ftp://ftp.sanger.ac.uk/pub/databases/ Trematode/S.mansoni/genome). The SmNR1 gene con- sists of eight exons spanning over 14 kb (Fig. 4A), and all splice donor and acceptor sites fit the GT-AG rule

We previously demonstrated that the splice junction in the DBD encoding region was conserved in SmNR1 [22]. In vertebrate NRs, two conserved splice sites were identified in the LBD encoding region, one is in motif I (also known as signature sequence of LBD) and the other is in motif II [17]. The splice junction of motif I in SmNR1 is at the same position as that found only in RARs (NR1B) [17] (Fig. 4C). The splice site of

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

392

W. Wu et al.

S. mansoni NR1

Fig. 3. Fluorescent in situ hybridization mapping of SmNR1. Mitotic metaphase chromosomes (2n ¼ 16) of male schistosomes obtained from the S. mansoni sporocyst stage. SmBAC 41A19 BAC DNA was used as a probe and hybridized to chromosome 1. Scale bar ¼ 6 lm.

structure of SmNR1 is ancient and has been main- tained through out evolution of NRs.

Developmental expression

Quantitative real-time RT-PCR was performed to evaluate mRNA expression of SmNR1. Normalized gene expression [23] was standardized to the relative quantities of S. mansoni a-tubulin. SmNR1 was expressed in all tested stages, with a higher expression in eggs (19.9-fold greater than male worms), sporocysts (13.6-fold greater than male worms) and 21-day worms (6.8-fold greater than male worms). It was expressed in a similar manner in the other developmental stages that SmNR1 is tested (Fig. 5). The results suggest expressed throughout development but may have a more significant role in the development of eggs, sporocysts and 21-day worms.

Determination of transactivation

Fig. 2. Phylogenetic tree of SmNR1. A maximum likelihood tree showing that SmNR1 (in black) is a member of the NR subfamily I. The phylogenetic tree was constructed by maximum likelihood method under the Jones–Taylor–Thornton substitution model with a gamma distribution of rates between sites (eight categories, parame- ter alpha). Support values for the tree were obtained by boot- strapping, 100 replicates. The subfamilies are according to the nomenclature system for the nuclear receptor (for nuclear receptor nomenclature, see http://www.ens-lyon.fr/LBMC/laudet/nurebase/ nomenclature/Nomenclature.html). The GenBank accession numbers of the analyzed sequences are provided in supplementary Table S2.

motif II in SmNR1 is located at the same conserved position as found in all analyzed NRs [17]. The con- served splice junctions in SmNR1 suggest that the gene

A yeast one-hybrid assay was employed to determine whether ligand-independent autonomous transactiva- tion function was present in SmNR1. Yeast strain transformed with pGBKT7-SmNR1, AH109 was pGBKT7-SmNR1(A ⁄ B) (containing the A ⁄ B domain) and pGBKT7-SmNR1(CF) (without the A ⁄ B domain), respectively, spread on synthetic dropout (SD) ⁄ –Leu media and SD ⁄ –Leu ⁄ –His medium plus 3 mm 3-AT. Yeasts transformed with pGBK-SmNR1 or pGBK- SmNR1(A ⁄ B) grew on both SD ⁄ –Leu medium and

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

393

W. Wu et al.

S. mansoni NR1

A

B

C

Fig. 4. Gene structure of SmNR1. (A) Show- ing exons and size of introns; roman numer- als indicate exons. (B) Showing the size of exons and their correspondence to the dif- ferent NR domains. A ⁄ B, A ⁄ B domain; C, C domain (DBD); D, D domain (hinge); Ts, sig- nature sequence of the LBD; E, E domain (LBD) after Ts. (C) Showing the splice junc- tion of SmNR1 within motif I which is at the same position as that found only in RARs (NR1B) [17]. hRARa, human retinoic acid receptor alpha (GenBank: AC018629); CiRAR, C. intestinalis retinoic acid receptor (www.jgi.doe.gov, Genomic sequence Scaf- fold (v 1.0): (14). H4, helix 4; H5, helix 5.

formed with the control plasmids grew as expected (see the legend to Fig. 6A for a complete explanation).

SmNR1 interacts with SmRXR1

SmNR1

SmRXR1

interacted with

Fig. 5. Quantitative real-time RT-PCR shows mRNA expression of SmNR1. Gene expression [23] of SmNR1 was normalized to the relative quantities of S. mansoni a-tubulin. For graphical representa- tion of fold of expression, the normalized expression was recalcu- lated by dividing the expression level of each stage by the lowest expression stage (male worms). Egg, eggs; Sp, secondary sporo- cysts in 30-day infected snail; Cer, Cercariae; 15d, 15-day schistos- omules; 21d, 21-day schistosomules; 28d, 28-day worms; 35d, 35-day worms; Pair, adult worm pairs; Female, adult female worms; Male, adult male worms.

SD ⁄ –Trp ⁄ –His medium plus 3 mm 3-AT (Fig. 6A), while yeasts transformed with pGBK-SmNR1(CF) grew on SD ⁄ –Leu medium but not on SD ⁄ –Trp ⁄ –His medium plus 3 mm 3-AT (Fig. 6A). The results sugges- ted that both full-length and the A ⁄ B domain of SmNR1 activated transcription of GAL4 reporter gene in the absence of ligand, while the C-F domain did not. Thus the A ⁄ B domain exhibits an autonomous transactivation function (AF-1) element. Yeast trans-

A yeast two-hybrid assay was performed to address whether or SmRXR2, or acted as a homodimer in a yeast system. As the A ⁄ B domain of SmNR1 (as demonstrated above) and SmRXR1 can activate transcription of GAL4 reporter [7], SmNR1(CF) and SmRXR1(CF) were used in the DBD vectors. Yeast transformed with pSV40 ⁄ p53 (positive control), pSV40 ⁄ pLamin C (negative control), pGBK-SmNR1(CF) ⁄ pACT-SmRXR1, pAS- SmRXR1(CF) ⁄ pGAD-SmNR1, pGBK-SmNR1(CF) ⁄ pACT-SmRXR2, pAS-SmRXR2 ⁄ pGAD-SmNR1 and pGBK-SmNR1(CF) ⁄ pGAD-SmNR1 grew on SD ⁄ –Trp ⁄ –Leu medium. If SmNR1 interacts with SmRXR1 or SmRXR2, or acts as a homodimer, the Gal4 DNA binding domain fusion partner will bind to the Gal1 UAS element and the Gal4 activation domain will drive transcription of HIS reporter gene. Yeasts cotrans- formed with pGBK-SmNR1(CF) ⁄ pACT-SmRXR1 or pAS-SmRXR1(CF) ⁄ pGAD-SmNR1 grew on SD ⁄ –Trp ⁄ –His ⁄ –Leu medium plus 3 mm 3-AT, indicting that SmNR1 and SmRXR1 interacted. Yeasts cotrans- pGBK-SmNR1(CF) ⁄ pACT-SmRXR2, formed with pAS-SmRXR2 ⁄ pGAD-SmNR1 pGBK-SmNR1 or (CF) ⁄ pGAD-SmNR1 did not grow on SD ⁄ –Trp ⁄ –His ⁄ –Leu medium plus 3 mm 3-AT, indicating that SmNR1 did not interact with SmRXR2 or act as a homodimer. The positive control yeast cotransformed with plasmids pSV40 ⁄ p53 grew on SD ⁄ –Trp ⁄ –His ⁄ –Leu

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

394

W. Wu et al.

S. mansoni NR1

A

B

SmRXR1 at a level similar to that of SmNR1 suggest- ing that there was a heterodimer interface located in SmNR1 EF domain (Fig. 7B).

the reporter gene.

DNA binding assays with SmNR1 ⁄ SmRXR1 heterodimers

(A) Yeast one hybrid Fig. 6. Yeast one and two-hybrid assays. assay showing that SmNR1 contains an autonomous transactivation function in A ⁄ B domain. Individual AH109 yeast colonies obtained from an initial transformation were re-streaked on SD ⁄ –Trp medium and on SD ⁄ –Trp ⁄ –His medium plus 3 mM 3-AT. (a) Diagram of reporter system used in yeast one-hybrid assay. The HIS3 reporter gene is controlled by binding of the Gal4 DNA binding domain (GAL4DB) to the GAL4 response elements. When a GAL4BD fusion protein contains an activation domain, it will transactivate (b) On SD ⁄ –Trp medium, the expression of the reporter genes. yeasts transformed with pGBKT7-SmNR1 (streak 1), pGBKT7- SmNR1(A ⁄ B) (streak 2), pGBKT7-SmNR1(CF) (streak 3), P53 (streak 4), PSV40 ⁄ P53 (streak 6), pLamin C (streak 7) and pLamin C ⁄ PSV40 (streak 8) grew, because pGBKT7, P53 and pLamin C plasmids expressed trp gene, yeasts transformed with PSV40 did not grow because PSV40 plasmid did not express trp gene (streak 5, negative control). (c) On SD ⁄ –Trp ⁄ –His medium plus 3 mM 3-AT, yeasts transformed with P53 (streak 4), PSV40 (streak 5), pLamin C (streak 7) and pLamin C ⁄ PSV40 (streak 8) did not grow, because P53 and pLamin C plasmids did not express the trp gene. Yeasts transformed with pGBKT7-SmNR1(CF) (streak 3) did not grow, indi- cating that the C-F domain of SmNR1 could not active transcription of the His reporter gene. Yeasts transformed with pGBKT7-SmNR1 (streak 1) and pGBKT7-SmNR1(A ⁄ B) (streak 2) grew indicating that the A ⁄ B domain contains an activation function to active transcrip- tion of His reporter gene. PSV40 ⁄ P53 (streak 6, positive control) grew as expected. (B) Yeast two hybrid assay showing SmNR1 interaction with SmRXR1. (a) Diagram of the system used in yeast two hybridization. If protein 1 (P1) interacts with protein 2 (P2), the Gal4 DNA binding domain fusion partner will bind to the Gal1 UAS element and the Gal4 activation domain will drive transcription of Individual AH109 yeast the expression of transformation were re-streaked colonies obtained from initial and on SD ⁄ –Trp ⁄ –Leu ⁄ –His on SD ⁄ –Trp ⁄ –Leu medium (b) medium plus 3 mM 3-AT (c). Streak 1, pSV40 ⁄ p53 (positive control); streak 2, pSV40 ⁄ pLamin C (negative control); streak 3, pGBK-SmNR1(CF) ⁄ pGAD-SmNR1; streak 4, pAS-SmRXR1(CF) ⁄ pGAD-SmNR1; streak 5, pGBK-SmNR1(CF) ⁄ pACT-SmRXR1; streak 6, pAS-SmRXR2 ⁄ pGAD-SmNR1; and streak 7, pGBK-SmNR1(CF) ⁄ pACT-SmRXR2.

separated by nucleic acids

medium plus 3 mm 3-AT, yeast cotransformed with the negative control plasmids pSV40 ⁄ pLamin C did not grow on SD ⁄ –Trp ⁄ –His ⁄ –Leu medium plus 3 mm 3-AT as expected (Fig. 6B).

Electrophoretic mobility shift assays were performed to determine DNA binding specificity of SmNR1. A DNA element containing the half-site AGGTCA, a direct repeat of the half-site spaced with 0–5 nucleic acids (DR0-DR5) and palindrome repeat of the half- site not (Pal0) were employed. No gel shift was observed when c-32P-labe- led half-site DR0-DR5 or Pal0 were added to SmNR1 alone (Fig. 8). Smears were observed when the same oligonucleotides were added to SmRXR1, and strong shifts were observed when the oligonucleo- tides were added to SmNR1 ⁄ SmRXR1 (Fig. 8). A weak shift was observed when labeled half-site was added to SmNR1 ⁄ SmRXR1 (Fig. 8). The results indi- cated that SmNR1 did not bind to the tested oligonu- cleotides, SmRXR1 bound to the oligonucleotides in an unstable state and SmNR1 ⁄ SmRXR1 heterodimer strongly bound to the target oligonucleotides. The results suggest that SmNR1 requires heterodimeriza- tion with SmRXR1 to bind to the tested DNA ele- ments.

The preference for SmNR1 ⁄ SmRXR1 heterodimer binding to oligonucleotides was determined by competi-

A glutathione S-transferase (GST) pull-down assay was performed to verify the interaction of SmNR1 and SmRXR1 in vitro. To address whether the heterodimer interface is located in the EF domain, both SmNR1 and SmNR1(EF) were employed. GST-SmNR1 and GST-SmNR1(EF) fusion proteins were immobilized on glutathione beads. 35S-labeled SmRXR1 was produced in a rabbit reticulocyte system. GST protein was used as a negative control. The pull-down results showed that both SmNR1 and SmNR1(EF) interacted with SmRXR1 (Fig. 7A). SmNR1(EF) interacted with

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

395

W. Wu et al.

S. mansoni NR1

A

B

The results showed that a 10-fold excess of unlabelled specific oligonucleotides led to a reduction in the signal, while a 50- and 200-fold excess of unlabelled specific competitors completely abolished the binding of the labeled DR4. No reduction of binding was observed when unlabelled nonspecific oligonucleotides were used (Fig. 9). The order of preference for SmNR1 ⁄ SmRXR1 heterodimer binding to DNA elements was thus determined by competition of a 10-fold excess of unlabe- led specific oligonucleotides to be DR2 > DR5 > DR3 > DR4 > DR1 > DR0 > Pal0.

To determine the role of

(a) GST-SmNR1 ⁄ pCITE-SmRXR1 reaction.

the

relative band intensities of SmNR1 ⁄ SmRXR1

Fig. 7. GST pull-down assay showing SmNR1 interaction with SmRXR1 in vitro. (A) 35S-labeled SmRXR1 was synthesized in vitro using pCITE-SmRXR1 as template and then incubated with GST- SmNR1, GST-SmNR1(EF) or GST (negative control) protein affixed to glutathione-Sepharose beads. The beads were collected, washed and the bound protein was resolved on 10% SDS acrylamide gel and visualized by autoradiography. Each experiment was repeated three times. (b) GST- SmNR1(EF) ⁄ pCITE-SmRXR1 reaction. (B) Bar graph representation and of SmNR1(EF) ⁄ SmRXR1 reaction and compared with SmRXR1 input. (a) GST-SmNR1 ⁄ pCITE-SmRXR1 reaction. (b) GST-SmNR1(EF) ⁄ pCITE-SmRXR1 reaction. The diagram explains the reactions.

tion of unlabeled DR0-DR5 and Pal0 with c-32P-labeled DR4 (Fig. 9). A 10-, 50- and 200-fold molar excess of unlabelled oligonucleotides was used for competition.

the A ⁄ B domain of SmNR1 in DNA binding, SmNR1(CF) ⁄ SmRXR1 binding to DR1 and DR2 were employed. Although SmNR1(EF) can form a heterodimer with SmRXR1 (demonstrated by pull-down experiment, Fig. 7), no shifts were observed when c-32P-labeled DR1 and DR2 were added to SmNR1(CF) ⁄ SmRXR1, while strong shifts were observed when same oligonucleotides were added to SmNR1 ⁄ SmRXR1 (Figs 8 and 10). The results suggested that the A ⁄ B domain of SmNR1 was necessary for SmNR1 ⁄ SmRXR1 heterodimer to bind to the tested DNA elements. To determine the role of the C-terminal extension of SmNR1 and SmRXR1 in binding to DNA elements, in vitro synthesized SmNR1 (Ile247 to Ser372) (containing 20 amino acids at the 5¢ end of the DBD, the DBD and 40 amino acids at 3¢ end of the DBD) and SmRXR1 (Glu251 to Asn376) (containing 20 amino acids at 5¢ end of the DBD, the DBD and 40 amino acids at the 3¢ end of the DBD) were tested. Both SmNR1 (Ile247 to Ser372) and SmRXR1 (Glu251 to Asn376) bound to half-site, and

Fig. 8. DNA binding of SmNR1 and SmRXR1 in vitro. A single protein or a combination of two proteins were synthesized in a TNT quick cou- pled transcription ⁄ translation system (Promega) and allowed to bind to c-32P-labeled DNA elements containing a half-site, DR0-DR5 and Pal0. Lanes 1, 5, 9, 13, 17, 21, 25 and 29 contain lysate from the control transcription-translation reaction as negative controls. Lanes 2, 6, 10, 14, 18, 22, 26 and 30 contain lysate with in vitro translated SmNR1. Lanes 3, 7, 11, 15, 19, 23, 27 and 31 contain lysate with in vitro translated SmNR1 and SmRXR1. Lanes 4, 8, 12, 16, 20, 24, 28 and 32 contain lysate with in vitro translated SmRXR1. NS, nonspecific binding.

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

396

W. Wu et al.

S. mansoni NR1

Fig. 9. Competition of DNA binding to SmNR1 ⁄ SmRXR1 heterodimer in vitro. Combination of SmNR1 and SmRXR1 proteins were synthes- ized in vitro, added to c-32P-labeled DR4. Unlabelled DR0-DR5, Pal0 or unrelated oligonucleotides (·10, ·50 and ·200 fold, respectively) were added to compete with labeled DR4. Lanes 1, 11 and 21 contain lysate from the control transcription-translation reaction as negative con- trols. Lanes 2, 12 and 22 contain no competitor. Lanes 3, 13 and 23 contain nonspecific competitor. Lanes 4, 14 and 24 contain DR0 as competitor. Lanes 5, 15 and 25 contain DR1 as competitor. Lanes 6, 16 and 26 contain DR2 as competitor. Lanes 7, 17 and 27 contain DR3 as competitor. Lanes 8, 18 and 28 contain DR4 as competitor. Lanes 9, 19 and 29 contain DR5 as competitor. Lanes 10, 20 and 30 contain Pal0 as competitor. NS, nonspecific binding.

mammalian COS-7 cells. The results showed that SmNR1 ⁄ SmRXR1 activated the reporter gene with a significant difference to control plasmid PcDNA [degrees of freedom (d.f.) ¼ 9, p ¼ 0.03] (Fig. 12).

Discussion

Phylogenetic analysis shows that SmNR1 is a divergent member of NR subfamily I with no known orthologue. This suggests that other unknown NR groups may be expected to be present in invertebrate lineages as their sequences become available for analysis. SmNR1 is a new NR group which does not exist in Drosophila, Caenorhabditis or vertebrates whose NR complement is well studied.

SmNR1 (Ile247 to Ser372) bound to DR2, weakly to DR1, DR4 and DR5. SmRXR1 (Glu251 to Asn376) bound to DR1, DR2, DR4 and DR5 (Fig. 11). SmNR1 (Ile247 to Ser372) and SmRXR1 (Glu251 to Asn376) did not form a heterodimer to bind to the DNA elements. The results suggest that although there is a dimer interface located in DBD and C-terminal extension [24–26], the D-E domain has an important role in SmNR1 ⁄ SmRXR1 heterodimer binding to the DNA elements. Figure 10 demonstrated that SmNR1 CF could not bind to DR1 or DR2 elements, while SmNR1 missing both the A ⁄ B and E ⁄ F domains (Fig. 11) was capable of binding to a half-site and the E ⁄ F to several DR elements. We suggest that domains of SmNR1 might prevent the interaction between the C domain of SmNR1 and DNA response elements, as previously demonstrated for S. mansoni RXR2 [8].

Transcriptional activation of a DR2 element-dependent reporter gene

the corresponding mRNAs

Electrophoretic mobility shift assay results showed that SmNR1 ⁄ SmRXR1 heterodimer could bind to DNA element DR2 strongly. A pUTK-3xDR2 reporter plasmid was constructed to test the ability of SmNR1 ⁄ SmRXR1 in to transactivate DR2-dependent

reporter

gene

Recently an alternative splice variant of SmNR1 was sequence (nt 1–84) identified (DQ439962). Our 5¢ aligns to nt 3397–3480 on the genomic DNA Con- tig_0012771, while the first exon of DQ439962 runs from nt 4069–4166. Both variants encode the same protein sequence; this is therefore a case of alternative splicing in the noncoding region similar to what was found for the S. mansoni nuclear receptor, SmFtz-F1 [11]. Whether interact differently with the translational machinery or have different stabilities as proposed for SmFTZ-F1 [11] is yet to be determined.

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

397

W. Wu et al.

S. mansoni NR1

Fig. 10. DNA binding of SmNR1(CF) ⁄ SmRXR1 in vitro. A single pro- tein or a combination of two proteins were synthesized in a TNT quick coupled transcription ⁄ translation system and allowed to bind to c-32P-labeled DR1 and DR2, respectively. Lane 1, lysate from the control transcription-translation reaction with labeled DR1 as negative control; lanes 2–4, SmNR1(CF) ⁄ SmRXR1 with labeled DR1 plus indi- cated amounts of unlabeled DR1 as competitor; lanes 5–7, SmNR1 ⁄ SmRXR1 plus indicated amounts of unlabeled DR1 as com- petitor (positive control); lane 8, lysate from the control transcription- translation reaction with labeled DR2 as negative control; lanes 9–11, SmNR1(CF) ⁄ SmRXR1 with labeled DR2 plus indicated amounts of unlabeled DR2 as competitor; lanes 12–14, SmNR1 ⁄ SmRXR1 with labeled DR2 plus indicated amounts of unlabeled DR2 as competitor (positive control). NS, nonspecific binding.

DR4 or DR5 [25,27,29,31,41]. In insects, Drosophila USP (RXR homologue) forms a heterodimer with EcR that can bind to DR0-DR5 [28] and to an imperfect palindromic structure [42]. The DNA binding specifici- ty of RXR ⁄ NR heterodimer in most invertebrates is not well known. A recent study showed that S. man- soni SmRXR1 ⁄ SmFtz-F1 heterodimer could bind to SF-1 element (which contains a conserved half-site AGGTCA) via SmFtz-F1 physical binding to the DNA element, while SmRXR1 did not bind to the DNA [43]. In the mollusk, Biomphalaria glabrata RXR (BgRXR) was shown to bind to DR1 as a homodimer or as a heterodimer with mammalian RARa, LXR, FXR or PPARa [33]. In this study, we showed that SmNR1 ⁄ SmRXR1 heterodimer could bind to DR0- DR5, as such it is similar to the Drosophila USP ⁄ EcR heterodimer [28] but with a different preference order (Fig. 9). The results suggest that RXR ⁄ NR heterodi- mer obtained the ability to bind to conserved half-site repeats before the split of Arthopods and Platyhelm- inths, but has not subsequently evolved a strict spacing between half-sites as it can bind to all of DR1 to DR5 elements. This lack of binding specificity is different from the vertebrate RXR ⁄ RAR interaction that can bind to DR1, DR2 and DR5 but not to DR3 or DR4 [25,31]. SmRXR1 alone was known to bind to a non- conserved direct repeat in the promoter region of S. mansoni p14 gene [7]. In this report, we demonstra- ted that SmRXR1 alone could also bind to a con- served half-site and direct repeats of half-site (Fig. 8). In addition, we showed that SmNR1 ⁄ SmRXR1 het- erodimer could bind in vitro to a perfect palindrome (Pal0) containing element (Figs 8 and 9). Further stud- ies of SmNR1 will help us to understand the mechan- ism of RXR ⁄ NR signal pathway in invertebrates and its evolutionary role.

autonomous

transactivation

A yeast one-hybrid assay was employed and a ligand- function independent (AF1) was determined to be present in the A ⁄ B domain of SmNR1. Furthermore, we demonstrated that the A ⁄ B domain has an important role in determining SmNR1 ⁄ SmRXR1 heterodimer binding to the DNA in the A ⁄ B domain element. That amino acids can affect DNA binding and dimerization has previ- ously been reported in the chicken thyroid hormone receptor [44].

Most NRs which can form a heterodimer with RXR are from subfamily I, for example, thyroid hormone receptor and RAR [2]. Our studies show that SmNR1 exhibits similarity to RAR, PPAR and EcR, which need RXR to form a heterodimer to confer hormone response element binding [25,27–31]. RXRs have been characterized in a wide variety of metazoans, including in Cnidaria [32], Platyhelminths [7–9], Mollusca [33], Nematoda [34] and Arthropoda [35,36], and verte- brates [37,38]. The functional relationship between vertebrate RXR with other NRs was described as the 1-2-3-4-5 rule [39,40] and was extended to insect RXR ⁄ EcR heterodimers [28]. For example, vertebrate RXR ⁄ RAR can bind to DR1, DR2 and DR5 but not to DR3 or DR4, RXR ⁄ vitamin D3 receptor heterodimer can bind to DR3 but not to DR1, DR2,

Our data shows that SmNR1 ⁄ SmRXR1 can activate transcription from a DR2-dependent reporter plasmid in mammalian cells (Fig. 12). Future studies will exam- ine transcriptional activation in detail. Although the full-length of SmNR1 could not bind to the response the presence of SmRXR1 in vitro element without (Fig. 8), SmNR1 alone enhanced transactivation of

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

398

W. Wu et al.

S. mansoni NR1

Fig. 11. DNA binding of SmNR1(Ile247-Ser372) and SmRXR1(Glu251-Asn376) in vitro. DNA binding of a protein containing 20 amino acids at the 5¢ end of the DBD, the DBD and the 40 amino acids at the 3¢ end of the DBD of SmNR1 (Ile247-Ser372) and SmRXR1 (Glu251-Asn376) were tested in vitro. Lanes 1, 5, 9, 13, 17, 21, 25 and 29, lysate from the control transcription-translation reaction as negative control; lanes 2, 6, 10, 14, 18, 22, 26 and 30 contain with lysate with in vitro translated SmNR1(Ile247-Ser372); lanes 3, 7, 11, 15, 19, 23, 27 and 31, lysate with in vitro translated SmNR1(Ile247-Ser372) and SmRXR1(Glu251-Asn376); lanes 4, 8, 12, 16, 20, 24, 28 and 32, lysate with in vitro trans- lated SmRXR1(Glu251-Asn376). NS, nonspecific binding.

6

*

5

suggests

4

3

l

n o i t a v i t c a d o F

2

1

0

PcDNA

SmNR1

SmRXR1

SmNR1+SmRXR1

down assays show no evidence for homodimerization of SmNR1 (Fig. 6, unpublished data). The ability of SmNR1 ⁄ SmRXR1 to transactivate DR2-dependent reporter gene that in mammalian cells SmNR1 ⁄ SmRXR1 can interact with mammalian coac- tivators of transcription, and S. mansoni coactivators of transcription may have a similar mechanism to SmNR1 ⁄ SmRXR1. Recently four NR coactivators, SmGCN5, SmPRMT1, SmCBP1 and SmCBP2 were isolated from S. mansoni [45–47]. It was shown that they could interact with schistosome NRs. For exam- ple, SmCBP1 interacted with S. mansoni nuclear recep- tor SmFTZ-F1 and exhibit transcriptional activity in mammalian cells [47]. Importantly, the interaction of SmNR1 ⁄ SmRXR1 is demonstrated by in vitro (GST pull-down assays) and in vivo (yeast two-hybrid and mammal cell assays) results. Likewise, the ability of the heterodimer to bind DNA is shown by in vitro (electrophoretic mobility shift assay) assays and to bind DNA and drive transcription in a mammalian cell reporter gene assay in in vivo results.

cells

Experimental procedures

Fig. 12. SmNR1 ⁄ SmRXR1 transactivated DR2-dependent reporter gene in vivo. Mammalian COS-7 cells were transfected with pUTK- DR2 reporter plasmids, pRL4.74 and various expression plasmids for pcDNA-3.1, SmNR1, SmRXR1 and SmNR1 ⁄ SmRXR1. Cells were lysed and luciferase activities were measured 48 h after transfection. Results are expressed in fold activation (relative to the pcDNA-3.1 vector control). Each experiment was repeated at least three times. The statistical significance of increase in luciferase activities of transfected with SmNR1, SmRXR1 and SmNR1 ⁄ SmRXR1 compared to cells transfected with pCDNA-3.1 was determined using Student’s t-test ( d.f. ¼ 9, *P < 0.05).

Parasites

transcription in mammalian cells. Whether SmNR1 can dimerize with mammalian RXR or whether a low level of homodimer formation of SmNR1 is needed is unknown. However, our yeast two-hybrid and pull-

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

399

glabrata) The NMRI strain of S. mansoni was maintained in snails (Biomphalaria and Syrian golden hamsters (Mesocricetus auratus). Cercariae were released from infec-

W. Wu et al.

S. mansoni NR1

BAC library screening, BAC DNA sequencing and chromosomal fluorescent in situ hybridization

Isolation of SmNR1 cDNA

ted snails and harvested on ice. Schistosome worms of dif- ferent ages (15–45 days old) were harvested from infected Syrian golden hamsters. Single-sex worms were obtained by separating adult worm pairs.

reverse primer:

S. mansoni SmBAC1 library was screened as previously described [21]. A SmNR1 specific probe of 497 bp was produced by PCR amplification with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose gel using Gel Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with 32P using a Metaprime kit (Amer- sham Pharmacia Biotech Inc., Piscataway, NJ, USA). For BAC DNA sequencing, the BAC clone was grown in 100 mL LB medium (12.5 lgÆmL)1 choramphenicol), BAC DNA was purified using Plasmid Midi kit (Qiagen) and se- quenced on an ABI-377 automatic sequencing machine (Applied Biosystems, Foster City, CA, USA). Fluorescent

in situ hybridization was performed on S. mansoni sporocyst metaphase chromosome spreads with BAC DNA using techniques previously described [52,53].

Genomic sequence analysis and gene organization

Sequence analysis and phylogenetic tree construction

PCR was performed using S. mansoni female worm phage [pBluescript SK (+ ⁄ –) phagemid] as cDNA library pool template DNA. The PCR primers for one end (either the 5¢ or 3¢ end) were designed according to the cDNA sequence of a short fragment previously cloned [22]. The primer for the other end (either the 5¢ or 3¢ end) was a vector universal primer (M13-Rev and T3, or M13-For and T7 primers). The 5¢-UTR was extended by rapid amplification of cDNA ends (RACE) using SMARTTM RACE cDNA Amplifica- tion Kit (BD Biosciences Clontech, Mountain View, CA 94043, USA). The sequence was confirmed as belonging to a single mRNA species by sequencing the products of PCR on single-stranded cDNA using primers within 5¢- and 3¢-UTR.

2) (after helix

Quantitative real-time RT-PCR

Exon ⁄ intron boundaries of SmNR1 were determined by sequencing BAC DNA of SmBAC1 41A19 obtained by BAC library screening. Primers were designed according to the different regions of cDNA and the entire encoding regions were sequenced. Intron sizes were determined by alignment of cDNA with a genomic DNA contig (Contig_0012771) obtained from WTSI database (ftp://ftp.sanger.ac.uk/pub/ databases/Trematode/S.mansoni/genome).

The phylogenetic tree was constructed using deduced aligned DBD and LBD sequences with clustalw (http://www.cf.ac.uk/biosi/research/biosoft/ Downloads/clustalw.html) (supplementary Fig. S3). Phylo- genetic analysis of the data set was carried out using the the Jones–Taylor– maximum likelihood method under Thornton substitution model [48] with a gamma distribu- tion of rates between sites (eight categories, parameter alpha, estimated by the program) using phyml (v2.4.4) [49]. Support values for the tree were obtained by boot- strapping 100 replicates.

TM

categories, parameter estimated alpha,

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

400

mRNA expression of SmNR1 in eggs, secondary sporocysts (in 30-day infected snail), cercariae, 15-day schistosomules, 21-day schistosomules, 28-day worms, 35-day worms, adult worm pairs, adult female worms and adult male worms were analyzed by quantitative real time RT-PCR. Total RNA was extracted using TRIzol reagent (Invitrogen, Car- lsbad, CA, USA), treated with RNase-free DNaseI (RQ1 DNase; Promega, Madison, WI, USA) and reverse tran- scribed using a random hexamer and SuperScript Reverse Transcriptase II (SSRTaseII; Invitrogen) [22]. Reverse-tran- scribed cDNA samples were used as templates for PCR amplification using SYBR Green Master Mix(cid:2) (Invitrogen) and BIO-RAD IQTM5 Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA 94547, USA). Primers specific for SmNR1 (forward: 5¢-AAAAACATCCCCC- ATTTCAGAA-3¢, reverse: 5¢-AACTACGCACATTCGGG- TTGA-3¢) were designed by Primer Express Program ) and primers specific for S. mansoni (Applied Biosystems a-tubulin (GenBank M80214) were designed according to [54]. The efficiency for each primer set is evaluated and The same data set was also tested by Bayesian inference [50] and neighbor-joining distance [51] methods. For Bayesian inference, the data set was analyzed under the Jones–Taylor–Thornton substitution model with a gamma distribution of rates between sites using mrbayes v3.1.1 [50]. The trees were started randomly; four simultaneous Markov chains were run for 3 million generations. The trees were sampled every 100 generations. Bayesian poster- ior probabilities were calculated using a Markov chain Monte Carlo (MCMC) sampling approach implemented in mrbayes v3.1.1, with a burn-in value setting at 7500 gener- ations. For neighbor-joining distance analysis, the data set was analyzed under Jones–Taylor–Thornton substitution model with a gamma distribution of rates between sites (eight using PHYML) using phylip package v3.62 (http://evolution. for genetics.washington.edu/phylip.html). Support values the tree were obtained by bootstrapping a 1000 replicates with seqboot implemented in the phylip package v3.62.

W. Wu et al.

S. mansoni NR1

Yeast one-hybrid assay

GST pull-down assay

35S-methionine

recorded during assay development by iQ5 application (cDNA is diluted to ·1-, ·10-, ·100- and ·1000-fold; see protocol of Bio-Rad iQ5 application). Normalized gene expression [23] of SmNR1 was calculated and standardized to the relative quantities of S. mansoni a-tubulin using Bio- Rad IQTM5 Optical System software v1.1 with the Normal- ized Expression calculations implemented in iQ5 according to the manufacturer’s protocol. For graphical representa- tion of fold of expression, the normalized expression was recalculated by dividing the expression level of each stage by the lowest expression level by iQ5. performed using Frozen-EZ transformation II kit (Zymo Research). Yeast from single transformations of DNA binding domain constructs were spread on SD ⁄ –Trp med- ium and SD ⁄ –Trp ⁄ –His medium plus 3 mm 3-AT. Yeasts from single transformations of activation domain constructs were spread on SD ⁄ –Leu medium and SD ⁄ –Leu ⁄ –His med- ium plus 3 mm 3-AT. All cotransformed yeasts were plated on SD ⁄ –Trp ⁄ –Leu medium and SD medium lacking trypto- leucine, histidine HCl monohydrate and adenine phan, hemisulfate salt (SD ⁄ –Trp ⁄ –His ⁄ –Leu ⁄ –Ade) medium plus 3 mm 3-AT.

incorporation was respectively. Yeast for reporter genes) was pGBK-SmNR1, pGBK-SmNR1(CF)

pGEX-SmNR1 transformed with and

Yeast two-hybrid assay

cDNA encoding full-length, C-F domain (Cys267-Phe715) and A ⁄ B domain (Met1-Met266) of SmNR1 were inserted into the DNA binding domain vector pGBK-T7 to form pGBK-SmNR1, pGBK-SmNR1(CF) and pGBK- strain AH109 (with SmNR1(A ⁄ B), LacZ ⁄ His transformed with 1 lg of pGBK- and SmNR1(A ⁄ B), respectively, spread on SD medium lacking tryptophan (SD ⁄ –Trp) and SD medium lacking tryptophan and histidine (SD ⁄ –Trp ⁄ –His) plus 3 mm 3-amino-1,2,4- triazole (3-AT, an inhibitor to prevent the leaky expression of HIS3 gene in host cell), and then incubated at 30 (cid:3)C. Transformations were performed using Frozen-EZ transfor- mation II kit (Zymo Research, Orange, CA, USA). The col- onies from SD ⁄ –Leu medium were streaked on SD ⁄ –Trp ⁄ –His medium plus 3 mm 3-AT to confirm the result. Yeasts transformed with p53, pLamin C, pSV40, pLaminc C ⁄ pSV40 and p53 ⁄ pSV40 (Stratagene, La Jolla, CA, USA) were used as positive or negative controls, respectively.

Electrphoretic mobility shift assay

cDNA encoding SmRXR1 was inserted into pCITE-4a vector to form pCITE-SmRXR1. cDNA inserts were tran- scribed and translated using Single Tube Protein System (Novagen, Madison, WI, USA). The manufacturer’s pro- followed. tocol cDNA encoding full-length and the E-F domain (Leu433- Phe715) of SmNR1 were inserted into pGEX-4T-1 vector to form pGEX-SmNR1 and pGEX-SmNR1(EF). Escheri- chia coli ad 494 (DE3) pLys S competent cells (Novagen) were pGEX- SmNR1(EF), respectively, and induced with isopropyl thio-b-d-galactoside to produce GST fusion proteins that were subsequently affinity purified over a glutathione-seph- arose column all by standard techniques. For pull-down assays, 50 lL of binding mixture containing binding buffer (50 mm Tris ⁄ HCl, pH 7.5, 100 mm NaCl, 10% glycerol, 0.15% Nonidet P40), GST-SmNR1 or GST-SmNR1(EF) fusion protein affixed to glutathione-sepharose beads (about 2 lg) and 2 lL of in vitro translation reaction was used. The reaction was incubated overnight at 4 (cid:3)C and washed three times with binding buffer [56]. The bound proteins were analyzed by running on 10% SDS ⁄ PAGE and autoradiography.

pCITE-SmNR1(Ile247-Ser372), and

performed: pGAD-SmNR1 ⁄ pAS-SmRXR1(CF),

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

401

and cDNAs encoding SmNR1, SmNR1(CF) (Cys267-Phe715), SmNR1(Ile247-Ser372) (containing 20 amino acids at the 5¢ end of DBD, DBD and 40 amino acids at the 3¢ end of DBD), SmRXR1 and SmRXR1(Glu251-Asn376) (con- taining 20 amino acids at the 5¢ end of DBD, DBD and 40 amino acids at the 3¢ end of DBD) were inserted into pCITE-4a vector to form pCITE-SmNR1, pCITE- SmNR1(CF), pCITE- pCITE-SmRXR1(Glu251-Asn376). The SmRXR1 proteins were produced in vitro using the TNT quick coupled transcription ⁄ translation system (Promega). The following complementary single-stranded oligonucleotides containing consensus half-sites AGGTCA [40,57,58] were synthesized: half-site: 5¢-GTACCGTAAGGTCACTCGC 5¢-CCGTAAGGTCAAGGTCACTCG-3¢, GT-3¢, DR0: cDNA encoding SmNR1 was inserted into the activation domain vector pGAD-T7 to form pGAD-SmNR1. pGBK- SmNR1(CF) was the same as for the yeast one-hybrid ana- lysis. cDNA encoding full-length and the C-F domain of SmRXR1 (GenBank AF094759) and SmRXR2 (GenBank AF129816) were previously ligated into activation domain vector pACT2 to form pACT-SmRXR1 and pACT- SmRXR2, and ligated into DNA binding domain vector pAS2 to form pAS-SmRXR1(CF) and pAS-SmRXR2 pre- viously [7,9,10,55]. Yeast strain AH109 was transformed with 1 lg of the following plasmids: pAS-SmRXR1(CF), pAS-SmRXR2, pACT-SmRXR1, pGBK-SmNR1(CF), pACT-SmRXR2, pGAD-SmNR1, and control plasmids pLamin C, pSV40 and p53. The following cotransfor- pGBK-SmNR1(CF) ⁄ pACT- mations were SmRXR1, pGBK- pGAD-SmNR1 ⁄ pAS- SmNR1(CF) ⁄ pACT-SmRXR2, SmRXR2, pGBK-SmNR1(CF) ⁄ pGAD-SmNR1, pSV40 ⁄ pSV40 ⁄ pLamin C. Transformations were p53

W. Wu et al.

S. mansoni NR1

compared to cells transfected with pcDNA-3.1 was deter- mined using Student’s t-test (d.f. ¼ 9).

Acknowledgements

The authors thank R. Pierce, Institut Pasteur de Lille for valuable suggestions. This research was supported by NIH grant AI046762. Schistosome infected snails were obtained from Fred Lewis (Biomedical Research Insti- tute), through NIH supply contract no. AI30026. Genomic DNA sequence (Contig_0012771) was pro- duced by Schistosoma mansoni Genome Project at the Sanger Institute and can be obtained from ftp://ftp.sanger. ac.uk/pub/databases/Trematode/S.mansoni/genome.

5¢-CCGTAAGGTCACAGGTCACTCG-3¢, DR2: DR1: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢, DR3: 5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGG TCACCAGGAGGTCACTCG-3¢. PAL0: 5¢-CGCAAGGT CATGACCTCG-3¢. One strand of each oligonucleotide was annealed after incubation at 100 (cid:3)C for 3 min to its comple- mentary oligonucleotide and then labeled with T4 polynucle- otide kinase and [c-32P]adenosine triphosphate. The binding reactions were incubated on ice for 40 min in 15 lL reaction mixture containing 40 000 cpm probes, 3 lL in vitro transla- tion reaction, 3 lL 5· buffer [20% glycerol, 5 mm MgCl2, 2.5 mm EDTA, 2.5 mm dithiothreitol, 250 mm NaCl, 50 mm Tris ⁄ HCl (pH 7.5), 0.25 mg mL)1 poly(dI-dC)Æpoly(dI-dC)], and then separated on 6% (v ⁄ v) native polyacrylamide gel containing 2.5% glycerol in 1· TBE buffer at 4 (cid:3)C. Gel was dried, exposed to X-ray film and autoradiographed.

References

Mammalian cell culture and transfection

1 Gronemeyer H & Laudet V (1995) Transcription factors 3: nuclear receptors. Protein Profile 2, 1173–1308. 2 Laudet V & Gronemeyer H (2001) The Nuclear Recep- tor Factsbook. Academic Press, New York, NY. 3 Berrodin TJ, Marks MS, Ozato K, Linney E & Lazar

MA (1992) Heterodimerization among thyroid hormone receptor, retinoic acid receptor, retinoid X receptor, chicken ovalbumin upstream promoter transcription fac- tor, and an endogenous liver protein. Mol Endocrinol 6, 1468–1478.

4 Leid M, Kastner P, Lyons R, Nakshatri H, Saunders M, Zacharewski T, Chen JY, Staub A, Garnier JM, Mader S et al. (1992) Purification, cloning, and RXR identity of the HeLa cell factor with which RAR or TR heterodimeri- zes to bind target sequences efficiently. Cell 68, 377–395. 5 Mangelsdorf DJ, Thummel C, Beato M, Herrlich P,

Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P et al. (1995) The nuclear receptor super- family: the second decade. Cell 83, 835–839. 6 Zhang XK, Hoffmann B, Tran PB, Graupner G &

Pfahl M (1992) Retinoid X receptor is an auxiliary pro- tein for thyroid hormone and retinoic acid receptors. Nature 355, 441–446. 7 Freebern WJ, Osman A, Niles EG, Christen L &

LoVerde PT (1999) Identification of a cDNA encoding a retinoid X receptor homologue from Schistosoma mansoni. Evidence for a role in female-specific gene expression. J Biol Chem 274, 4577–4585.

8 de Mendonca RL, Escriva H, Bouton D, Zelus D, Vanacker JM, Bonnelye E, Cornette J, Pierce RJ & Laudet V (2000) Structural and functional divergence of a nuclear receptor of the RXR family from the trema- tode parasite Schistosoma mansoni. Eur J Biochem 267, 3208–3219.

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

402

9 Freebern WJ, Niles EG & LoVerde PT (1999) RXR-2, a member of the retinoid x receptor family in Schisto- soma mansoni. Gene 233, 33–38. cDNAs coding SmNR1 and SmRXR1 were amplified by PCR, cloned into pENTR ⁄ SD ⁄ D-TOPO vector (Invitro- gen) and transferred into pcDNA-3.1 destination vectors using Gateway LR Clonase enzyme (Invitrogen). pUTK- 3xDR2 was constructed by inserting oligonucleotides con- taining three copies of DR2 (ACGCTCACTGGAACACT GGAATGCCCAGTTCTCGTCGCTCACTGGAACACTG GAATGCCCAGTTCTCGTTCGCTCACTGGAACACTG GAATGCCTCTAG) upstream of the thymidine-kinase promoter of reporter plasmid pUTK-Luc vector, which contains a firefly luciferase encoding sequence under the control of a Herpes simplex virus thymidine-kinase promo- ter [59]. pRL4.74 (Promega, containing a renilla luciferase reporter gene under the control of a cytomegalovirus pro- moter) was used as an internal control. Mammalian COS-7 cells were maintained in Dulbecco’s modified Eagle’s med- ium supplemented with 10% (V ⁄ V) fetal bovine serum. For transfection, cells were plated at a density of 1.5 · 105 cell- s ⁄ per well in 24 well culture plates with Dulbecco’s modified Eagle’s medium supplemented with 10% (V ⁄ V) fetal bovine serum. Transfection was done following the instruction of LipofectamineTM 2000 (Invitrogen), the mix containing 1 lL LipofectamineTM 2000 (Invitrogen), 0.4 lg expression plasmids, 0.375 lg reporter plasmids and 0.025 lg pRL4.74 (Promega). Forty-eight hours after transfection, COS-7 cells were lysed and the luciferase activity was measured by Dual Luciferase Reporter Assay system (Promega) and VeritasTM Microplate Luminometer (9100–001, Turner BioSystems, Sunnyvale, CA, USA). Expression of the firefly luciferase was normalized by expression of Renilla luciferase. Fold activation of the reporter gene was calculated by dividing the normalized firefly luciferase value of each expression plasmid by that of the control vector pcDNA-3.1. The sta- tistical significance of increase in luciferase activities of cells transfected with SmNR1, SmRXR1 and SmNR1 ⁄ SmRXR1

W. Wu et al.

S. mansoni NR1

10 Fantappie MR, Freebern WJ, Osman A, LaDuca J, Trematoda) nuclear receptors: sixteen new members and a novel subfamily. Gene 366, 303–315. 23 Livak K & Schmittgen T (2001) Analysis of relative

Niles EG & LoVerde PT (2001) Evaluation of Schisto- soma mansoni retinoid X receptor (SmRXR1 and SmRXR2) activity and tissue distribution. Mol Biochem Parasitol 115, 87–99. gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C(T)) Method. Methods 25, 402–408.

11 de Mendonca RL, Bouton D, Bertin B, Escriva H, Noel C, Vanacker JM, Cornette J, Laudet V & Pierce RJ (2002) A functionally conserved member of the FTZ-F1 nuclear receptor family from Schistosoma mansoni. Eur J Biochem 269, 5700–5711.

24 IJpenberg A, Jeannin E, Wahli W & Desvergne B (1997) Polarity and specific sequence requirements of peroxi- some proliferator-activated receptor (PPAR) ⁄ retinoid X receptor heterodimer binding to DNA. A functional analysis of the malic enzyme gene PPAR response element. J Biol Chem 272, 20108–20117. 25 Predki PF, Zamble D, Sarkar B & Giguere V (1994) 12 Hu R, Wu W, Niles EG & LoVerde PT (2006) SmTR2 ⁄ 4, a Schistosoma mansoni homologue of TR2 ⁄ TR4 orphan nuclear receptor. Int J Parasitol 36, 1113–1122.

13 Hu R, Wu W, Niles EG & LoVerde PT (2006) Isolation and characterization of Schistosoma mansoni constitu- tive androstane receptor. Mol Biochem Parasitol 148, 31–43. Ordered binding of retinoic acid and retinoid-X recep- tors to asymmetric response elements involves determi- nants adjacent to the DNA-binding domain. Mol Endocrinol 8, 31–39. 26 Wilson TE, Paulsen RE, Padgett KA & Milbrandt J

(1992) Participation of non-zinc finger residues in DNA binding by two nuclear orphan receptors. Science 256, 107–110. 14 Lu C, Wu W, Niles EG & LoVerde PT (2006) Identifi- cation and characterization of a novel fushi tarazu factor 1 (FTZ-F1) nuclear receptor in Schistosoma mansoni. Mol Biochem Parasitol 150, 25–36. 27 Andersson ML, Nordstrom K, Demczuk S, Harbers M

15 Wang LH, Tsai SY, Cook RG, Beattie WG, Tsai MJ & O’Malley BW (1989) COUP transcription factor is a member of the steroid receptor superfamily. Nature 340, 163–166. & Vennstrom B (1992) Thyroid hormone alters the DNA binding properties of chicken thyroid hormone receptors alpha and beta. Nucleic Acids Res 20, 4803–4810. 28 Antoniewski C, Mugat B, Delbac F & Lepesant JA

(1996) Direct repeats bind the EcR ⁄ USP receptor and mediate ecdysteroid responses in Drosophila melanogas- ter. Mol Cell Biol 16, 2977–2986. 16 Wurtz JM, Bourguet W, Renaud JP, Vivat V, Chambon P, Moras D & Gronemeyer H (1996) A canonical struc- ture for the ligand-binding domain of nuclear receptors. Nat Struct Biol 3, 206.

29 Desvergne B (1994) How do thyroid hormone receptors bind to structurally diverse response elements? Mol Cell Endocrinol 100, 125–131. 30 Schaefer F, Yoon SA, Nouri P, Tsao T, Tummala P, 17 Zhang Z, Burch PE, Cooney AJ, Lanz RB, Pereira FA, Wu J, Gibbs RA, Weinstock G & Wheeler DA (2004) Genomic analysis of the nuclear receptor family: new insights into structure, regulation, and evolution from the rat genome. Genome Res 14, 580–590.

Deng E & Rabkin R (2004) Growth hormone-mediated janus associated kinase-signal transducers and activators of transcription signaling in the growth hormone-resis- tant potassium-deficient rat. J Am Soc Nephrol 15, 2299–2306. 18 Vivat-Hannah V, Bourguet W, Gottardis M & Grone- meyer H (2003) Separation of retinoid X receptor homo- and heterodimerization functions. Mol Cell Biol 23, 7678–7688. 31 Schrader M & Carlberg C (1994) Thyroid hormone and

retinoic acid receptors form heterodimers with retinoid X receptors on direct repeats, palindromes, and inverted palindromes. DNA Cell Biol 13, 333–341. 32 Kostrouch Z, Kostrouchova M, Love W, Jannini E, 19 Perissi V, Staszewski LM, McInerney EM, Kurokawa R, Krones A, Rose DW, Lambert MH, Milburn MV, Glass CK & Rosenfeld MG (1999) Molecular determi- nants of nuclear receptor–corepressor interaction. Genes Dev 13, 3198–3208.

Piatigorsky J & Rall JE (1998) Retinoic acid X receptor in the diploblast, Tripedalia cystophora. Proc Natl Acad Sci USA 95, 13442–13447.

20 Nagy L, Kao HY, Love JD, Li C, Banayo E, Gooch JT, Krishna V, Chatterjee K, Evans RM & Schwabe JW (1999) Mechanism of corepressor binding and release from nuclear hormone receptors. Genes Dev 13, 3209–3216. 21 Le Paslier MC, Pierce RJ, Merlin F, Hirai H, Wu W,

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

403

33 Bouton D, Escriva H, de Mendonca RL, Glineur C, Bertin B, Noel C, Robinson-Rechavi M, de Groot A, Cornette J, Laudet V et al. (2005) A conserved retinoid X receptor (RXR) from the mollusk Biomphalaria glab- rata transactivates transcription in the presence of reti- noids. J Mol Endocrinol 34, 567–582. Williams DL, Johnston D, LoVerde PT & Le Paslier D (2000) Construction and characterization of a Schisto- soma mansoni bacterial artificial chromosome library. Genomics 65, 87–94. 22 Wu W, Niles EG, El-Sayed N, Berriman M & LoVerde PT (2006) Schistosoma mansoni (Platyhelminthes, 34 Shea C, Hough D, Xiao J, Tzertzinis G & Maina CV (2004) An rxr ⁄ usp homolog from the parasitic nema- tode, Dirofilaria immitis. Gene 324, 171–182.

W. Wu et al.

S. mansoni NR1

35 Oro AE, McKeown M & Evans RM (1990) Relation-

Schistosoma mansoni CBP ⁄ p300 has a conserved domain structure and interacts functionally with the nuclear receptor SmFtz-F1. Mol Biochem Parasitol 146, 180–191. 48 Jones DT, Taylor WR & Thornton JM (1992) The ship between the product of the Drosophila ultraspiracle locus and the vertebrate retinoid X receptor. Nature 347, 298–301.

rapid generation of mutation data matrices from protein sequences. Comput Appl Biosci 8, 275–282.

36 Guo X, Xu Q, Harmon MA, Jin X, Laudet V, Mangels- dorf DJ & Palmer MJ (1998) Isolation of two functional retinoid X receptor subtypes from the Ixodid tick, Amblyomma americanum (L.). Mol Cell Endocrinol 139, 45–60. 49 Guindon S & Gascuel O (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52, 696–704.

50 Huelsenbeck JP & Ronquist F (2001) mrbayes: Baye- sian inference of phylogenetic trees. Bioinformatics 17, 754–755.

51 Saitou N & Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4, 406–425. 37 Chambon P, Mader S, Garnier J-M, Staub A, Chen J-Y, Zacharewsi T, Saunders M, Nakshatri H, Lyons R, Kast- ner P et al. (1992) Purification, cloning, and RXR iden- tity of the HeLa cell factor with which RAR or TR heterodimerizes to bind target sequences efficiently. Cell 71, 887. 38 Mangelsdorf DJ, Ong ES, Dyck JA & Evans RM

52 Hirai H & LoVerde PT (1995) FISH techniques for con- structing physical maps on schistosome chromosomes. Parasitol Today 11, 310–314. (1990) Nuclear receptor that identifies a novel retinoic acid response pathway. Nature 345, 224–229. 53 Hirai H & Hirai Y (2004) FISH mapping for helminth 39 Shulemovich K, Dimaculangan DD, Katz D & Lazar genome. Methods Mol Biol 270, 379–394.

MA (1995) DNA bending by thyroid hormone receptor: influence of half-site spacing and RXR. Nucleic Acids Res 23, 811–818. 40 Umesono K, Murakami KK, Thompson CC & Evans

54 Oger F, Bertin B, Caby S, Dalia-Cornette J, Adams M, Vicogne J, Capron M & Pierce RJ (2006) Molecular cloning and characterization of Schistosoma mansoni Ftz-F1 interacting protein-1 (SmFIP-1), a novel core- pressor of the nuclear receptor SmFtz-F1. Mol Biochem Parasitol 148, 10–23. RM (1991) Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 65, 1255–1266. 41 Shaffer PL & Gewirth DT (2004) Vitamin D receptor– DNA interactions. Vitam Horm 68, 257–273.

55 Fantappie MR, Osman A, Ericsson C, Niles EG & LoVerde PT (2003) Cloning of Schistosoma mansoni Seven in Absentia (SmSINA) (+) homologue cDNA, a gene involved in ubiquitination of SmRXR1 and SmRXR2. Mol Biochem Parasitol 131, 45–54. 42 Cherbas L, Lee K & Cherbas P (1991) Identification of ecdysone response elements by analysis of the Droso- phila Eip28 ⁄ 29 gene. Genes Dev 5, 120–131. 43 Bertin B, Caby S, Oger F, Sasorith S, Wurtz JM &

56 Osman A, Niles EG & LoVerde PT (2001) Identifica- tion and characterization of a Smad2 homologue from Schistosoma mansoni, a transforming growth factor-beta signal transducer. J Biol Chem 276, 10072–10082. 57 Kliewer SA, Umesono K, Mangelsdorf DJ & Evans Pierce RJ (2005) The monomeric orphan nuclear recep- tor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1. Biochem Biophys Res Commun 327, 1072– 1082.

RM (1992) Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling. Nature 355, 446–449.

44 Hadzic E, Habeos I, Raaka BM & Samuels HH (1998) A novel multifunctional motif in the amino-terminal A ⁄ B domain of T3Ralpha modulates DNA binding and receptor dimerization. J Biol Chem 273, 10270– 10278. 58 Umesono K & Evans RM (1989) Determinants of target gene specificity for steroid ⁄ thyroid hormone receptors. Cell 57, 1139–1146.

45 de Moraes Maciel R, de Silva Dutra DL, Rumjanek FD, Juliano L, Juliano MA & Fantappie MR (2004) Schistosoma mansoni histone acetyltransferase GCN5: linking histone acetylation to gene activation. Mol Biochem Parasitol 133, 131–135.

59 Prost E & Moore DD (1986) CAT vectors for analysis of eukaryotic promoters and enhancers. Gene 45, 107–111. 60 Renaud JP, Rochel N, Ruff M, Vivat V, Chambon P, Gronemeyer H & Moras D (1995) Crystal structure of the RAR-gamma ligand-binding domain bound to all-trans retinoic acid. Nature 378, 681–689.

Supplementary material

is available

The following supplementary material online:

46 Mansure JJ, Furtado DR, de Oliveira FM, Rumjanek FD, Franco GR & Fantappie MR (2005) Cloning of a protein arginine methyltransferase PRMT1 homologue from Schistosoma mansoni: evidence for roles in nuclear receptor signaling and RNA metabolism. Biochem Biophys Res Commun 335, 1163–1172.

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

404

47 Bertin B, Oger F, Cornette J, Caby S, Noel C, Capron M, Fantappie MR, Rumjanek FD & Pierce RJ (2006)

W. Wu et al.

S. mansoni NR1

This material is available as part of the online article

from http://www.blackwell-synergy.com

Table S1. Exon ⁄ intron organization of SmNR1 gene. Table S2. GenBank accession numbers of the sequences used to construct phylogenetic trees. Fig. S1. Bayesian phylogenetic tree of SmNR1. Fig. S2. Neighbor Joining distance tree of SmNR1. Fig. S3. Alignment of peptide sequences of DBD and LBD (after helix 2).

Please note: Blackwell Publishing is not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the corres- ponding author for the article.

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS

405