Master's thesis of Design: Between studio and lab: explorations with bacterial cellulose

BETWEEN STUDIO AND LAB: EXPLORATIONS WITH BACTERIAL CELLULOSE

A project submitted in fulfilment of the requirements for the degree of Master of Design

ALEXANDER ‘ALEXI’ FREEMAN

Bachelor of Fine Art (University of Tasmania, 2004)

School of Design

College of Design and Social Context

RMIT University

September 2021

DECLARATION

I certify that except where due acknowledgement has been made, the work is that of the author alone; the work has not been submitted previously, in whole or part, to qualify for any other academic award; the content of the project is the result of work that has been carried out since the official commencement date of the approved research program; any editorial work, paid or unpaid, carried out by a third party is acknowledged; and, ethics procedures and guidelines have been followed.

I acknowledge the support I have received for my research through the provision of an RTP Stipend Scholarship (RSS) funded by the Australian Government.

Alexi Freeman, September 6, 2021

ACKNOWLEDGMENTS

I respectfully acknowledge the Wurundjeri people of the Kulin Nations as the traditional owners of the land on which this research was conducted. I acknowledge the sovereignty of the Aboriginal and Torres Strait Islander peoples and recognise their Elders, past, present and emerging.

Along this thesis journey, many people have offered indispensable support at crucial moments. I’m immensely grateful to my primary supervisor, Dr Judith Glover, for her unwavering support. Undoubtedly I would have been lost at Academic Sea on numerous occasions without Jude steering my research ship. I would also like to thank my secondary supervisor Dr Pia Interlandi for her pivotal role in providing an experienced lens to engage with Biodesign principles and for generously enabling a backyard full of my resource recovery experiments! My associate supervisor, Honorary Professor of Mycology Dr Ann Lawrie, also offered expertise, wisdom and an unparalleled enthusiasm for my research project. Without Ann’s incredible generosity in returning from retirement the laboratory-based experimentation would not have been possible. Enjoy your next chapter, Ann!

I acknowledge the valuable perspectives of milestone panellists including Dr Leah Heiss, Dr Simon Lockrey, Dr Karli Verghese, Dr Liam Fennessey, Dr Daphne Mohajer ve Pesaran and Dr Rebecca Van Amber. Also, friends to the research including Dr Shadi Houshyar, Dr Shelley Macrae, Dr Dylan Hegh, Dr Sarvesh Soni, Dr Muthu Pannirselvam, Dr Anita Quigley, Lashna Tuschewski, and the friendly allies at Goodbrew Kombucha, Noisy Ritual and Alchemy Brewing.

There are also myriad allies who played pivotal motivating roles, including; Thorsten, who held me to a promise; my majestic Swans; Soda Jerk, for reminding me how inspiring creative rigour can be; Sruli, for illuminating that we are all naked apes; Sarah, for co-lecturing regenerative design; Azzy, for keeping the faith; Emma, for the mad chats; Cal, for the hot-desk; Pauline, for The Patch thesis writing residencies; and, last but not least, the magical Sally, for all the unforgettable swaffiness.

I would also like to thank those that generously invited me to share my research in progress including Claire Beale, Design Tasmania & Mona Foma Festival; Dale Hardiman & NGV Melbourne Design Week; Lisa Cahill and the Australian Design Centre; Process; Raw Assembly; RMIT Gallery staff and curators including Andrew Tetzlaff, Helen Rayment, Dr Jonathan Duckworth, Dr Evelyn Tsitas; Dr Fiona Hillary and MPavilion.

Thanks also go to the myriad researchers, curators, authors and practitioners contributing groundbreaking research to biodesign that have come before me and have created space for this type of practice-led research to occur. Finally, I would like to formally acknowledge the support of RMIT University and all the administrative staff for providing me with the life-changing opportunity to undertake this research degree.

Document design and layout for publication by Georgina O'Connor.

List Of Diagrams, Tables And Figures ...................................................................................................vii Abbreviations ..................................................................................................................................................... xi Abstract ............................................................................................................................................................... 01

INTRODUCTION

Thesis Structure ........................................................................................................................................02

SECTION 1: Frameworks

Background And Motivations .............................................................................................................05 Environmental Impacts Of Fibre, Fashion And Textiles ........................................................ 10 Fibre Types ...................................................................................................................................................11 Textile Waste And Emissions Management ................................................................................ 12 Overview Of Design And Science Methodologies ..................................................................... 13

CHAPTER 1 Bacterial Cellulose: Fibres Secreted By Microorganisms

Introduction ................................................................................................................................................ 15 Cellulose .................................................................................................................................................. 16 Etymology ................................................................................................................................................ 17 Culture And Physiology .................................................................................................................... 17 Applications ........................................................................................................................................... 19 Kombucha .............................................................................................................................................. 20 Reproduction ......................................................................................................................................... 21 Metabolism ............................................................................................................................................ 21 Temperature .......................................................................................................................................... 22 Acidity/Alkalinity .................................................................................................................................23 Static Versus Agitation Cultivation Method ..........................................................................24 Water Quality ........................................................................................................................................24 Cultivation Environment ..................................................................................................................23 Oxygenation ...........................................................................................................................................25 Cultivation Catalysts .........................................................................................................................25 Cultivation Period ...............................................................................................................................25 Harvesting And Dehydration .........................................................................................................26 Biosafety: Mitigating Exposure To Airborne Contaminants ...........................................26 Appearance Of Dried Pellicle ......................................................................................................... 27 Biodegradation With Fungi ............................................................................................................ 27 Conclusion ...................................................................................................................................................28

iii

CHAPTER 2 Community Of Practice: Situating Within Biodesign

Introduction .................................................................................................................................................29 Biodesign: Definitions And Practices In An Emerging Field ........................................... 30 Biodesign Versus Bioart: Designers And Artists Who Use Biology ............................32 Biodesign: A Field Rejecting The Pitfalls Of Designed Obsolescence .......................35 Biodesign: A Brief History Of Practitioners And Projects .................................................36 A Brief History Of Alternative Textile Researchers Companies ....................................39 A Brief History Of Bacterial Cellulose In Biodesign ............................................................44 Key Themes And Methods Of Biodesign ..................................................................................44 Engagement ...........................................................................................................................................44 Fermentation ..........................................................................................................................................46 Interdisciplinary Collaboration .....................................................................................................46 Interspecies Collaboration .............................................................................................................46 Mitigating Environmental Impacts ............................................................................................. 47 Resource Recovery ............................................................................................................................. 48 Rejection Of Fast Fashion ............................................................................................................... 48 Bioregionalism .....................................................................................................................................49 Conclusion .................................................................................................................................................. 50

SECTION 2: Practice-Based Experimentation And Reflections

............................................................................................................................................................................ 51

CHAPTER 3 Studio-Based Experimentation

Introduction ................................................................................................................................................ 52 Bacterial Cellulose Cultivation, Dehydration And Observations .................................. 52 Bacterial Cellulose With Resource Recovered Feedstock ............................................... 57 Bacterial Cellulose Cultivation At Scale ..................................................................................60 Bacterial Cellulose Resource Recovery As Raw Material ................................................ 62 Textile Surface Modification ..........................................................................................................65 Applications: Observations Of Studio-Experiments ...........................................................66 Wax Finishing ........................................................................................................................................ 67 Moulding .................................................................................................................................................68 Crocheting And Knitting ..................................................................................................................70 Tensile Strength .................................................................................................................................. 72 Weaving ................................................................................................................................................... 73 Perforations ........................................................................................................................................... 74 Packaging ................................................................................................................................................. 76 Bleaching ................................................................................................................................................ 77

Transparency And light .................................................................................................................... 78 Colouration ............................................................................................................................................. 79 Metal oxidation .................................................................................................................................... 79 Flammability ......................................................................................................................................... 80 Engagement ........................................................................................................................................... 81 Conclusion ...................................................................................................................................................89

CHAPTER 4 Laboratory-Based Experimentation

Introduction ............................................................................................................................................... 90 PART 1

Isolation And Identification Of The Bacterial Cellulose Producing Microorganisms In Kombucha

....................................................................................................90

Methods And Results ........................................................................................................................ 91 Maldi-Tof Identification Of Bacterial Cellulose Microorganisms .................................93 Dna Sequencing ...................................................................................................................................94 Morphology Of Bacterial Cellulose By Komagataeibacter Xylinus .............................96 Chemical Analysis Of Komagataeibacter Xylinus ............................................................... 98 Discussion And Analysis ..................................................................................................................99

PART 2

Biodegradation Of Bacterial Cellulose By Fungi

............................................................100

Materials And Methods ..................................................................................................................101 Sterilisation Of Textiles .................................................................................................................101 Test Fungi ............................................................................................................................................ 104 Preparation Of Solid Test Medium And Control Test Medium ................................... 106 Inoculation Of Test Specimens ................................................................................................... 107 Assessment Of Biodegradation ................................................................................................. 108 Growth ................................................................................................................................................... 108 Loss Of Mass (Weight) ................................................................................................................... 108 Loss Of Tensile Strength ............................................................................................................... 108 Results And Discussion ................................................................................................................. 109

PART 3

Hydrophobic Fungus On Bacterial Cellulose

..................................................................113

Methods ................................................................................................................................................. 113 Results .................................................................................................................................................... 115 Discussion ............................................................................................................................................. 115 Conclusion ................................................................................................................................................. 115

CHAPTER 5 Reflections

CONCLUSION

.................................................................................................................................... 126

References ........................................................................................................................................................ 129

APPENDICES .............................................................................................................................................148 Glossary .............................................................................................................................................................149 Table 5.1: Food Waste Experiment Recipes ....................................................................................... 158

LIST OF DIAGRAMS, TABLES AND FIGURES

Figure 0.1 Wet-spinning apparatus at

Figure 3.4

Deakin University.

Large BC pellicle air-drying. Diameter 80 cm.

Figure 0.2 Dissolution of a BC pellicle into

Figure 3.5

a viscous substance ready to wet spin.

Assortment of dehydrated BC pellicles. Petri dishes on top row 8 cm diametre. Larger rectangular pellicles ≈ 40 cm x 30 cm each.

Figure 3.6

7 day cultivation; pale, paper- thin and soft. 8 cm in diameter.

Figure 3.7

Figure 0.3 Behind the scenes image of my industry practice. I am dressing artist Kirsha Kaechele for her wedding in my Interstellar Gown (interdisciplinary collaboration with jeweller Tessa Blazey). Photography: Lisa Lozano (2014).

14 day cultivation, slightly thicker and becoming more opaque. Detail of 8 cm in diameter pellicle.

Figure 0.4

Figure 3.8

42 day cultivation. Detail of pellicle that is 8 cm in diameter.

Industry practice. Gown of Shadows (interdisciplinary collaboration with jeweller Tessa Blazey). Photography: Jane Burton (2018).

Figure 3.9

Figure 0.5

56 day cultivation. Detail of pellicle that is 8 cm in diameter.

Figure 3.10 70 day cultivation.

8 cm in diameter.

Industry practice depicting my WHITE NOISE trans-seasonal fashion collection launch at the Museum of Old and New Art (MONA) under James Turrell’s Amarna. Photography: Nina Hamilton (2016).

Figure 3.11 BC utilising Allium sativum (garlic) peels as feedstock. 8 cm in diameter.

Figure 0.6

Sun bleaching textile experiment.

Figure 3.12 BC pellicle utilising Musa

Figure 0.7

Sun bleaching textile experiment (detail).

acuminata (banana) skin as feedstock. Detail of 8 cm in diameter pellicle.

Figure 0.8

Figure 3.13 BC pellicle utilising Vaccinium

Jumper perforated by wool metabolising moth larvae.

species (blueberries) as feedstock. 8 cm in diameter.

Figure 2.0

Diagram of a chain of glucose monomers aggregating to form strands of cellulose.

Table 2.1

Figure 3.14 Contaminated BC utilising Citrus .paradisi (grapefruit) waste as feedstock. 8 cm in diameter.

Alternative Textile Researchers And Companies.

Figure 3.15 BC cultivated with grapefruit

Figure 3.0

peel as feedstock (after dehydration). 8 cm in diameter.

Profile view of pure K. xylinus forming a pellicle at the air-liquid interface.

Figure 3.16 BC pellicle utilising urine as

Figure 3.1

feedstock. 40 cm x 30 cm.

Aerial view of BC forming a thick layer of BC at the air-liquid interface. 40cm x 30cm

Figure 3.2

Figure 3.17 BC pellicle utilising waste wine lees as feedstock. Detail of 8 cm in diameter pellicle.

Figure 3.18 Successfully cultivated large BC

First successfully dehydrated bacterial cellulose pellicle. Diameter 20 cm. March 15, 2019.

pellicle 40 cm x 30 cm.

Figure 3.3

Assorted BC pellicles air-drying. 40 cm x 30 cm each.

vii

Figure 3.19 BC experiment at scale

Figure 3.33 Various BC pellicles drying over

a mannequin. 60 cm x 30 cm.

contaminated by airborne contaminants. Detail of pellicle 220 cm x 100 cm.

Figure 3.34 Hand-cut and hand-twisted

Figure 3.20 Detail of a large scale BC

strands of dehydrated BC pellicle.Each strand is ≈ 4 mm in thickness.

experiment contaminated by airborne contaminants. 220 cm x 100 cm.

Figure 3.21

Figure 3.35 BC pellicle dehydrated and cut into ≈ 4 mm yarn, twisted and crocheted into a 7 cm diameter biomaterial.

Industrial BC pellicle cultivation in kombucha brewery. Detail of wet pellicle 2 cm thick x 80 cm in diameter.

Figure 3.36 BC pellicle dehydrated and cut

Figure 3.22 Numerous 500 L tanks of

into 4 mm wide yarn, twisted and knitted into a 8 cm x 3cm biomaterial.

industrial kombucha growing in industry. These tanks are stacked 6 m high shelves.

Figure 3.37 BC pellicle reinforced with

Figure 3.23 BC pellicle partially

plastic orange bag mesh textile waste. Detail of 8 cm in diameter pellicle.

metabolised by unidentified larvae. Detail of pellicle 40 cm x 30 cm.

Figure 3.24 BC waste recovered from

Figure 3.38 Strips of BC pellicle hand-woven into a biomaterial 8 cm in diameter.

kombucha brewery dehydrating on Hills hoist.

Figure 3.39 Detail of ≈ 15 mm strips of BC

Figure 3.25 Detail of BC resource recovered

BC dehydrating on Hills hoist.

pellicle hand-woven into a biomaterial.

Figure 3.26 BC pellicle partially

Figure 3.40 Pin perforation of dehydrated

BC pellicle. 8 cm in diameter.

metabolised by unidentified larvae.

Figure 3.41 Pin perforation of BC pellicle.

Figure 3.27 Penicillium glabrum forming a

Detail of 8 cm in diameter pellicle.

hydrophobic coating on a BC pellicle.

Figure 3.42 Hole punch perforation in

Figure 3.28 Recovered soy candle wax heat

dehydrated BC pellicle. Detail of 8 cm in diameter pellicle.

set onto BC. Detail of 8 cm in diameter pellicle.

Figure 3.43 BC crinkled up into an

amorphous shape 30 cm x 20 cm.

Figure 3.29 Red paraffin wax waste (recovered from banana peel wax tip) heat set onto BC pellicle. Detail of 8 cm in diameter pellicle.

Figure 3.44 BC bleached for 24 hours, washed, air-dried, highly transparent. 8 cm in diameter.

Figure 3.30 BC pellicle moulding to the

surface morphology of asphalt. 40 cm x 30 cm.

Figure 3.45 Hand-woven and bleached dehydrated BC biomaterial ≈ 30 cm x 30 cm, consisting of ≈ 15 mm hand-cut strips of BC.

Figure 3.46 Dehydrated BC pellicle

Figure 3.31 BC pellicle was moulded over a foam head during air-drying resulting in a permanently curved shape. 20 cm in diameter.

demonstrating transparency. Detail of amorphous 30 cm x 30 cm pellicle.

Figure 3.32 BC moulding over a mannequin.

40 cm x 30 cm.

* Published Creative Works

viii

Figure 3.47 Dehydrated BC pellicle

demonstrating a high level of transparency. Detail of 8 cm diameter pellicle.

Figure 3.48 Wet BC pellicle placed

over a colourful painting to demonstrate its high transparency. 40 cm x 30 cm.

Figure 3.58 * Amorphous assortement of various sized BC pellicles on plinths. BC pellicle (bottom right) utilising waste Hordeum vulgare (barley grain) as feedstock recovered from a local beer brewery compared with BC pellicle from tea + sucrose (top right).

Figure 3.49 BC dry brushed with ink. Detail

of 8 cm diameter pellicle.

Figure 3.59 * PLAY, Designer floor talk, Design Tasmania, Mona Foma Festival, January 2021.

Figure 3.50 A wet pellicle oxidised as

it dehydrated on raw steel resulting in a black and rigid pellicle. 8 cm diameter pellicle.

Figure 3.60* PLAY, Designer floor talk, Design Tasmania, Mona Foma Festival, January 2021.

Figure 3.51 BC fed to cellulose-

Figure 3.61 * PLAY, Designer floor talk, Design Tasmania, Mona Foma Festival, January 2021.

metabolising white oyster mushroom mycelium (Pleurotus ostreatus). 8 cm diameter pellicle.

Figure 3.62 * Regenerative Biodesign:

Figure 3.52 * Vertically placed pellicles are

Co-evolving Sustainability, Presented By MPavilion, MARCH 14, 2020, NGV Melbourne Design Week, Victoria.

Figure 3.63 * Biodesign; Reconciling,

40 cm x 30 cm. Horizontally placed pellicles are 8cm in diameter. LIFE & DEATH, (group exhibition), NGV Melbourne Design Week, March 13 - March 27, 2020, Meat Market Stables, Victoria.

decolonising and indigenising our urban environments. MPavilion, Melbourne, 28th February 2021.

Figure 3.53 * Ray Edgar, IS IT TIME FOR

Figure 3.64 * Assorted BC practice

PLANET B? THE AGE, March 14, 2020.

experimentation exhibited at FUTURE U (group exhibition), RMIT Gallery, Victoria, July 29 - March 2022.

Figure 3.65 * Assorted BC practice

Figure 3.54 * Stephen Todd, Sea Urchin Delights and Future-Proof Cabinets, Life & Leisure, THE FINANCIAL REVIEW, March 6-8, 2020 (1/2).

experimentation ranging from 5 cm – 8 cm in diameter. Exhibited at FUTURE U (group exhibition), RMIT Gallery, Victoria, July 29 – March 2022.

Figure 3.55 * Stephen Todd, Sea Urchin Delights and Future-Proof Cabinets, Life & Leisure, THE FINANCIAL REVIEW, March 6-8, 2020 (2/2).

Figure 4.0

Figure 3.56 * BC pellicle 8cm in diameter. Excerpt from ISOLATE DIARY, (group exhibition) Australian Design Centre, Sydney, 2020.

Kombucha isolates and subcultures growing on agar plates. Order of plates (left to right in each group): LGI, HS, PDA, NA. The top row shows isolates from the brown part of the pellicle, the second-row isolates from the white part of the pellicle, the third and fourth row are subcultures obtained from the liquid culture.

Figure 3.57 * Amorphous assortement of various sized BC pellicles on plinths. PLAY, (group exhibition), Design Tasmania, Mona Foma Festival, January - February 2021.

* Published Creative Works

Figure 4.1

Figure 4.15 All materials tested by spraying

Gram-stained rod-shaped microorganisms observed via light microscopy.

Figure 4.2 MALDI-TOF plate with templates

for 3 mm microbial smears.

Table 4.3

Summary of MALDI-TOF identification results.

Table 4.4

with spores of five ascomycete fungi causing decay of textiles 4 days after spraying with a mixture of spores: Penicillium chrysogenum, Paecilomyces variotii, Chaetomium globosum, Aspergillus flavus, Aspergillus niger. Textiles are labelled below left to right. AF = from Alexi Freeman.

Summary of 16S DNA sequencing results.

Figure 4.16 All textiles on STM at 4

Figure 4.5

BC nanofibrils at 25 times magnification self-organising into a non-woven biomaterial.

Figure 4.6

days, showing differences in appearance between test plates sprayed with ascomycete fungal spores (left) and those left unsprayed (control) (right).

Figure 4.17

The three-dimensional matrix of bacterial cellulose observed at 6000 times magnification revealing rigid and nanofibrillar biopolymers.

Figure 4.7

Textiles after inoculation with basidiomycete fungi as blocks of agar growth cut from Petri dishes. Reflections are from the back of the laminar flow cabinet providing sterile air.

BC at 10,000 times magnification rod-shaped organisms, splitting by fission and forming into chains were observed.

Figure 4.18 Growth of basidiomycete

Figure 4.8

Fourier-transform infrared (FTIR) spectroscopy was used to assay the chemical purity of the BC cultivated during this research.

fungi on textiles and BC after 10 days. Reflections are from the back of the laminar flow cabinet providing sterile air to avoid contamination during the experiment.

Table 4.9

Diagram 4.19 Percentage weight loss over

Textile samples for biodegradation with fungi experimentation.

control for BC biodegradation with fungi tests.

Figure 4.10 Apparatus used to sterilise

Figure 4.20 Macroscopic appearance of

materials in methanol vapour for 18 h minimum.

fungus grown on fresh potato dextrose agar.

Table 4.11

Figure 4.21 Microscopic appearance of

Known cellulose-digesting ascomycete fungi used to test biodegradability.

Table 4.12

Fungi used to inoculate specimens of textiles.

fungus grown on fresh potato dextrose agar, showing the diagnostic ‘penicillus’ (broom- like) structure of Penicillium species.

Table 4.13

Composition of solid test medium (STM).

Figure 4.22

ITS sequence of hydrophobic fungus growing on BC.

Figure 4.23 Relationships between ITS

Diagram 4.14 The pattern of inocula used for basidiomycete fungi. Key: top left to right, Ga, Gl, Plc, RHS top to bottom: Ple, Plo, bottom right to left: Plp, Pb; LHS bottom to top Sc, Tv. (Total of 9 fungi).

sequences from a fungal isolate from BC (top sequence) and Penicillium species. Those labelled TYPE at the end are from the original (Type) cultures.

ABBREVIATIONS

Bacterial Cellulose

Chemical symbol for sodium

BC

Na

Nutrient agar medium

Chief Creative Officer

NA

CCO

Chief Executive Officer

CEO

NCBI

National Centre for Biotechnology Information

CRISPR Clustered Regularly Interspaced

Short Palindromic Repeats

Nitrogen-fixing bacteria medium

NFb

CH3OH Methanol or methyl alcohol

NMMO

(or NMO) N-Methylmorpholine N-oxide

Chief Scientific Officer

CSO

Polybrominated biphenyls

PBB

Chief Technical Officer

CTO

Polyporus brumalis

Pb

Control Test Medium

CTM

Acidity/alkalinity

pH

Dichloro-diphenyl-trichloroethane

DDT

Parts Per Million

PPM

Deoxyribonucleic acid

DNA

Parts Per Billion

PPB

Degree of polymerisation

DP

Parts Per Trillion

PPT

Design for disassembly

DFD

Quantitative & qualitative

Q&Q

End of life

EOL

Scanning electron microscopy

SEM

Fit For Purpose

FFP

Schizophyllum commune

Sc

FTIR

SCOBY

Fourier-transform infrared spectrometry

Symbiotic Culture of Bacteria and Yeast

Ganoderma australe

Ga

Solid Test Medium

STM

G. lucidum

Gl

H2SO4 Sulphuric acid

Hestrin Schramm medium

HS

Trifluoroacetic acid

TFA

Intellectual Property

IP

Trametes versicolor

Tv

Potato dextrose agar medium

JPDA

Vice President of Operations

VPO

Life Cycle Analysis

LCA

LGI

Large Glucagon Immunoreactivity medium

MALDI-TOF MS Matrix-Assisted Laser Desorption Infrared-Time of Flight Mass Spectrometry

ABSTRACT

I began this research motivated to comprehend and address the environmental impacts of the fibre, fashion and textile industries. Consequently, the potential to optimise methods for biofabricating bacterial cellulose (BC) is researched through my primary research question: ‘To what extent does my practice change when design meets science?’

This question is prefaced by Section 1 which discusses my background and motivations, reviews the environmental impacts of fibre, fashion and textiles, outlines the cultivation parameters of BC and contextualises the research through a review of key practitioners and projects in the field of biodesign.

These discussions, outlines and reviews identify themes, methods and methodologies that frame Section 2, underpinning my studio and laboratory-based practice research including interdisciplinary collaboration, resource recovery, the application of microbiology protocols to design problems and the importance of public engagement.

This research journey explores BC’s potential for textile design applications and interrogates how BC’s optimisation elicits the potential to play an important role in mitigating the environmental impacts of textile industries. This research has increased my knowledge of scientific processes, developed my interdisciplinary skills and transformed my practice from a fashion designer to a biodesigner and biodesign translator between design and science.

I’ve concluded this research with a hybridised knowledge of the nexus between design and science, aggregating in a dissertation that discusses the environmental impacts of textiles and the community of practitioners addressing these impacts. This thesis also documents the suite of practice artefacts that experimentally demonstrate the potential of BC and reflects on how this research has irreversibly changed my design practice.

INTRODUCTION Thesis Structure

As this thesis journey evolved and I moved between design and science, the writing, literature reviews, reviewing methods and various types of practical work situated themselves into studio or laboratory chapters. These chapters are discussed through reflective practice writing, exploring how the studio and laboratory practice intersected and irreversibly changed my design practice. Whilst reflecting on what I had become, I realised I was not a scientist, nor was I purely a designer either.

Section 1 of the thesis begins with a review of BC literature, thus reading as per a scientific literature review, followed by pivotal projects that illuminate the field of biodesign in the Community of Practice chapter, written in a manner more indicative of a design journal. These reviews were crucial to underpin the studio and laboratory- based experimentation undertaken during the practice component of this research. In Section 2, the Studio chapter documents practical work in a style characteristic of design, whereas the Laboratory chapter was documented in a style characteristic of science. The conclusion of these two sections makes sense of these distinct fields and their commonalities.

The BC literature review elicited potential to reduce the impacts of fibre cultivation, textile production and disposal through studio and laboratory-based practice. This review identified BC is cultivated for commercial applications in non-fashion industry settings such as high-fibre food (Jayabalan et al., 2014), paper, materials, biomedical, pharmaceutical, and cosmeceutical industries (Gallegos et al., 2016; Vielreicher et al., 2018), establishing these as precedents for a shift to fashion industry applications. For instance, textile company Nanollose devised a technique for wet-spinning BC into a regenerated lyocell yarn applicable to the textile industry (Nanollose, 2021), further discussed in Community of Practice.

BC interrogation was motivated by sustainability, but the analysis of BC’s environmental performance versus incumbent forms of cellulose regarding environmental advantages required a different set of experiments involving the use of LCA. Although LCA remains a crucial tool in biodesign, it was outside of my scope as the inadvertent ‘mastery’ became my ability to adapt the nomenclature and methodologies of science and scientific procedures and apply these to design problems combined with design methods.

Through supervisory discussions, it was agreed I would not follow a strict environmental design methodology to enable a more hybridised mode of interdisciplinary practice. Consequently, my dissertation should be considered with that limitation in mind. There are a number of enablers for environmental design methodology decision making, defined by Sun et al (2003) as end of life (EOL) and life cycle assessment (LCA), also referred to as life cycle analysis. Life cycle assessment (LCA) is a term that Rebitzer

et al (2004) discuss as a method for calculating the opportunities for reductions in resource consumption and end of life (EOL) strategies are defined by Rose and Stevels (2002) as ways to reuse, service, remanufacture and recycle products at the end of their use phase.

I was not able to follow a strict environmental design methodology because I used a creative practice methodology that hybridised a mixture of design and science based methods. If I had followed a strict environmental design methodology it would have limited my capacity to explore this hybridised mode of practice, therefore I was not able to undertake environmental design methodologies.

Nevertheless, my research process was exploratory, investigating the commonalities of design and scientific processes, interrogating the parameters of BC utilising my knowledge of design in combination with a new set of scientific skills deployed to explore BC through a design/science lens. Notwithstanding the limitations noted above, the laboratory-based experimentation utilised scientific methods through an interrogation of BC, having become stifled by BC cultivation during studio-based experimentation.

The Community of Practice chapter reviewed biodesign practitioners, commentators and companies of relevance such as Suzanne Lee, Neri Oxman and Nanollose. Undertaking a thorough review of interrelated fields including biomimicry and bioart was beyond the scope, although they are discussed as relevant adjuncts to the biodesign field. Other key themes discussed are interdisciplinarity, biofabricating, resource recovery, mitigation of environmental impacts and engagement. These themes underpinned the practice research discussed in Studio and Laboratory-based Experimentation and the corresponding Reflections discussion. In this thesis, reference to the term Biodesign draws on the definition that “Biodesign integrates living organisms into designed solutions, often with the aim of improving sustainability and ecological performance in novel ways” (Gough et al., 2021, p.1), as further discussed in the Community of Practice chapter.

Figure 0.1 Wet-spinning apparatus at Deakin University.

Figure 0.2 Dissolution of a BC pellicle into a viscous substance ready to wet spin.

The Studio-based Experimentation chapter documents practice exploring the potential of cultivating BC in a studio, while the Laboratory-based Experimentation chapter documents practice undertaken in a laboratory. Wet-spinning bacterial nanofibrils into yarns suitable for scalable textile production was explored before the review of Nanollose. In dialogue with Dr Dylan Hegh (Material science at Deakin University), I negotiated the undertaking of a residency at the Institute of Frontier Materials (IFM) to utilise Deakin’s wet-spinning apparatus (Figure 0.1) leading to the dissolution of a BC pellicle into a viscous substance ready to wet spin (Figure 0.2). When Covid-19 hit in March 2020, the residency was postponed indefinitely, preventing the completion of this experiment. Nevertheless, wet-spinning BC exhibits significant potential and textile company Nanollose claims to have achieved this feat, yet the environmental implications need to be evaluated utilising LCA. My biodegradation of BC with cellulose- metabolising fungi experiment elicited the potential for cellulose-based textile waste to be biodegraded on an industrial scale, although a definitive determination of scalability was deemed beyond the scope.

The unanticipated value of the laboratory-based practice was the way it transformed my practice as a designer, opening up new hybridised methods and fruitful relationships. Interdisciplinary collaboration is a theme of the biodesign field further discussed in the Reflections chapter, comparing the studio and laboratory-based experimentation, reflecting on what these experiments meant to this research and how these projects irreversibly evolved my practice from a fashion designer to a biodesigner and biodesign-translator. Reflections also discussed how this research was translated into public engagement, documented in Studio-based Experimentation (Figures 3.52 - 3.65). Engagement was also a crucial part of my pre-research industry practice as an artisanal designer and active contributor to the Australian fashion landscape.

SECTION 1: Frameworks

This thesis interrogates the potential to optimise methods for biofabricating bacterial cellulose (BC) and is broken into 3 explorations. Prefaced by my background

and motivations, I then discuss the environmental impacts of incumbent textiles,

and provide an overview of my design and science methodologies.

BACKGROUND AND MOTIVATIONS

I designed editioned and bespoke wearables throughout two decades of practice, innately embodying sustainability through artisanal fashion, textile and jewellery methodologies intended to be future heirlooms (figures 0.3 - 0.5). These artefacts contributed to fashion’s vernacular, situating my oeuvre in a community celebrating newness, luxury, and interdisciplinarity, developing a tacit knowledge of textiles encompassing design, manufacture, performance, care, and disposal.

Figure 0.4 Industry practice. Gown of Shadows (interdisciplinary collaboration with jeweller Tessa Blazey). Photography: Jane Burton (2018).

Figure 0.5 Industry practice depicting my WHITE NOISE trans-seasonal fashion collection launch at the Museum of Old and New Art (MONA) under James Turrell’s Amarna. Photography: Nina Hamilton (2016).

I progressively became aware of the environmental impacts of textiles, compounding an ethical conundrum concerning my ongoing love of designing and the conviction to embed my practice within a sustainable ethos.

Thus my candidature reviewed, practiced and reflected upon the potential of design as a critical vehicle of environmental reform as I became interested in biomaterials and the nascent field of biodesign. While not strictly a thesis framed by sustainable design methods, investigating the uses of bacterial cellulose (BC) were motivated by a desire for less polluting textiles applicable to my industry practice.

During my initial studio-based practice experiments, I was confounded by unsuccessful experiments that looked appalling and exhibited a pungent stench. These tests culminated in unpleasant gloops of biohazardous microorganisms requiring bioremediation. At such times I questioned if I should remain within the familiarity of luxury fashion rather than pursuing the challenge of mitigating environmental impacts through the interrogation of biomaterials.

This research is also motivated by observations of natural systems as interdisciplinary collaborators. For example, intrigued by sunlight catalysing the deterioration of my design archive, I devised an experiment whereby I masked textile sections in a geometric pattern, facilitating fading of the unmasked areas, enlisting the sun as a non-human collaborator (figures 0.6 - 0.7).

Figure 0.6 Sun bleaching textile experiment.

Figure 0.7 Sun bleaching textile experiment (Detail).

By way of a second example, I recovered a woollen jumper in a state of decay. Washing revealed a wearable artefact with myriad perforations formed by protein-metabolising moth larvae (figure 0.8). These observations of natural phenomena on textiles inspired my initial thoughts on how collaboration with biological systems may reduce textile impacts.

Figure 0.8

Jumper perforated by wool metabolising moth larvae.

After initially looking at alternative biomaterials such as algae, chitin, lichen and mycelium, I settled on BC. Other designers, notably Suzanne Lee (Lee, 2007), had previously explored BC as an alternative textile that can be located easily on craft-based websites (Grey, 2020). So why did designers such as Lee move on to other projects? What were BC’s potential advantages and disadvantages? My initial research investigated the potential of using BC cultivation as alternative cellulose and its scalability. As my research progressed, I shifted away from traditional design practice and into the field of science and scientific collaboration, leading to my primary research question: ‘To what extent does my practice change when design meets science?’ leading to reflections on how this journey evolved my practice. These reflections are further discussed in this chapter while moving between design and science becomes the overarching narrative content for Section 2.

ENVIRONMENTAL IMPACTS OF FIBRE, FASHION AND TEXTILES

Environmental impacts of fibre, fashion and textiles arise from water, land and chemical use, bioengineering, distribution, microfibres, waste and carbon emissions (Hines, 2007; Anguelov, 2016; Roos, 2016; Schuch, 2016; Giacomin et al., 2017; Bick et al., 2018; Sandin and Peters, 2018; Iqbal et al., 2019). These impacts are compounded by planned and trend obsolescence (Givhan, 2019) and myopic reinvestments in stranded assets. Nevertheless, undertaking this research has led to my view that textile impacts can potentially be mitigated with biodesign methods. This stance underpins my research interrogating BC as an environmentally friendly alternative to incumbent fibres, the potential for more sustainable uses of natural resources and improved management of waste streams (GFA, 2017; McFall-Johnsen, 2018; Tan, 2016) .

Technical advances have optimised textile fibre cultivation including the generation of synthetic chemicals which revolutionised the speed of cultivating, processing, and manufacturing fibres (Rauturier, 2018); the spinning jenny that mechanised the transformation of fibre into yarn (Mohajan, 2019); and the computerisation of knitting, weaving and sewing machines (Forsdyke, 2020).

These advances, along with communication technologies and global proliferation strategies, facilitated the proliferation of fast fashion (Anguelov, 2015), characterised by strategic lowering in quality of both manufacturing and materials, and high-volume turnover of low- cost products to a mass market, exploiting both human and natural resources (Bick et al., 2018). Ubiquitous shifts such as the industrial and green revolutions, globalisation and overconsumption have also enabled fast fashion (Hines, 2007; Morgan et al., 2009).

Cellulose markets are worth USD 219 billion annually (Fortune, 2021), contributing to 100 million tonnes (mt) of textile products (Fibre Year, 2014), whilst 80 billion garments (Drennan, 2015) contribute to a USD 3 trillion industry employing 60 million people. Cotton employs 250 million cultivators in 80 countries (Bomgardner, 2018), producing 113 million bales (Kadolph et al., 2013).

Fibre is defined as the “thread or filament from which a vegetable tissue, mineral substance, or textile is formed” (OED, 2021). Bismark et al. (2005) define bast fibres as elementary cells isolated from plants. Rayon, or ‘artificial silk’ (Keist, 2009), is defined as “filaments made from various solutions of modified cellulose by pressing or drawing the cellulose through an orifice and solidifying it in the form of a filament” (Scroggie, 1950, p.194), defined as “fabric made from regenerated cellulose” (OED, 2021).

Chan (2019) states cotton requires 20,000 litres for 1 kg (one t-shirt requires 2,700 litres of water), the thirstiest of all agricultural commodities (Roth et al., 2013), requiring 10,000 sqm of land for 2270 kg of fibre (Liu et al., 2013) utilising 2.5% of Earth’s arable land (Schuch, 2016; Iqbal et al., 2019; Roos, 2016). Infamously, the Aral Sea was desiccated by cotton cultivation (Micklin, 2007; Hoskins, 2014) culminating in the desertification of 1.47 million hectares surrounding cotton fields in Uzbekistan (Edelstein, 2012; Saiko et al., 2000). Water consumption by Australian cotton growers improved 40% from 2003-2013 (Roth et al., 2013) and organic cotton requires 91% less water (World Wildlife, 2020), replenishing soil fertility

without synthetic chemicals or genetically modified (GM) seeds (Riello, 2013) but constitutes less than 1% of cotton globally (OTA, 2012).

Cotton cultivation utilises bioengineered seeds and fertilisers, 10% of pesticides and 25% of insecticides (Entine et al., 2014; DuVall, 2017). Hazardous pesticides include aldicarb, phorate, methamidophos and endosulfan (Ethical, 2020). Leaching pesticides bioaccumulate over time (Carson, 1962; Dietz, 2013), and exposure leads to poisoning with 25 million cultivator poisonings annually (Singh et al., 2016; Jeyaratnam, 1990), whilst agricultural chemicals kill 200,000 people annually (DuVall, 2017).

Cotton pesticides include 1,3-dichloropropene, a carcinogen damaging respiration, kidneys, reproduction, eyes and skin (Clarke, 2017). Similarly, malathion is a textile pesticide carcinogenic to terrestrial invertebrates, primarily bees and aquatic invertebrates (Tomlin, 2006; IARC, 2015).

In 2017, 80% of the cotton was GM (Folger, 2014; Shahbandeh, 2019; Cutler, 2020), highlighted by 90% of USA cotton (USDA, 2019) and 99.5% of Australian cotton (OGTR, 2020). Proponents attribute reduced water and chemical consumption to the proliferation of GM in Australia, reducing insecticides by 85% and herbicides by 33-62% (Ward, 2014). Shiva (1989), Abbas (2018) and Prior (2018) dispute these environmental advantages, raising concerns regarding the contamination of GM genes into pristine wilderness. Recommendations limit GM crops to 20-50%, surrounded with non-GM refuges to mitigate transfer via pollinators (Qiao et al., 2017; Kranthi et al., 2019).

FIBRE TYPES

There are three chemical groups of textile fibres: Cellulose, protein and synthetic. Fibres derived from plants (cellulose) or animals/insects (proteins) are collected as staples or processed into filaments and spun into yarns suitable for knitting or weaving, although non- wovens do not require a yarn stage (Lawrence, 2015). Petrochemicals/minerals (synthetics) are disassembled, resulting in polymers suitable for respinning into fibres (Sandin and Peters, 2018). Cotton constitutes 24-31% of fibre markets (Sandin et al., 2018; Iqbal et al., 2019), 63% derived from petrochemicals/minerals with the balance derived from alternative species of plants, animals and insects (Lenzig, 2016).

Cellulose fibres derived from plants include flax, hemp, bamboo and eucalyptus, whilst cotton retains the highest volume, with 26 mt produced yearly (Organic Cotton, 2020). Synthetic fibres derived from petrochemicals include polyester, originally TeryleneTM, and DacronTM (Boekhoff, 1996), now occupying 51% of textile markets (Bruce et al., 2016; Lenzing, 2017; Sandin et al., 2018).

Life Cycle Analysis (LCA) quantifies textile impacts encompassing: water, land, chemicals, embodied energy, greenhouse gases and carbon footprint (Roos, 2016). The OEKO-TEX 100 tool certifies the toxicity of textiles, having assessed 90,000 products (DITE, 2011; Ecolabel Index, 2020), enabling unprecedented insights into pollutants (Bomgardner, 2018).

Kane et al. stated, “The environmental impact of textile dyeing and finishing is of paramount concern” (2020, p.99) as chemicals use is prevalent for all fibres types (Gupta, 2013). Washing synthetic textiles contributes 35% of oceanic microfibres aggregating to 500,000 tonnes annually (IUCN, 2017). In-wash laundry accessories mitigate leakage but landfilling intercepted microfibres merely displaces these pollutants (EMA, 2017), necessitating research to reduce impacts.

Fibre and textile industries utilise 8000 chemicals (Nimkar, 2017), impacting environments through the leaching of fertilisers during cultivation, processing, manufacturing, dyeing, printing, finishing, use-phase, end-of-life biodegradation and regeneration (Brigden et al., 2012; Kant, 2012; Roos, 2016). Cotton processing utilises sodium hydroxide to remove substances to isolate purified cellulose (Cheng et al., 2009), so a pure variety of cellulose, such as BC, may mitigate impacts.

Numerous textile chemicals are prioritised for eradication as they contribute to 20% of global water pollution (Kant, 2012). These include hazardous chemicals such as polyfluoroalkyl substances (PFAS), nonylphenol ethoxylates and phthalates (Stenborg, 2013; Roos, 2016). Azo dyes are also problematic, releasing carcinogenic aromatic amines; while heavy metals including cadmium, lead, and mercury are used for dyes and pigments; and formaldehyde is used for wrinkle-free, shrinkage-free, anti-mildew, anti-parasite, and flame retardance (Plell, 2018). Body heat and sweating accelerate the osmosis of toxic textile chemicals into the skin (Stringer, 2019), underpinning the necessity to design fit-for-purpose textiles with the mitigation of chemical use.

TEXTILE WASTE & EMISSIONS MANAGEMENT

Australia produces 500,000 tonnes of textile waste (McFall-Johnsen, 2018), contributing to 15.1 mt globally, 12.8 of which is discarded (Tan, 2016) while only 1% is recycled (Wicker, 2016). Textile emissions totalled 1.2 billion tonnes (4.3%) of carbon dioxide (EMF, 2017; GFA, 2017; Pandey, 2018), modelled to reach 26% by 2050 if textile emissions maintain this trajectory (DTE, 2019).

Waste cellulose and protein are combined with virgin fibres to regenerate fibres utilising SaXcell and Renewcell recycling technologies (Narasimhan et al., 2016; Oelerich et al., 2017). Waste synthetics are regenerable within closed-loop systems, with the caveat that chemical processing adds impacts (Blackburn, 2015).

Performance-enhancing synthetic chemicals are often applied as finishes to natural fibres (Riley et al., 2017), problematising recycling, and reducing biodegradation efficiency as synthetics emit greenhouse gases for centuries (Hawley, 2006; Karanjekar et al., 2015; McCarthy, 2018). Nevertheless, technologies including Identitex™ isolate fibre groups from composite textile waste (Saxcell, 2020), Fibresort™ machinery sorts waste textiles by composition (Matthews, 2015) and Blocktexx technologies separate composited waste for regeneration (Blocktexx, 2020; Linnenkoper, 2019).

Bartl (2011) reports landfilling textiles as the least environmentally friendly waste treatment, yet it remains an incumbent disposal method. Incineration of waste textiles releases greenhouse gases such as hydrogen cyanide (SEPA, 2019) whilst remaining a prominent form of energy harvesting. As fibre production and textile processing are energy-intensive, reuse and resource recovery of waste represent ideals in waste management (Bartl, 2011). Nevertheless, waste textiles cannot be regenerated indefinitely, underpinning the relevance of developing environmentally sustainable methods of deriving textile fibres.

Emerging waste management practices include anaerobic digestion, whereby methane emissions of biodegrading plant and animal fibres are captured and converted into: biopolymers applicable for textile production (Mango Materials, 2021), liquified natural gas and electricity (Poltronieri et al., 2016).

Potential also exists to derive cellulose from non-traditional organisms such as certain species of bacteria, slime moulds, tunicates and algae that produce cellulose (Saxena et al., 2005). This research interrogated Komagataeibacter xylinus, a cellulose-producing bacteria which synthesises pure cellulose nanofibrils (Volova et al., 2018) circumnavigating the need for chemical processing to extract pure cellulose (Klemm et al., 2001). Potential to derive bacteria-derived cellulose is gaining momentum in research and industry, although challenges must be overcome regarding scalability, as discussed in the BC chapter.

As discussed, the fibre, textile and fashion industries face myriad challenges to mitigate the impacts of the textile lifecycle. Prevalent systems expose ecosystems to toxic pollutants exacerbated by overconsumption. This dissertation advocates a renaissance of non-toxic, synthetic chemical-free biological processes combined with contemporary technology, advocating the potential of BC to mitigate resource depletion and release of emissions, to reduce textile environmental impacts.

OVERVIEW OF DESIGN AND SCIENCE METHODOLOGIES

Interdisciplinary collaboration is a method that has emerged as a feature of both the biodesign community and this research, further discussed in Community of Practice. Through both studio and laboratory-based experimentation, many observed similarities and differences between design and science fields taught me how the confluence of these attributes creates new hybridised methods of addressing problems and determining value.

During my pre-research experience as a fashion designer in industry, my process began with identifying design problems, targeted through a phase of trial and error to determine a fit- for-purpose design solution, trialling various materials, methods and tools before achieving an optimal combination. I observed that science also utilises trial and error to address problems, known as an experimental phase. As per design, science also trials a series of materials, methods and apparatus before a workable confluence is achieved. A successful design may be determined through qualitative analysis, (such as how it feels against the body of the wearer) whereas measures of success in scientific terms are through objective analysis of quantitative data. By working collaboratively with scientists and scientific

principles, my comprehension of value determination also deepened, through hybridised assessments of biodesign outcomes, encapsulating both qualitative and quantitative measurements. The depth and scope of these methods are documented, discussed and reflected upon in Section 2 of this thesis.

I initially cultivated BC during my studio-based experimentation and producing a biomaterial through fermentation was very liberating, exhibiting promise as an alternative method of fabricating an environmental textile. BC was biofabricated with primitive studio apparatus and methods without requiring toxic chemicals, minimal water consumption and achievable utilising very low-cost or zero-cost resource recovered feedstock.

As experimentation with these methods developed, I comprehended the limitations of this studio-based method. For example, the capability to reliably cultivate homogenous BC in my studio proved technically challenging, highlighting the requirement for a sterile laboratory environment to deepen my comprehension of BC’s potential for textile applications.

To address these challenges, I moved beyond the confines of the studio to understand and experience BC from a scientific perspective, leading to the undertaking of scientific collaborations and the development of scientific skills in a laboratory, thus situating this research in the field of biodesign, eliciting the opportunity to research BC on a molecular level. As my need to understand and practice scientific methods developed, I forged a relationship with Professor of Mycology Dr Ann Lawrie, who became an associate supervisor and was instrumental in training me in microbiology protocols enabling engagement in biodesign experiments. These experiences deepened my understanding and knowledge of BC in practical ways I could not have achieved through literature reviews and studio methods. These experiments are documented and discussed in Laboratory-based Experimentation.

This introduction summarised the key themes discussed and documented in this thesis, my background and motivations for exploring BC, the environmental impacts of the textile industry, the structure of this thesis, a preview of its content and my research question, ‘To what extent does my practice change when design meets science?’. The next chapter reviews BC literature concerning BC’s potential applicability as a textile with fewer environmental impacts, a topic which is discussed further in Studio and Laboratory-based Experimentation.

CHAPTER 1 Bacterial Cellulose: Fibres Secreted By Microorganisms

As previously discussed, the cultivation of cellulose fibres is associated with many environmental impacts, including water use, land use and chemical pollution (Micklin, 2007; Roos, 2016; Sandin and Peters, 2018), underpinning this review exploring the potential of BC as an alternative derivation of cellulose fibre applicable to textiles.

Literature is reviewed primarily from biochemistry, biomedicine, material science and microbiology; design literature exploring BC is discussed in Community of Practice. BC characteristics reviewed in this chapter include chemical composition, microbiology and cultivation methods, current applications, water use, energy requirements and health risks. I aim to highlight techniques for streamlining the cultivation, uncover methods for improving the material properties of BC, identify waste applicable as feedstock and discuss fit-for-purpose design applications.

These aims build towards repeatable steps for upscaling BC production with environmentally friendly methods to partially replace cellulose derived by less sustainable methods. This review of scientific literature underpins the methods and methodologies undertaken in the practice component of this research and has necessitated the use of scientific nomenclature foreign to design literature, some of which are defined in the Glossary.

CELLULOSE

French agricultural chemist Anselme Payen discovered cellulose, establishing its role as a structural component of the cell walls of plants (Hon, 1994). Cellulose is the most abundant polymer on Earth, with 180 billion tonnes of cellulose grown annually (Brown, 2004; Klemm et al., 2005). Cellulose is a linear polysaccharide fibre consisting of chains of glucose monomers combined to form carbohydrate biopolymers (Ophardt, 2003). The chemical structure of cellulose can be observed in Figure 2.0, demonstrating how the polymers link together two- and three-dimensionally, thus illustrating how molecules aggregate to form visible microfibrils of cellulose.

Figure 2.0 Diagram of a chain of glucose monomers aggregating to form strands of cellulose.

Cellulose I and II occur naturally, with cellulose II exhibiting more thermodynamic stability due to changes in the crystal structure (Nunes, 2017). Cellulose III is obtained via processing of cellulose I or II with amines, while processing of cellulose III with glycerol at high temperatures results in cellulose IV. Cotton is 95% cellulose I (β-1,4-d- anhydroglycopyranose) (Chand and Fahim, 2008). These four known types of cellulose are important, as BC is characterised as cellulose II (Szymańska-Chargot et al., 2011), a cellulose type exhibiting particular characteristics that may be advantageous or disadvantageous to design applications. It was beyond the scope to explore the impacts of the various cellulose types during practice research but one clear advantage is that cellulose II occurs naturally, circumnavigating the need for additional synthetic chemicals or energy that significantly add to the impacts of cellulose types III and IV.

ETYMOLOGY

When my BC literature review began, it was unclear why there was so much variation between the terms used to describe BC. As my review deepened, it became increasingly clear that BC nomenclature is vast, exemplified by a supernumerary collection of more than 30 terms published since BC’s discovery, many of which are now archaic. Comprehending such an array of terms increased the challenge of reviewing literature in this field but establishing this variety of terms existed, facilitated a deeper review of BC literature and thus a greater understanding of its potential. Furthermore, I observed that practitioners, scientists and companies in various fields use varying terms to suit their purpose. For example, Suzanne Lee’s BC project is BioCouture, providing Lee’s BC project with a high-fashion connotation and BC textile company Nanollose opted for a company name including the prefix ‘nano’ combined with the suffix ‘ose’, capitalising on the surge in nanotechnology investment in recent times.

Since BC research began, the descriptions of BC have evolved immensely, each name revealing clues regarding which discipline it was targeting. For example, scientific terms include extracellular gelatinous mat (Brown, 1887), extracellular polymeric substance (Nazir et al., 2019), zoogleal mat (Blanc, 1996) and cities for microbes (Watnick et al., 2000). Technical terms include bionanocellulose (Rojewska et al., 2017; Ryngajłło et al., 2019), nanobiocellulose (Gorgieva et al., 2019), gelatinous nanofilm (Rangaswamy et al., 2015), BC nanofilm (Wang et al., 2020), cellulose nanofibres (Yao et al., 2017), microbial cellulose (Rangaswamy et al., 2015). The do-it-yourself and design fields use terms including kombucha leather (Branwyn, 2018), vegan leather (Musk, 2016), vinegar plant (Park et al., 2009), scoby leather and mother (Jayabalan et al., 2014).

It was important to tessellate the puzzle of how these names changed to establish a holistic understanding of what BC literature exists. In this research, to mitigate confusion, I used the terms bacterial cellulose (BC) and pellicle to describe the cellulose produced by K. xylinus.

CULTURE AND PHYSIOLOGY

Unlike cellulose formed by terrestrial plants in seeds, stems and leaves, cellulose-forming bacteria synthesise cellulose through a fermentation process (Costa et al., 2017), as secreting a BC matrix is critical for the survival of microbes in harsh environments (Zaets et al., 2014). The BC matrix decreases susceptibility to the damaging effects of ultraviolet rays, conferring the advantage of repelling competitive microorganisms vying for nutrients suspended in the growth medium (Williams and Cannon, 1989).

The general public may have encountered the pellicle which forms at the air-liquid interface of kombucha tea, which has emerged as a popular beverage and commensurate reemergence of growing kombucha at home for the purported benefits to the microbiome. Suzanne Lee is the design practitioner most widely advocating the potential of kombucha leather, further discussed in Community of Practice.

There are a variety of known cellulose-producing bacteria including Gluconacetobacter sucrofermentans (Santos et al., 2013), G. hansenii (Costa et al., 2017) and Komagataeibacter xylinus (Silva et al., 2017). As further outlined in Laboratory-based Experimentation, my practice focussed on the potential of K. xylinus, primarily due to its efficient production of cellulose but secondly due to financial restraints associated with purchasing additional species of cellulose-producing bacteria for research. Nevertheless, it is important to establish that various species exhibit different characteristics that impact their ability to produce cellulose. For example, K. xylinus is a unicellular, Gram-negative, acetic acid- producing non-pathogenic bacterium, identified by Adrian John Brown (Brown, 1887). It was originally named Bacterium aceti or Bacterium xylinum, later renamed Acetobacter xylinum, then Gluconacetobacter xylinus (Römling and Galperin, 2015), and is the most widely studied bacterial producer of fibres due to its high cellulose-production efficiency (Petersen & Gatenholm, 2011; Meza-Contreras et al., 2018; Vigentini et al., 2019).

The new genus Komagataeibacter was erected in Acetobacteraceae, and G. xylinus was transferred to the current name K. xylinus (Yamada et al., 2012; Oren and Garrity, 2020). Acetobacteraceae contains ten acetic acid and BC-producing genera, including Gluconacetobacter and Acetobacter (Saichana et al., 2014) taxonomically grouped in the order Rhodospirillales of the class Alphaproteobacteria (Hördt et al., 2020).

K. xylinus is a non-motile, diazotrophic aerobe that metabolises a wide range of dissolved carbon compounds and minerals resulting in crystalline, nanofibrillar, extracellular matrices of polymeric substances (Gorgieva and Trček, 2019). Carbon dioxide (CO2) is expelled, partially trapped inside the nanofibrillar matrix, creating buoyancy, allowing BC to rise to the air-liquid interface of the growth medium. This ability facilitates access to the surface, a characteristic crucial for accessing oxygen for respiration and facilitating nitrogen fixation (Delmer, 1999). Williams and Cannon (1989) also report that K. xylinus is capable of growing microaerophilically, indicating that a strictly aerobic environment is not required.

A significant advantage of BC is its typically high purity (Hestrin and Schramm, 1954; Yudianti and Indrarti, 2008; Dufresne, 2018) due to the absence of impurities like hemicellulose, pectin and lignin (Kudlicka and Brown, 1996; Kurosumi et al., 2009). This characteristic circumvents the ecologically costly practice of removing such impurities from cotton-derived cellulose and is a potential benefit for developing BC in some textile applications. BC self-organises its microfibrils into a gelatinous nanofilm (pellicle) that exhibits high mechanical strength (Rangaswamy et al., 2015; Lavasani et al., 2017; Liu et al., 2019). Potential also exists to dissolve BC into a biopolymer solution able to be spun into filaments through a wet-spinning process. During my literature review, I observed many alternative polymers spun with a wet- spinning process (e.g. algae, citrus waste, coffee waste) leading me to hypothesise that wet-spinning may be a method also applicable to BC. I then discovered an Australian start- up company called Nanollose, claiming to have developed a method for wet-spinning BC into a regenerated lyocell textile (Nanollose, 2021).

As discussed in the Introduction, the wet-spinning process is a widely used industrial- scale textile making process used for fibres such as bamboo. The replacement of BC for fibres such as bamboo potentially mitigates environmental impacts as bamboo requires

high chemical and energy processing to become ready for wet-spinning. I went through a protracted period of communications and negotiations with The Institute of Frontier Textiles at Deakin University to conduct some wet-spinning tests. Initial viscosity tests were begun and regrettably were abandoned due to ongoing campus closures resulting from Covid-19. Nevertheless, in Laboratory-based Experimentation, I discuss the potential for BC to be wet spun.

This research utilises K. xylinus, a cellulose-producing bacterium known to reside within kombucha (Yamada et al., 2012). This will be further discussed in both Studio and Laboratory- based Experimentation.

APPLICATIONS

BC is currently utilised in various industries including high-fibre food (Jayabalan et al., 2014), paper, materials, pharmaceutical, cosmeceutical industries (Gallegos et al., 2016), biomedical textiles for tissue engineering and wound dressing (Vielreicher et al., 2018). BC is also used for bioremediation of textile dye and removal of chemical oxygen demand from textile wastewater (Isik et al., 2018); and economically viable improvements of recycled paper and strengthening of paper when hybridised with plant-based cellulose (Campano et al., 2018). Commercialisation of BC for these applications in other fields highlights the potential to also scale BC for fashion and textile applications.

Relative to the larger quantity of peer-reviewed scientific publications, there is also a smaller but still important quantity of peer-reviewed articles published on BC in the interrelated fields of fibre, fashion, textile and biodesign and, notably, a marked increase in these articles in recent years, a topic further discussed in Community of Practice. These include the growing trend towards do-it-yourself culture, and the utilisation of kombucha pellicles as a form of ‘vegan leather’, while other companies, notably Nanollose, are now heavily involved in pilot-testing methods for scaling BC production towards industrial outcomes applicable to both the fashion and textile design industries.

In scientific fields, BC research outcomes and the measurement of their impact are usually discussed in regards to publications in peer-reviewed papers, whereas in design, research is usually presented in alternative contexts such as exhibitions and public presentations. For example, in 2011 fashion designer Suzanne Lee took to the TED stage in a presentation titled ‘Grow Your Own Clothes’, receiving 1,602,622 views (as of 14th June 2021). While some studies considering the application of BC for fashion/textiles had been published prior, a significant surge in BC literature has emerged in the last decade; thus it is important to consider that scientific journal articles do not reach an audience to the extent that a TED talk can. I further discussed engagement and how interdisciplinary biodesigners publish their research in Community Of Practice. Also included are examples of engagement I have produced during this research in Studio-based Experimentation.

KOMBUCHA

To determine how BC may be optimised for textile applications, kombucha fermentation was reviewed, providing insights on how traditional cultivated methods may be combined with contemporary methods and tools.

Kombucha is a beverage produced by fermenting sweetened tea inoculated with a live culture of bacteria and yeast (Jayabalan et al., 2010), purportedly originating two millennia ago, undergoing a series of etymological shifts including ‘Manchurian Mushroom’ (Hamblin, 2016), before Doctor Kombu brought the chá to Japan, thus deriving its contemporary name (Dufresne and Farmworth, 2000). Kombucha industries were valued at USD 0.74 billion in 2016, predicted to rise to USD 5 billion by 2025, while 210 kombucha brands distribute products across 22 countries with 98% of brands positioning their marketing as wellness products (Lumina Intelligence, 2021). This highlights the market kombucha has attracted in recent years, due to its perceived health benefits and its popularity with the Millennial market. As kombucha has achieved a meteoric level of mainstream adoption in recent years, this may act as a pathway for the subsequent adoption of biomaterials produced as a by-product or derivative of this beverage.

May et al. (2019) state that kombucha cultures concurrently contain several species of bacteria and yeasts. While all kombucha cultures contain an acetic acid-producing strain of bacteria, many cultures also contain additional bacteria, including the lactic acid producers Bacillus coagulans and Lactobacillus plantarum, adding tartness to the flavour. Yeasts commonly found in kombucha include Saccharomyces boulardii, Brettanomyces and Zygosaccharomyces kombuchaensis (Jayabalan et al., 2010).

Kombucha culture produces a fibrous by-product commonly referred to by the acronym scoby (Symbiotic Culture of Bacteria and Yeast) that floats at the air-liquid interface. This is a chemically pure cellulose pellicle, formed most commonly by K. xylinus (Hestrin and Schramm, 1954). Additionally, BC is produced by closely related species, including K. rhaeticus and genera, such as Gluconacetobacter kombuchae (Machado et al., 2018).

Specifically, it is the cellulose-producing bacteria (e.g K. xylinus) that secretes the cellulose fibres and therefore it seems logical to hypothesise that isolating this bacterium may optimise growth, due to less competition for food. Nevertheless, I argue that it may be optimal to continue using a symbiotic culture of various microorganisms including acetic acid-producing microbes, as this seemingly incidental characteristic may significantly mitigate the risk of culture contamination. This hypothesis was discussed in Studio- based Experimentation whereby tests were set up with a pure strain of K. xylinus, all of which became contaminated before the pellicle reached maturity, whereas experiments undertaken with the symbiotic culture usually reached maturity without contamination.

REPRODUCTION

The Fairbrother’s Textbook of Bacteriology (1970) states that a BC colony can be established with a single bacterium proliferating by binary fission into two genetically identical daughter cells. Bacteria multiply indefinitely, doubling every 20 minutes, undergoing exponential growth. These events may be divided into four cultivation phases: (1) lag, (2) logarithmic, (3) stationary and (4) decline (Fairbrother, 1970). Consequently, inoculating a growth medium with a single bacterium may result in a longer cultivation period; conversely, beginning with a larger bacterial culture may maximise cellulose yield in the same duration, provided the nutritional and environmental needs of a larger inoculum are proportionately met. In Studio- based Experimentation, I discuss a test whereby I blended fragments of waste pellicles to test this theory. I observed that this method resulted in the assembly of a faster-growing pellicle, as it provided the BC with a headstart on matrix formation, although this may have resulted from other cultivation parameters including seasonal variations in temperature during cultivation. Nevertheless, I consider it to be a hypothesis worthy of experimentation under laboratory conditions, as this method may contribute to scalability.

METABOLISM

BC metabolises various carbon compounds as energy sources, including sugars (e.g. glucose, sucrose, fructose, arabinose, galactose and xylose) and alcohols (e.g. ethanol, glycerol, sorbitol and mannitol) (Dutta and Gachhui, 2007).

The most efficient carbon source for laboratory-based BC cultivation is glucose (Hestrin and Schramm, 1954). K. xylinus polymerises 200,000 glucose molecules every minute, using β‐1,4-glycosidic bonds to form cellulose (Tang et al., 2010) and producing cellulose most efficiently when metabolising glucose, fructose, sucrose and glycerol (Rangaswamy et al., 2015; Gullo and Giudici, 2008). Zhong et al. (2013) compared the metabolic flux for the central carbon metabolism, reporting that 47.96 % of glycerol was transformed into BC, while 24.78 % of fructose and 19.05 % of glucose were transformed. Volova et al. (2018) report K. xylinus metabolises glucose more efficiently than other substrates, with the caveat that BC- production is inhibited at greater than 25% (w/v) glucose. Glucose is thus an ideal feedstock for cellulose production (Jozala et al., 2016).

Sucrose is the most common carbon source used in kombucha production largely because of its cost-effectiveness and K. xylinus converts glucose into gluconic acid via glucose dehydrogenase, reducing cellulose yield in pure culture (Kuo et al., 2016). May et al. (2019) observed ethanol-producing yeasts present in kombucha performing a multipurpose role. The yeasts metabolise sucrose, glucose and fructose to form ethanol, which Acetobacter species convert to acetic acid (Steels et al., 2002). The addition of 1% (v/v) ethanol to a culture medium of cellulose-producer G. hansenii inhibited the growth of non-cellulose- producing mutants (Park et al., 2003), whilst increasing BC production.

BC production also requires sodium, potassium, calcium, magnesium and iron, as they are enzymatic cofactors in the production of intermediates needed for cellulose synthesis, aided by nitrogen fixation from the air (Almeida et al., 2013).

Nitrogen is the main component of proteins essential for cell metabolism and constitutes 8-14% of the bacterial mass (Almeida et al., 2013). Additional nitrogen in the medium increased biomass but reduced the rate of cellulose production. In kombucha, K. hansenii (Dutta and Gachhui, 2007) and K. xylinus fix nitrogen. They are two of only six cellulose- producing and acetic acid-producing bacteria exhibiting this capability, as demonstrated by the cultivation of K. xylinus in a nitrogen-free LGI medium (Machado et al., 2018). This confers the advantage of utilising low-nitrogen carbon sources in which other bacteria have lesser productivity and hence less competitiveness and also reduces the economic cost of the bacterial feedstock.

I discussed the ability of known cellulose-producing bacteria to metabolise various sugars as this characteristic exhibits the potential to utilise waste from food processing or agricultural supply chains from which 1.3 billion tonnes of food are wasted globally (Canali et al., 2017). Recovering nutrient-rich waste as feedstock for BC may help to mitigate the impacts of BC cultivation. Resource recovery is further discussed in Studio-based Experimentation.

TEMPERATURE

The temperature range for cellulose production in kombucha is 10 - 37 ˚C, but the optimum is mostly 18 - 33 ˚C (Moonmangmee et al., 2000; Son et al., 2001; Jayabalan et al., 2014; Volova et al., 2018; Gaggìa et al., 2019; May et al., 2019). Growing K. xylinus in a region that maintains a temperature between 25 - 30 ˚C all year round dramatically reduces the need to use additional energy to maintain the optimum temperature for growth.

This experimentally demonstrated temperature range is important as the potential for growing BC at ambient temperatures without additional energy sources offers a tantalizing look at BC’s potential to reduce production impacts. In Studio-based Experimentation, I discuss the cultivation of BC at both ambient and controlled temperatures in low-fi conditions, whereby I observed, albeit anecdotally, that BC cultivation occurred significantly faster when a temperature ± 30˚C was maintained.

In the thesis, the ‘±’ symbol is used to mean “more or less”, as is the norm in biology and other fields of life science.

ACIDITY/ALKALINITY

As K. xylinus metabolises nitrogen, it produces ammonia, a volatile, soluble, colourless gas, creating a strongly alkaline solution. However, the pH (power + hydrogen) value of kombucha gradually decreases during fermentation due to the cohabitation of acetic acid bacteria (AAB), which stimulate yeast to produce ethanol, in turn assisting AAB with acetic acid production (Liu et al., 1996). Son et al. (2001) report effective BC-production at pH 4.5 - 7.5 with the maximum rate at pH 6.5. Steels et al. (2002) report optimum efficiency at pH 2.0 - 3.6 and Volova et al. (2018) at pH 3.5 - 4.5.

This acidity versus alkalinity measurement is important as the pH must be closely monitored and maintained during fermentation to both maintain the optimum rate of cellulose production and mitigate the risk of airborne contaminants colonising the nutrients. I made initial attempts to monitor pH, but it was not practical to accurately measure and proportionately adjust the pH due to the low-fi nature of the studio experiments. This experiment would have been better suited to growing BC in the laboratory, whereby the pH could be measured with appropriate apparatus and scientific rigour. Due to ongoing campus closures resulting from Covid-19 throughout my candidature, it was not possible to undertake this experiment, nevertheless, monitoring the pH remains an important factor in optimising BC production.

STATIC VERSUS AGITATION CULTIVATION METHOD

The ‘static method’ (Watanabe et al., 1998) is the stationary means of producing BC, akin to the method used by kombucha home brewers, whereas the ‘agitation method’ requires the vigorous shaking of liquid culture, providing a highly-oxygenated environment experimentally proven to catalyse BC-production (Campano et al., 2018).

Campano et al. (2018) regard the static method as exhibiting more industrial potential but concede that as static BC synthesis requires cultivation in shallow trays of liquid culture, the space required may inhibit scalability. The agitation method addresses space efficiency, potentially utilising less space than stacked static vessels. The quantification of energy required for continuously agitated vessels must be evaluated versus the energy-free static method, and the potential to develop stackable cultivation vessels to efficiently increase the yield of static BC synthesis. Nguyen et al. (2008) report that agitation deactivates essential enzymes required for BC production, increasing the risk of bacterial mutations that decrease cellulose production.

While developing the agitation method to produce BC fibres warrants further research, so does the potential for optimising the static method. Therefore, the choice of static versus agitated culture should also be determined on a fit-for-purpose basis. For example, if the aim is to produce a non-woven biomaterial without further processing, the static method may be most applicable. Conversely, if the aim is to produce industrial quantities of non-uniform BC nanofibre to later be dissolved for wet-spinning, agitation may be optimal if Campano

et al. (2018) are correct in their experimental results that high oxygenation leads to a faster rate of BC production. Studio-based Experimentation further explores and compares these methods.

WATER QUALITY

Water-borne impurities pose significant risks to BC cultivation and thus literature on water quality also needs to be reviewed and assessed. Chlorination is one of the most widely used disinfection processes and is commonly added to drinking water supplies due to its bactericidal effect (Kotula et al., 1997). Procedures should be undertaken to remove chlorine before bacterial cultivation, to provide a liquid environment conducive to BC production.

Methods for dechlorinating water include: adding sulphur-based chemicals; reverse osmosis, dechlorinating agent; boiling water for 20 min; pump aeration; off-gassing (Hall et al., 1981); ultraviolet (UV) light at 254 nm (James, 2009); and adding ascorbic acid (Son etal., 2001) which also optimises the pH.

This is worthy of further consideration, as if the water quality is not suitably pure, it may significantly reduce the ability of the cellulose-producing bacteria to produce BC. The need for water purification also adds impacts to the production process either through heating water to purify it or the addition of chemicals. During Studio-based Experimentation, I discussed boiling water for 20 minutes to purify the water before inoculation of K. xylinus.

CULTIVATION ENVIRONMENT

BC is cultivated according to aseptic techniques under controlled conditions to mitigate the risk of environmental contaminants colonising the BC culture (Siddiquee, 2017). This requires a sterilised container with a permeable lid or forced bubbling with sterile air to allow oxygenation whilst protecting from airborne micro- or macroorganisms. As BC culture produces acetic acid, it must be cultivated in a vessel that will not be susceptible to degradation by acetic acid vapour (AAV), precluding the use of mild steel. Lead-free ceramics, plastics and glass are all suitable for small-scale in-vitro research, glass being especially useful where high visibility is often critical during research.

To scale BC production, stainless steel is a fit-for-purpose solution, commonly used for cultivating various fermentation processes at industrial scales. Prevalent examples include kombucha and nata de coco, both of which produce BC at scale for the food and beverage industry (Piadozo, 2016), a practice further discussed in Studio-based Experimentation. Thus, the potential exists to utilise existing food technology to cultivate BC at scale utilising stainless vats suitable for 500,000 - 3,000,000 litres (A & G Engineering, 2020).

While equipment for scaling up is entirely possible, the do-it-yourself potential of BC also offers the ability to explore the static method in a home/studio environment as outlined in Studio-based Experimentation.

OXYGENATION

K. xylinus bacteria are aerobic, an attribute facilitating the intrusion of airborne contaminants (Jayabalan et al., 2014). Orbital shaking or sparging of sterile oxygen necessitates growth, whilst offering protection from airborne competitors (Yoshinaga, 1997).

During static method explorations, some experiments developed unexpected outcomes arising from colonisation by airborne contaminants, further discussed in Studio-based Experimentation.

CULTIVATION CATALYSTS

Son et al. (2001) added 1.4% (v/v) ethanol to the growth medium, improving BC production by 300% and eliminating mutations of Acetobacter species. The addition of 3% (w/v) ethanol also enhanced BC-productivity (Volova et al., 2018). The phytohormone ethylene enhances cellulose production as it increases K. xylinus biosynthesis directly by up-regulating the expression of bcsA and bcsB (Augimeri et al., 2015).

Nascent methods for augmenting BC cultivation improves the efficacy required to produce BC competitively. Methods include using low-cost feedstocks (e.g recovering high-carbon waste from food and beverage industries) (García-Sánchez, 2020; Kongruang, 2008), chemical catalysts and aeration to increase cellulose production (Yoshinaga, 1997).

Meza-Contreras et al. (2018) demonstrated experimentally that exposure to ultraviolet radiation significantly enhanced cellulose yield, as BC-production doubled relative to the control. Meza-Contreras et al. (2018) state BC-production is a protection mechanism, potentially explaining the greater BC-production when 5 g l-1 of sodium chloride is added, which causes osmotic stress.

In Studio-based Experimentation, I discuss BC cultivation with and without direct exposure to sunlight. I also conducted an experiment whereby I added salt to the nutrient medium, but both these tests were inconclusive due to the low-fi constraints of analysis in the studio environment. I was unable to recreate the ethanol experiment in my studio as pure ethanol is a controlled liquid. Nevertheless, as per the experimental results in the BC literature, it may be beneficial to explore catalysts in a laboratory to determine how they may optimise BC production.

CULTIVATION PERIOD

May et al. (2019) state an optimum cultivation period of 10 - 14 days and Jayabalan et al. (2014) report the cultivation of a 2 cm thick pellicle after 10 - 14 days. These published findings inform Studio-based Experimentation, where cultivation tests were undertaken from 7 - 90 days, to determine how the cultivation period impacts the resultant biomaterial, and consequently, the potential textile design applications.

HARVESTING AND DEHYDRATION

A mature BC pellicle is harvested by removal from the liquid culture. A freshly harvested pellicle consists of less than 1% cellulose and more than 99% water (Vielreicher, 2018; Choi and Shin, 2020). Thus, the harvesting stage is an ideal time to add dye without additional water use.

Dehydration is an essential step in establishing a stable BC biomaterial, achievable through air-drying. In warm environments, dehydration is achieved through an environmentally friendly air-drying method. Commensurate with pellicle thickness and room temperature, dehydration typically occurs in ±7 days. Alternatively, BC can be vacuum dried to remove all moisture before subsequent procedures, a process further discussed in Laboratory-based Experimentation. Placing a harvested pellicle in an oven accelerates the dehydration rate, resulting in densification. Expediting dehydration leads to chemical and morphological changes in cellulose fibre structures, resulting in brittleness and a reduction in tensile strength (Šutý, et al., 2012).

Dehydration of BC also reduces swelling and surface availability, known as hornification (Minor, 1994). Hornification is a process of closing the structure of cellulose fibres to increase their BC impermeability to water, due to the development of irreversible hydrogen bonds between microfibrils and other structural units of cellulose fibres (Šutý, et al., 2012).

During Studio-based Experimentation, I discuss dehydrating pellicles at ambient temperatures efficiently during warmer periods, and slower during cooler periods. Therefore, to reduce the production impacts, BC would be well suited to a consistently warm climate. I also experimented with storing a previously dehydrated pellicle in a fridge for 7 days. The pellicle was more brittle after removal, indicating that BC may not be suitable for design applications in environments in environments below 5˚ C.

BIOSAFETY: MITIGATING EXPOSURE TO AIRBORNE CONTAMINANTS

Komagataeibacter xylinus is a safe and non-toxic microorganism fit for human consumption and exposure, already scaled in industries including kombucha (Steels et al., 2002) and nata de coco (Piadozo, 2016). Nevertheless, the vaporous by-products and innumerable organisms that may colonise K. xylinus must be monitored to ensure the safety of cultivators.

BC cultivation emits carbon dioxide and acetic acid vapour, but no published reports quantify their emissions. If exposure to increased CO2 is researched and identified as a significant risk to industrial scaling, a solution may be to produce BC using a non-carbon dioxide emitting strain of bacteria. For example, Enterobacter sp. FY-07 is an effective BC producer able to synthesise cellulose aerobically and anaerobically (Ji et al., 2016). Alternatively, sufficient ventilation will mitigate the risk of harmful aggregations of CO2 and AAV, which must be evaluated against the energy use and economic cost.

Acetic acid vapour must be strictly monitored and adhered to within regulatory guidelines, considered non-toxic (to humans) by the US Food and Drug Administration (FDA). The American Occupational Safety and Health Administration (OSHA) and the American Conference of Governmental Industrial Hygienists (ACGIH) have adopted a threshold limit value (TLV), dictating that airborne acetic acid exposure, defined as an 8-hour, time-weighted average (TWA), should be no more than 10 ppm. At 1,000 ppm, vapour concentrations are Immediately Dangerous to Life or Health (IDLH), irritating eyes, nose and respiratory tract (Virginia Department of Health, 2020).

Carbon dioxide is a colourless, odourless, non-flammable greenhouse gas, occurring naturally in the atmosphere. Humans have evolved to withstand minimal CO2 exposure, with 300 ppm to 900 ppm typically present in metropolitan areas. OSHA and ACGIH define the Permissible Exposure Limit (PEL) for CO2 of 5,000 ppm over an 8-hour TLV. An exposure limit of 30,000 ppm is applicable over a 10-min period. At 40,000 ppm, CO2 concentrations are IDLH. Sampling of CO2 is conducted using a gas sampling bag and analysed by chromatography or infrared spectrophotometry (OSHA, 2020; Environmental Safety and Health Group, 2020).

Technical apparatus would have been required to empirically quantify the carbon dioxide or acetic acid vapour during my project work. Nevertheless, it remains important to discuss the potential risks to cultivator health that require mitigation on the path to scalability. In Reflections, I discuss how the BC experiments transformed my studio into a fetid space due to the inadvertent contamination of experiments.

APPEARANCE OF DRIED PELLICLE

French chemist and bacteriologist Louis Pasteur described the BC pellicle as “a sort of moist skin, swollen, gelatinous and slippery” (Louis Pasteur, as cited in Dufresne, 2018, p.125). During Studio-based Experimentation, I discuss the white, blubbery and smooth surface of BC during harvesting. As the pellicle dried, it oxidised to a honey hue, eventually becoming a darker chocolate brown hue. Due to the capacity of BC to absorb moisture hygroscopically, its appearance darkened further when the material became saturated due to high humidity.

I also observed a direct relationship between the natural pigments present in the feedstock and the resultant hue of the final dehydrated pellicle (e.g. waste wine lees resulted in a burgundy pellicle, while orange peel resulted in a noticeably orange pellicle), a topic further discussed in Studio-based Experimentation.

BIODEGRADATION WITH FUNGI

Bacteria and fungi efficiently biodegrade cellulose, yet there are few industrial systems targeted at textile waste. In a 2019 study by Sülar & Devrim, 90% of cellulosic fibres were degraded through exposure to cellulose metabolising microbes in soil. These fibres changed both physically and chemically through the one-month biodegradation process.

This thesis explores the lifecycle of BC including the potential for BC to be biodegraded back into nutrient cycles at end-of-life, thus situating BC within the circular economy. Biodegradation of BC is further discussed in Laboratory-based Experimentation as I undertook an experiment exploring the potential to biodegrade BC with cellulose metabolising fungi.

CONCLUSION

This BC literature review established what is known about the cultivation of BC biomaterials, underpinning the cultivation of BC biomaterials during the practice component of this research. I broadly discussed the cultivation characteristics and applications of BC and K. xylinus specifically, highlighting cultivation parameters influencing the feasibility of scalability.

The characteristics of BC cultivation have been discussed, with BC literature exhibiting the potential to improve the lifecycle impacts of textiles. These methods include: cultivating BC with minimal impacts using food waste as feedstock; low energy and water use; potential to cultivate BC with minimal apparatus and ability to scale BC production to industrial levels with comparatively quick cultivation times (e.g. typically up to 1 month for BC compared to up to 2 years for plant-based cellulose such as cotton). The resultant pellicles also exhibited changes in surface morphology commensurate with alterations to the feedstocks and cultivation parameters, some of which may be desirable on a fit-for-purpose basis (eg. increases and decreases in transparency versus opacity, flexibility versus rigidity). Disadvantages potentially include water purification adding to impacts; non-laboratory environments (e.g. DIY studio) becoming unpleasant due to an influx of carbon dioxide and acetic acid vapour; airborne contaminant (e.g. fruit flies) attraction to cultivation tanks; and the hydrophilic and hygroscopic characteristics of the dried pellicle, although some applications demonstrate this may be an advantage (e.g. wound dressings and baby wipes).

I argue that the cultivation of BC exhibits the potential for optimisation beyond what has been published previously in the literature, yet further investigation is required to comprehend how this potential may apply to textiles.

The subsequent chapter, Community of Practice, discussed biodesign projects exploring textiles and the value of interdisciplinary collaboration to the biodesign field. Studio and Laboratory-based Experimentation discussed the practical projects undertaken, underpinned by this BC review to discuss the advantages and disadvantages of BC cultivation for textile applications.

CHAPTER 2 Community Of Practice: Situating Within Biodesign

Underpinning the practice-based experimentation I have undertaken, this chapter situates my research within an emergent community of practice known as biodesign. This chapter discusses definitions, provides historical context and analysis on how and why this field has emerged and discusses the community of practice, drawing specific attention to key practitioners, theorists, curators, companies and projects in the biodesign field pertinent to this BC textile research.

To begin, it is important to consider that Wenger et al. define practice as “a set of frameworks, ideas, tools, information, styles, language, stories and documents”, (2002, p.29) leading to the development of three key structural elements: mutual engagement, joint enterprise and shared repertoire (Iverson, 2011, p.43). Pyrko et al. elaborate on the definition of Wenger et al. vis-à-vis mutual engagement as “how and what people do together as part of practice”, joint enterprise as “a set of problems and topics that they care about”, and shared repertoire as “the concepts and artefacts that they create” (2016, p.391). This chapter applies these definitions to the community of practice that is of most relevance to the research I have undertaken.

As later demonstrated in Section 2, this research explores new sustainable solutions in response to the environmental impacts of the fashion and textile industries (Anguelov, 2016; Bick et al., 2018; Fletcher, 2007; Giacomin et al., 2017; Hines, 2007). To address these impacts, I have explored the potential to transform my practice from that of a fashion designer to that of an interdisciplinary biodesign practitioner, merging life science and design methods and methodologies to produce new ecologically relevant textiles.

I observe a key characteristic of practitioners in this field to be the merging of previously siloed fields of knowledge through interdisciplinary practice. These fields often include biology, synthetic biology, microbiology, mycology, biochemistry, bioengineering and material science, with many branches of design including architecture, industrial, accessory, fashion and textiles. Consequently, there are numerous biodesigners, scientists, researchers, curators, theorists and companies with whom I identify as my community of practice for this thesis. Among the myriad of practitioners in the nascent biodesign field, those of specific interest to this research interrogates the potential to merge methodologies of life and material science, with those of design, applicable to the production of textiles that are superior to the incumbents on an ecological basis.

The community of practitioners of key relevance to this thesis include textile companies Nanollose, Modern Meadow and Ecovative Design, all of whom engage with biodesign

methods to biofabricate environmentally relevant textiles. In addition, I discuss the more speculative textile artefacts of Suzanne Lee, Neri Oxman and Donna Franklin respectively. I also discuss the views of key biodesign theorists and curators including Kate Fletcher, William Myers, Paola Antonelli and Carole Collet. All are highly relevant to this thesis as they contribute valuable artefacts, literature, exhibitions and public engagement to the field, offering insights into what the future of textiles may look like, speculating on how these future textiles will be produced, and the importance of these new ways of working, in collaboration with biological systems.

BIODESIGN: DEFINITIONS AND PRACTICES IN AN EMERGING FIELD

Biodesign is a term that has emerged in recent decades, but in many respects, it defines a mode of interdisciplinary practice that has existed since the beginning of human existence.

To begin to define the contemporary field of biodesign, I stand with Valentine Seymour, a research fellow at the University of Surrey, in her statement that “an interdisciplinary approach can facilitate a deeper understanding of the complexities involved for attaining optimal health at the human-environmental interface.” (Seymour, 2016, p.1). Seymour’s stance is important, as it underpins an argument that is central to the discussion defining the biodesign field, namely the theory that design and agricultural science have always been intrinsically linked, albeit, up until recent decades, without the unifying moniker of biodesign to link them.

For example, archeologists have uncovered fragments of textiles dated 5500 BC (Mithen, 2003), while the trade of textiles is considered to be the first global industry, spanning millennia (Riello, 2013). To produce these textiles, textile designers collaborated with farmers regarding the cultivation and harvesting of plants for the derivation of cellulose fibres (e.g. cotton, flax, hemp, bamboo) and with the practice of animal husbandry to harvest their skin (e.g. cow, sheep, pig) and fur (e.g rabbit, fox, monkey, goat) (Mohajer va Pesaran, 2017, p.257). The 20th century, which saw textiles begin to be produced from petrochemicals and minerals (e.g. polyester, nylon), is construed as a seismic shift away from biological materials, although these substances were still produced by the biodegradation and compression of biological matter through geological compression, albeit over a longitudinal time frame spanning millions of years. Consequently, although the ongoing use of non-renewable fossil fuels may not be ecologically sustainable, it is noteworthy they are still originally derived from a biological source. In this respect, I contend that all textile designers are in some ways ‘biodesigners’, as design has always relied on the harvesting and rearranging of non-living biological materials. Nevertheless, I stand with numerous theorists (Cogdell, 2011; Collet, 2012; Myers and Antonelli, 2012) in the view that biodesign, in the contemporary context, has evolved to define a far more specific mode of practice, utilising living biological materials.

The definition of biodesign is expansive, remaining a topic of much debate, with many designers, academic researchers, fashion and textile commentators expressing strong

opinions of what the field means to them. For example, Central Saint Martins Professor Carole Collete and Nina Williams, lecturer in cultural geography at UNSW, combine to state “Biodesign is at the forefront of innovations in advanced textiles and material futures.” (2020, p.1). Gough et al. (2021, p.1) state that “Biodesign integrates living organisms into designed solutions, often with the aim of improving sustainability and ecological performance in novel ways”, while fashion journalists Debika Ray and Ellie Goodman add that biodesign is a “rather amorphous discipline” (Ray, 2019, p.1) and “biodesign offers a symbiotic, environment-first, innovative approach” (Goodman, 2011, p.1). These examples illustrate the diversity of definitions that define the biodesign field.

One of the most accessible and pivotal texts I encountered was that of design historian and author William Myers, whose book Bio Design: Nature, Science, Creativity, is curated into a series of projects, constituting both the first encyclopedia and textbook of biodesign projects. In this pivotal text, Myers argues the term biodesign has evolved to engender a more specific meaning, stating it does not simply utilise biological-inspired approaches to design in the traditional sense, but implies a level of collaboration between previously siloed fields of creative and scientific enquiry to improve ecological sustainability. Myers contributes a wealth of valuable discussion and engagement to the biodesign field, having also curated numerous biodesign exhibitions including Biodesign: On the Cross-Pollination of Nature, Science, and Creativity, (Myers, 2013 - 2014) and Biodesign: From Inspiration to Integration (Myers, 2018). Myers further defines biodesign as “the integration of design with biological systems, often to achieve better ecological performance”, encompassing the “incorporation of living organisms as essential components, enhancing the function of the finished work ”(2012, p.1).

This open-ended approach to a working definition has been further debated by numerous authors including Cogdell (2011) and Collet (2012) facilitating, over the last decade, the emergence of a more specific definition of biodesign, often encompassing interdisciplinarity between design and science, and the use of living organisms to biofabricate biodesign artefacts and products.

In 2008, an exhibition titled Design and the Elastic Mind was launched at MoMA, curated by Paola Antonelli, senior curator of architecture and design at MoMA, and a significant actor in the biodesign community. Antonelli states “designers want to design objects and buildings that grow by themselves” (Gambino, 2013, p.1). Fashion journalist Meg Miller (2017) describes this exhibition as the first time biodesign was curated into a museum context. This is an important stage in the evolution of biodesign, constituting the first survey exhibition in a major cultural institution, a meaningful step towards the establishment of biodesign as a globally recognised field of practice.

The biodesign field also owes its origins, in part, to the groundbreaking work of scientist and author Janine Benyus, whose trailblazing book Biomimicry: Innovation inspired by nature, inspired a generation of designers to look to nature for inspiration (Gambino, 2013). Biodesign as a field is an iteration of Benyus’ provocation, taking Benyus’ concept of ‘looking’ at nature one step further, incorporating the use of living biological materials into the deoxyribonucleic acid (DNA) of the design process.

To gain a holistic understanding of the origins of biodesign, I have also reviewed the literature concerning the interrelated field of bioart. Yetisen et al. (2015) define bioart as “a contemporary art form that adapts scientific methods and biotechnology to explore living systems as artistic subjects” (p.1). I have observed that bioartworks often result in speculative prototypes that are later commercialised in the biodesign field. Similarly to biodesign, interdisciplinarity is also a key characteristic of bioart, often involving a similar combination of previously siloed fields including practitioners in creative industries with those in the life sciences including biology, microbiology, bioengineering, chemistry and other interrelated fields.

BIODESIGN VERSUS BIOART: DESIGNERS AND ARTISTS WHO USE BIOLOGY

The differences between art and design is an age-old debate (Irwin, 1991), as is the discipline of fashion as being between and both, art and design. Thus the differences between bioart and biodesign is also a topic that could be discussed in great depth. Strictly speaking, bioart is engaged with by artists, whereas biodesign is engaged with by designers, and while I acknowledge this to be a reductive précis of two rich and highly diverse fields, I must exclude a thorough discussion of bioart from this thesis to focus on biodesign practitioners who produce sustainable textile fibres applicable to the textile industry. Nevertheless, I acknowledge the community of practitioners in the fields of biodesign and bioart often overlap, notably Donna Franklin, Ionat Zurr and Oron Catts, warranting a brief discussion of key themes, practitioners and projects in the bioart field to demonstrate that bioart’s reach is often beyond the confines of art, per se, into hybrid areas that may also be viewed within the speculative end of the biodesign spectrum.

For example, it is impossible to consider the field of bioart without discussing the longitudinal collaboration between Zurr and Catts, who in 2002 co-founded Symbiotica, the Centre of Excellence in Biological Arts, within the School of Anatomy and Biology, at the University of Western Australia (Symbiotica, 2021). Notably, their Victimless Leather Jacket, part of their Tissue Culture and Art Project (curated by Antonelli into Design and the Elastic Mind) discussed the social ritual of animals being exploited for their skin. Through this bioartwork, Zurr and Catts offer an alternative form of leather by growing living tissue into a leather-like material, in the shape of a minuscule jacket, speculating on how future textiles may be grown (Rotkop, 2008). Victimless Leather Jacket is an important precedent in the trajectory of biodesign, as this speculative artwork predates the establishment of Modern Meadow in 2011, a biotechnology company utilising a fermentation process to produce Zoa, a laboratory-grown leather applicable to the textile industry (Modern Meadow, 2021).

Donna Franklin is another notable bioartist whose work explores biological processes and relationships with the natural world. While Franklin’s work is generally aligned with the bioart field, Franklin’s works also tessellate well with the values and methods of biodesign and thus practice areas of interest to this thesis. In 2009, Franklin created a living garment titled Fibre Reactive utilising Western Australian orange bracket fungi. It was predicted that

the garment may live for up to five years, a speculative example of how near-future textiles may be cultivated for design outcomes. Rackham states “The glowing and seemingly floating hybrid Fibre Reactive dress challenges us to consider how we as a society commodify and manipulate other living entities and how that will manifest itself in the not-too-distant future as the physical and cultural impact of biotechnology” (2009, p.387). Franklin’s bioartwork is also important as it provides another precedent of how wearable textiles may be produced with biodesign methods, demonstrating the potential to produce qualitatively engaging biological textiles with a minimum of quantitative environmental impact. Franklin’s speculative experiment predates the establishment of several textile companies that are exploring the potential to biofabricate leather-like material utilising mushroom technology, which I will discuss further in this chapter. Franklin is also a practitioner of interest to this research due to her dual role as a curator of bio-inspired artworks, notably her 2012 group exhibition, Creatures of the Future Garden, a component of her PhD research at Edith Cowan University, an exhibition that brought together international bioartists with the aim of “generating further interest in animal welfare, the environment, science and arts” (Franklin, 2012, p.1). In these ways, Franklin’s interdisciplinary oeuvre engages the public in discourse regarding a nexus of creative practice combined with biological principles and is thus an important example of how bioart principles closely align with those of biodesign. In Reflections, I further discuss the significant value of translating biodesign research into public engagement, as a precursor to industrial shifts towards environmentally sustainable textiles.

Another pivotal practitioner creating works that span bioart and biodesign is MIT Professor and architect turned biodesigner Neri Oxman, arguably the most famous practitioner operating across these intersected bio-fields, highlighted by her solo exhibition at MoMA, Neri Oxman: Material Ecology (2020), showcasing eight major projects that Oxman has contributed to the biodesign/bioart fields. The Oxman documentary screened during season two of the Netflix series Abstract: The Art of Design has further concretised Oxman’s status as one of the most celebrated designers currently practising in the bioart/design fields.

One of Oxman’s key textile projects is Silk Pavilion, created by The Mediated Matter Group at the MIT Media Lab, founded by Oxman. This project is relevant to this thesis as Yin et al. (2021) state “the spun silk industry is facing several problems now, including environmental pollution, low production efficiency, increased labour intensity, significant material waste, and excessive energy consumption” (p.123690) (sic). It is notable that animal rights organisations, including PETA, lobby for the humane treatment of not only animals but also insects, including silkworms, reporting that during sericulture, an astounding 6,600 silkworms are killed to make 1 kilogram of silk (PETA, 2021). Furthermore, Thomas et al. (2012) state that silk yarn production results in 6964 kg of carbon dioxide per metric tonne, 2.58 times more than polyester yarn production. Oxman’s Silk Pavilion demonstrates the potential to develop significantly cleaner methods of deriving silk fibre, an innovation that could significantly reduce the impacts of deriving silk fibres.

For the creation of Oxman’s Silk Pavilion, rather than deriving silk from silkworms in the traditional manner, which usually involves inhumanely boiling silkworms alive to extract their silk, Silk Pavilion deployed a swarm of 6,500 silkworms as living ‘biological printers’, spinning flat non-woven silk patches over a predetermined polygonal structure. At the pupation stage, the silkworms were removed, with the resulting moths able to lay 1.5 million eggs, estimated to be capable of producing a further 250 Silk Pavilions (MIT Media Lab, 2020). This project is important to this thesis as it exemplifies the potential to explore interspecies collaboration as a more humane and environmentally-friendly method of producing fibres relevant to textile design applications.

Numerous universities since the 1990s have developed biodesign courses, as previously discussed in the BC chapter, and much scientific literature concerning BC has been published in the biomedical field. However for the purposes of this thesis and where I situate my practice I am concerned with the university-led research institutions that investigate biodesign in collaboration with Creative practice fields. Central Saint Martins, under the future-thinking guidance of Carole Collet, also launched the Biodesign Fashion Masters in 2019 to promote sustainable fashion innovation (Hitti, 2019) while the University of West London also offers a biodesign course (Goodman, 2021). University of College London’s Bartlett School of Architecture and Biochemical Engineering Department combine to offer a masters degree in bio-integrated design, biotechnology, advanced computation and fabrication aimed at the creation of a radically new sustainable built environment (UCL, 2021). Biodesign Innovation is also a postgraduate program at the University of Melbourne facilitating collaborations between business, engineering students and hospital clinicians (Grayden & Lim, 2021). The continual emergence of these biodesign courses around the globe is further tangible evidence of the momentum that biodesign is gaining as a field and the corresponding development of appropriate university courses in response to growing demand in the biodesign industry for qualified practitioners able to work in this industry.

It is important to state that many pivotal published texts are exploring the biodesign field, including the previously mentioned Bio Design: Nature, Science, Creativity (2012) authored by William Myers with a supplementary section by MoMA curator Paola Antonelli, which curates and discusses numerous pivotal practitioners operating in this field. More recent high-quality publications also include The Rise of Biodesign: Contemporary Research Methodologies for Nature-Inspired Design in China (Polites, 2019) and Biodesign: The Process of Innovating Medical Technologies (Yock et al., 2015). In addition to these books, there are also numerous other public engagement formats including peer-reviewed journal articles, theses, public seminars, biodesign journalism (e.g print, online, podcasts), exhibitions and exhibition catalogues which are emerging in response to both the volume and quality of work that is being produced in the field and a corresponding public interest in the field of biodesign. While it is impossible to review and discuss every pertinent project published in this field, this chapter has provided an overview of the published projects and practitioners of most relevance to this thesis, illustrating that biodesign literature has permeated throughout all main avenues of design discourse.

BIODESIGN: A FIELD REJECTING THE PITFALLS OF DESIGNED OBSOLESCENCE

To discuss the rejection of design obsolescence observable within the biodesign field, it is necessary to consider some of the key historic design precedents which have been built upon to scaffold this contemporary discourse.

Design obsolescence is a mode of production that artificially reduces the usefulness of a product, a design method which became common practice by the late 1950s, championed by Alfred Sloan, the former CEO of General Motors, who is credited with inventing this concept to stimulate consumer spending during a depressed post World War II economy (Maycroft, 2000). In 1989, scientists Robert Frosch and Nicholas Gallopoulos co-authored a journal article titled Strategies for Manufacturing, where they stated that “waste from one industrial process can serve as the raw materials for another, thereby reducing the impact of industry on the environment” (Frosch and Gallopoulos, 1989, p.144). In this article, they coined the term ‘industrial ecology’ to describe this attitude towards materiality, a concept which I observe to be another key theme of the biodesign field. This industrial ecology concept underpins practice discussed in Section 2 exploring the potential to apply this industrial ecology concept to cellulose production, through the resource recovery of nutrient-rich food waste, used as a feedstock to cultivate BC.

Through this review, I have consistently questioned an ongoing conflict between the desire to harness nature for the creation of textile fibre, and the seemingly conflicting desire to reduce the impact on natural resources. To address this conundrum, I situate this research within the field of biodesign as I observe biodesign to be a field able to utilise creative thinking and design methods in combination with scientific methods and methodologies to create textile fibres that meet myriad requirements (e.g. functional, aesthetic, economic), whilst simultaneously prioritising a minimisation of the ecological impacts of these textile fibres on the environment.

Furthermore, I argue that the continual advances in life sciences and our consequent understanding of and ability to manipulate the expression of genes at a molecular level has provided an unprecedented opportunity for textile designers to collaborate with life scientists to fabricate textiles of environmental relevance that were not previously conceivable let alone technically possible. For example, Modern Meadow’s bioengineering of yeast to produce a leather-like material (Modern Meadow, 2021) is only technically possible due to recent advances in biotechnology, an innovation that has the potential to significantly mitigate the environmental impacts of rearing cattle. While biotechnology methods are beyond the scope of this research, it is important to state that bioengineering methods are revolutionising the way textiles are produced in the biodesign field and it is notable that the potential to use Nobel-winning CRISPR technology to genetically tailor the characteristics of BC has already begun to emerge in the literature. For example, a journal article published by Huang et al (2020) discusses the potential to genetically edit the characteristics of cellulose-producing microorganism Komagataeibacter xylinus, research which may open the potential for new textile design applications.

BIODESIGN: A BRIEF HISTORY OF PRACTITIONERS AND PROJECTS

Throughout my design career and specifically through this research, I have become increasingly aware of practitioners and companies utilising an interdisciplinary combination of design thinking, life science and material science methods to produce textiles from alternative sources that aim to reduce the ecological impact of the textile industry. Whilst reviewing, defining and discussing the key practitioners and projects in the biodesign field relevant to this thesis, I must also emphasise that biodesign is a field that is fast emerging as a megatrend. Therefore, it is impossible to create a definitive list as the field is growing exponentially. Nevertheless, I have reviewed the literature extensively and this chapter provides a synopsis of key practitioners and projects that research alternative textile fibre derivation sources utilising methods characteristic of biodesign; that is, sources other than the prevalent textile fibres currently derived from the cultivation of terrestrial plants and animals, and the extraction of petrochemicals and minerals.

Capturing and utilising pollution as a feedstock for fibre production is of specific interest to this research, as it elicits the potential to remediate the environment and reduce the ecological impact of textiles, compared to the practice of deriving fibre from virgin sources. Numerous companies are researching and developing waste-derived textiles applicable to the textile industry. For example, both Adidas and Nike collect ocean plastic waste as a raw material for the production of synthetic textile fibres while Mango Materials capture methane off-gassed from landfills utilising anaerobic digestion, all resulting in the production of regenerated synthetic textile fibres (Adidas, 2021; Nike, 2021; Mango Materials; 2021). While some interpretations of biodesign may exclude the use of petrochemicals, be they virgin or regenerated, I am including these projects as examples of the capacity to transform waste into a textile fibre, as this is a theme of strong interest to this research, as demonstrated in Studio-based Experimentation.

Additional examples include Vivobarefoot, which collaborated with The Oxygen Project to transform harmful algal blooms that choke waterways into a biodegradable shoe foam (Vivobarefoot, 2021), while Ecovative Design utilises agricultural waste as a feedstock for the cultivation of mycelium leather (Ecovative Design, 2021). Other examples include textile company Orange Fiber which utilises citrus waste (Orange Fiber, 2021), Piñatex which recovers waste pineapple leaves (Hirsh, 2019), Crabyon which uses waste meat (Swicofil, 2021), and S.Café, a textile product partially derived from coffee waste (Brones, 2017). When reviewing this biodesign textile community, I also observed many other textile designers utilising resource recovery as a method, but it is impossible to list all pertinent examples. Nevertheless, these examples I have included demonstrate how a contemporary community of textile designers are seeking alternative feedstock sources, in a bid to reduce the environmental impact of the textile industry. This method of resource recovery informed the practice-led research documented in Studio-based Experimentation.

This research also draws upon the groundbreaking work of Suzanne Lee; fashion designer, senior research fellow at St Martins and author turned biodesigner, a practitioner now situated at the forefront of interdisciplinary biodesign practice. In 2004, Lee was researching

for a book titled Fashioning the Future: Tomorrow’s Wardrobe, which questioned how textile materials may be produced for a more sustainable future (Lee, 2007). During this research Lee met biologist David Hepworth, alerting Lee to the potential to utilise cellulose-producing microorganisms to produce textiles. Lee then undertook a fashion design/life science collaboration with Hepworth as part of Lee’s academic research project, a collaboration later founded by Lee as BioCouture. This experimental biodesign project resulted in the production of a series of speculative garments utilising non-woven textiles secreted by microorganisms known to exist within kombucha culture. Lee’s BioCouture project contributed valuable discussion to what the future of textiles may look, feel and smell like. In Lee’s TED Talk she states that wearing BC is “possibly a good performance piece, but definitely not ideal for everyday wear” (Lee, 2011, 3:28), providing an insight as to why Lee never commercialised the BioCouture project beyond the speculative stage.

Nevertheless, Lee’s BioCouture project is influential to this thesis, and Lee is arguably the most famous biofashion designer, and thus this investigation into fashion and biomaterials, and more specifically the interrogation of the potential of BC cannot be undertaken without this discussion of Lee and her significant contribution to the biodesign field. Lee now represents the epitome of a fashion designer turned biodesigner, continually making valuable contributions to the field, notably through BioFabricate, an international biodesign symposium situated in New York founded by Lee, showcasing outstanding examples of innovative research utilising biologically based biodesign methods (isciencemag, 2021).

Lee later became the Chief Creative Officer at Modern Meadow, as previously discussed, which is a textile company that fabricates numerous textile products including Zoa, a pourable, non-woven textile utilising bioengineered yeast to biofabricate laboratory-based collagen. Zoa was launched at MoMA’s Items: Is Fashion Modern? exhibition curated by Paola Antonelli in 2017. Zoa is chemically and functionally similar to animal leather but can be grown in a matter of weeks rather than years. Modern Meadow states that this product has the potential to radically reduce the environmental impact of the textile industry (Modern Meadow, 2021). This innovation is important as it provides a powerful precedent of how interdisciplinary biodesign methods can be implemented to propose a reduction in the impacts of the textile industry.

In the 1990s agricultural scientist Gary Cass accidentally spoiled a vat of wine by flooding it with too much oxygen. Through this mishap, Cass claims (UWA, 2008) to have inadvertently created a method for producing a microbial fibre that floated on the air-liquid interface of the spoiled wine. Cass then collaborated with Donna Franklin on the production of Micro’be’ Fermented Fashion dress made from red wine, which has been widely exhibited, including presentations at Ripley’s Believe it or Not and the Venice Biennale Fringe Festival. In 2014, Cass launched Nanollose as a research and development company intending to produce a “low-cost eco-friendly fabric from food and beverage waste” (Papas, 2014). In 2017, Nanollose filed an international patent application relating to a method for processing microbial cellulose waste into a pulp as an alternative to plant-derived fibre. Nanollose claims this pulp can be produced utilising a method that transforms microbial cellulose waste from the liquid food industry into a spinnable yarn comparable to plant-derived rayon fibre. This yarn

can then be fabricated into a material suitable for a broad range of commercial applications including medical scaffolding, non-woven fabrics and absorbent feminine hygiene products (Barrie, 2017). Nanollose states that this processing method has the potential to become a sustainable alternative to conventional plant-derived cellulose fibres and, in so doing, proposing a method with which to revolutionise the ecological sustainability of the textile industry (Nanollose, 2021).

In 2019, Nanollose secured 5 tonnes of microbial cellulose from Indonesian food producer PT Supra Natami Utama which produces a gelatinous dessert using an Acetobacter strain of cellulose-producing microorganisms, facilitating further experimentation at an industrial scale. In 2020, Nanollose partnered with Grasim Industries, which “ belongs to an Indian company, Aditya Birla Group, worth US$48.3 billion (AUD 71.8 billion), which is one of the world’s largest man-made cellulosic fibre producers” (Simcock, 2020). In April 2021, Nanollose announced a pilot program aiming to produce up to 5 tonnes of microbial lyocell per month (Glover, 2021). At the time of writing, Nanollose is yet to make their product commercially available although they appear to be heavily engaged in the pilot-scaling of their production capacity.

Numerous companies are now producing a leather-like material using mycelium technology from fungi. Haneef et al. (2017) state that mycelium is composed of natural polymers including chitin, cellulose and proteins, resulting in a natural polymeric composite of non-woven fibre, which is non-toxic to humans and readily biodegradable. The main textile companies now developing mycelium leather include Bolt Threads, Ecovative Design and Mycoworks (Bolt Threads, 2021; Ecovative Design, 2021; Mycoworks, 2021).

There are also numerous researchers and companies exploring the potential to produce spider-silk, an arachnid-free textile fibre produced through a fermentation process. These include Cambridge researchers, Bolt Threads and AMSilk (Cambridge University Press, 2020; Bolt Threads, 2021; AMSilk 2021).

This pioneering research involves the aforementioned practitioners, numerous other scientists, practitioners and textile companies collaborating to produce environmentally sustainable textiles. While it is beyond the scope of this thesis to list every academic, industry practitioner and textile brand researching or commercially producing a sustainable textile product, I will now provide a brief company synopsis of some of the key textile research and development happening in the biodesign field.

I list these companies and products with the caveat that it is very challenging to determine whether or not some may be greenwashing the industry with outlandishly wild and scientifically unsubstantiated claims about the environmental relevance of the textiles they are producing. I infer this point to highlight that the scientific knowledge required to discern between what may be factual and what may be fictional requires a knowledge greater than a consumer or fashion designer can be reasonably expected to know. I am therefore interrogating the potential of BC with the aim of becoming an expert in this specific set of scientific knowledge. Nevertheless, it remains beyond the scope of this research to conclusively determine which companies have produced evidence-based data substantiating

the claims they make in their media releases. All entries on this list are deemed worthy of inclusion based on situating this thesis within a community of practitioners promoting the innovation of alternative fibre derivation sources. These alternative sources include using either waste or pollution as raw material, and/or using biodesign methodologies as part of their method of producing textiles relevant to the improved ecological sustainability of the textile industry.

A BRIEF HISTORY OF ALTERNATIVE TEXTILE RESEARCHERS AND COMPANIES

Table 2.1 provides a brief history of alternative textile fibre researchers and companies which are grouped by fibre type (Cellulose, Chitosan, Protein and Synthetic) and whether they are speculative research or commercially available.

This table is important to this research, demonstrating that a significant amount of alternative textiles are being researched and commercialised utilising biodesign methodologies, typically by founding members with formal training in design and or bioscience. Documented and cited in the table are key researchers and companies contributing alternatives to incumbent

textiles.

Cellulose

Algiknit is a biomaterials company who have developed a

textile fibre of the same name, which derives cellulose from

algae resulting in a machine knitted textile. Founded in 2017

Commercial

Algiknit

in the USA by Tessa Callaghan (CEO), Aaron Nesser (CTO),

Textile Fibre

Commercial

Aleks Gosiewski (COO) (Algiknit, 2021) with 30 employees

(Owler, 2021).

BioCouture is a fashion brand founded by Suzanne Lee

BioCouture

(fashion designer) in the UK in 2003. BioCouture is a

Speculative

speculative project biofabricating fashion garments utilising

Fashion

Research

cellulose produced by bacteria (Myers, 2012).

Desserto is a textile company with a textile product of the

same name co-founded by Adrián Velarde and Marte Cázarez

Desserto

in Mexico in 2019. Desserto® is a partially-biodegradable

Commercial

leather-like material derived from the leaves (cellulose from

Textile Fibre

Commercial

plants) of the nopal cactus, which can be cultivated with a

bare minimum of water (Hirsh, 2019).

Table 2.1 A brief history of alternative textile fibre researchers and companies

Cellulose (cont.)

DuPont Biomaterials is a subsidiary of the global textile

company DuPont, founded in 1802 by Éleuthère Irénée du

Pont in the USA, now with 98,000 employees (Britannica,

2021; Dupont, 2021). The DuPont Sorona® brand is a textile

made from 37% renewable and responsibly sourced plant-

Commercial

based cellulosic (corn) ingredients, which aims to reduce

DuPont BioMaterials

Textile Fibre

the environmental impact of the textile industry (Kurian,

Commercial

2004 - 2005; DuPont Biomaterials, 2021). Koller states “For

stretch use, in the U.S., Sorona can be labeled elasterell-p;

in the European Union, Elastomultiester; and in Asia Pacific,

polyester” (Koller, 2019).

Eastman is a textile company founded by George Eastman

in 1920 in the USA, now with 14,500 employees. Eastman

produces Eastman NaiaTM in collaboration with DuPont

Eastman

Biomaterials. It is a cellulosic textile fibre made from

Commercial

Textile Fibre

Commercial

responsibly sourced wood (plant-based cellulose), produced in a safe, closed-loop process. NaiaTM is biodegradable

in water and soil and can be composted industrially

(NaiaEastman, 2021; Eastman, 2021).

Malai is a textile company founded by C S Susmith (product

designer) and Zuzana Gombosova (material researcher/

designer) in Southern India in 2015, now with 10 employees.

The Malai product is made entirely from organic and

Malai

Commercial

sustainable bacterial cellulose, grown on agricultural

Textile Fibre

waste sourced from the coconut industry. Malai utilises an

Commercial

interdisciplinary approach, collaborating with experts in

microbiology, material science, chemistry and mechanical

engineering (Malai, 2021).

Nanollose is a textile company established in Australia in 2014,

co-founded by Gary Cass (Chief Science Officer) and Wayne

Best (PhD in organic chemistry) in 2014. Cass resigned from

Nanollose in 2019 and has since founded another innovative

Nanollose

Commercial

textile start-up called Cass Materials. Nanollose produces

Textile Fibre

a textile fibre product named NullaborTM, whereby BC is

Commercial

fed high-nutrient liquid waste from the coconut industry to

produce a regenerated BC yarn suitable for knitted textiles

(Nanollose, 2021).

Table 2.1 (cont.) A brief history of alternative textile fibre researchers and companies

Cellulose (cont.)

Orange Fiber is a textile company established in Italy in

2014, by co-founders Adriana Santanocito (fashion design,

textiles, materials and new fashion technology) and Enrica

Arena (International Cooperation for Development as well

Commercial

Orange Fiber

as in Communications). It produces a silk-like textile made

Textile Fibre

Commercial

from waste citrus peels (cellulose from plants). A patented

method is used to extract the citrus cellulose to spin the

yarn (Material District, 2016; Orange Fiber, 2021).

Piñatex

Commercial

Textile Fibre

Commercial

Piñatex is a textile company founded in the United Kingdom in 2013 by Dr Carmen Hijosa. They produce a non-woven leather-like textile made from cellulose fibres extracted from waste pineapple leaves (plant-based cellulose), combined with polylactic acid (PLA) and petroleum-based resin (Hirsh, 2019).

Singtex

Commercial

Textile Fibre

Commercial

Singtex is a Taiwanese textile company founded by Jason Chen, which launched a textile named S.Café in 2009. This product is derived from coffee waste, which is cleaned, ground to nanoscale and mixed with recycled synthetic fibres to create a textile (Brones, 2017). In 2014, Singtex added a new product, Sefia, which combines waste coffee grounds with wood pulp, resulting in a drapey, lustrous lyocell regenerated cellulosic textile (S.café, 2021).

Chitosan

Commercial

Bolt Threads

Textile Fibre

Commercial

Bolt Threads is a textile company co-founded by Dan Widmaier (CEO, PhD in chemistry and chemical biology), David Breslauer (CSO, PhD in bioengineering) and Ethan Mirsky (VPO, engineer and scientist). Established in the USA in 2009, they now have 100 employees (Owler, 2021). Bolt Threads produces numerous innovative textiles including MyloTM, a leather-like material fabricated with fungal mycelium. In March 2021, Stella McCartney was the first to debut Mylo.

Commercial

Evocative Design

Textile Fibre

Commercial

Ecovative Design is a textile company co-founded by Eben Bayer (CEO) and Gavin McIntyre (Director of Business) in the USA in 2007; they now have 50 employees. They produce packaging solutions and leather-like (non-woven) textiles (MycoFlexTM and ForagerTM) by feeding agricultural waste to mycelium (Ecovative, 2021).

Table 2.1 (cont.) A brief history of alternative textile fibre researchers and companies

Chitosan (cont.)

Mycoworks

Commercial

Textile Fibre

Commercial

Mycoworks was co-founded by Philip Ross (CTO, MA in Fine Arts), Sophia Wang (a PhD in English literature), and Eddie Pavlu (Masters of Engineering) in 2013, USA. Matthew L. Scullin has been CEO since October 2017 ( PhD in Materials Science + Masters) (Linkedin, 2021). (Owler, 2021) and also They have 100 employees utilise mycelium to produce a leather-like material (Fine MyceliumTM and ReishiTM) (Mycoworks, 2021).

Commercial

Swicofil

Textile Fibre

Commercial

Swicofil is a textile company that owns distribution rights for Crabyon, a textile fibre product invented by Omi Kenshi in 1997. Crabyon® is a textile fibre consisting of chitosan (derived from chitin) sourced from waste meat processing factories, specifically crab shells (5-20%) combined with viscose derived from plant cellulose. At the time of writing, Crabyon® has ceased production entirely (Post, 2014; Swicofil, 2021).

Protein

Commercial

AMSilk

Textile Fibre

Commercial

AMSilk is a German biotechnology company founded in 2008 by biochemist Lin Romer, now with 28 employees. AMSilk produces a product called Biosteel, utilising bioengineered Escherichia coli (E. coli) bacteria (protein) (Flint, 1996) to produce a silk-like biopolymer modelled on spider silk, applicable to textile applications (AMSilk, 2021; Pitchbook, 2021).

Azlon is a regenerated protein textile fibre (as per Rayon

is regenerated cellulose) mixed with acrylonitrile (a toxic

liquid used to make synthetic fibres), resulting in a wool-like

textile. First commercially released in 1936 under the brand

Azlon

name Lanital, azlon was invented by Italian chemist Antonio

Speculative

Ferretti. These fibres have since been regenerated from

Fashion

Research

numerous protein sources including peanuts, maize (zein

protein), cotton seeds and dairy products (casein protein).

Other prevalent trade names include Aralac, Fibrolane,

Merinova and Wipolan (Aziz, 2020).

Bolt Threads also produce MicrosilkTM, a silk-like textile

produced with a bioengineered yeast that undergoes

Commercial

Bolt Threads

fermentation resulting in a strong yet soft textile modelled

Textile Fibre

Commercial

on the secretions of spider silk (Bolt Threads, 2021).

Table 2.1 (cont.) A brief history of alternative textile fibre researchers and companies

Protein (cont.)

Cambridge University researchers synthesised spider silk

protein (spidroin) utilising 98% water, 2% silica and cellulose,

resulting in a fibre claiming to be stronger than steel and

Research

Cambridge University

Kevlar. It is notable that the Stella McCartney brand invested

Textile Fibre

in the development of this fibre and resultant textiles to

Research

bring this research to industry (Matchar, 2017).

Modern Meadow is a biotechnology company co-founded

by Andras Forgacs, Gabor Forgacs, Karoly Jakab and

Francoise Marga in 2011, USA. They now have 85 employees

Commercial

Modern Meadow

(Owler, 2021). They produce a product called Zoa utilising

Textile Fibre

Commercial

a bioengineered yeast through a fermentation process to

cultivate lab-grown leather (Modern Meadow, 2021).

Synthetics

Commercial

Mango Materials

Textile Fibre

Commercial

Mango Materials is a textile company co-founded by Molly Morse (PhD in Biopolymer and biocomposite engineering), Anne Schauer-Gimenez (PhD in Civil and Environmental Engineering) and Allison Pieja (PhD in Environmental microbiology), in the USA in 2010. Currently employing 68 employees, Mango Materials utilises a fermentation process to produce a textile derived from methane captured via anaerobic digestion to produce biopolymers suitable for knitting textiles (Owler, 2021; Mango Materials, 2021).

Table 2.1 (cont.) A brief history of alternative textile fibre researchers and companies

A BRIEF HISTORY OF BACTERIAL CELLULOSE IN BIODESIGN

As earlier stated in the BC review, scientific descriptions of cellulose-producing bacteria were first published late in the 19th century (Brown, 1887). Nevertheless, the potential synergies between BC, fashion and sustainable textile design were not formally published until 2004 when Suzanne Lee, fashion designer turned biodesigner, first started an interspecies collaboration with cellulose-producing microorganisms to produce speculative fashion garments. In 2007, Gary Cass was employed as a laboratory technician at the University of Western Australia, leading to a collaboration with Donna Franklin on the production of a dress made with cellulose-producing microorganisms fed with red wine (Salleh, 2007). In 2014, textile company Nanollose began developing a system for transforming coconut food waste into a regenerated textile fibre utilising cellulose-producing microorganisms, although it is yet to be made commercially available for textile design applications. Lee, Cass, Franklin and Nanollose will be further discussed in this chapter in respect to their pioneering work demonstrating the potential to use biodesign methodologies to cultivate

wearable textiles with BC.

KEY THEMES AND METHODS OF BIODESIGN

Through this review, I have observed many thematic similarities that continually appear in the community of practitioners and textile companies. These themes, which underpin the practice research undertaken during this research, include engagement, fermentation, interdisciplinarity, interspecies collaboration, mitigating environmental impacts, resource recovery and rejection of fast-fashion, all of which I will now analyse and discuss.

ENGAGEMENT

There is a key group of actors whose interrelated theories, speculative artefacts and resulting public engagements align with my motivations and have proven highly influential to this research. These key actors include fashion/biodesigner Suzanne Lee, architect/ biodesigner Neri Oxman, bioartist Donna Franklin, bioart/biodesign collaborative duo Ionat Zurr and Oron Catts curator Paola Antonelli, design historian/curator/author William Myers, theorists Carole Collet and Kate Fletcher, and philosopher Slavoj Zizek. These actors all publish engagements that break us free from the archaic shackles of neo-liberal myopia, generating the fabrication of new and environmentally alternative design paradigms. These are alternative paradigms that do not further advocate the exploitation of the Earth’s ecosystems to produce design products that prioritise the lives of humans, at the expense of all other living systems.

As discussed, often the publishing of this theoretical and speculative work is crucial in creating a foundational precedent for a new method of creating fibre, which is later industrialised by textile companies. Speculative biodesign projects also play a critical role in creating discursive dialogue around the importance of changing the lens through which

we view, engage and dispose of textiles. For example, the prevalence of bacteriophobia (broadly referring to any microorganism which causes disease), may initially prevent some consumers from engaging with textiles produced by bacteria. This is remedied by public engagement such as Lee’s Ted Talk on the potential of bacterial fashion, which articulately communicates the potential and qualitative value of this alternative fibre production method. Lee’s engagement is an important public precedent mitigating the irrational fear associated with bacteria, thus enabling industry adoption of BC by startup companies such as Nanollose more achievable.

Another practitioner who continually contributes value to public engagement in biodesign is Carole Collet, Professor in Design for Sustainable Futures at Central St. Martins. In 2012, Collet published BioLace: An Exploration of the Potential of Synthetic Biology and Living Technology for Future Textiles, a design-led project investigating the intersection of synthetic biology and textile design (Collet, 2012). Although the project was speculative, Collet’s theoretical concept that textile crops could be bioengineered to weave textiles from the roots of the plants was hugely thought-provoking, and although I’m yet to observe this impact the textile industry directly, I would not be surprised by bioengineering interventions of this magnitude emerging in the future. BioLace is highly influential to this thesis as it contributes valuable discussion to the lens through which we view textile design, and alludes to how this lens may be refocused to address key sustainability challenges in the 21st century.

Diana Sherer is another practitioner situated in the biodesign field whose project titled Exercises in Root System Domestication (Sherer, 2020) iterates Collet’s BioLace project, through an exhibition of artefacts that explored the potential to cultivate plant roots in moulds resulting in biomaterials. Sherer’s project is important as it goes beyond the speculative and offers the added benefit of existing in practice.

In addition to the aforementioend projects by Collet (speculative) and Sherer (actualised), Alexandra Daisy Ginsberg is another leading practitioner who explores hypothetical futures, positioning her creative practice at the nexus between art, design and genetically modified synthetic biology. Ginsberg’s oeuvre explores the relationship between the natural environment and technology, having also speculated on how synthetic biology may influence textile design whilst presenting a guest lecture at the Textile Futures Research Centre at Central St Martins. (Ginsberg, 2021). In 2018, Ginsberg coauthored an article with bioartist Natsai Audrey Chieza titled Other Biological Futures, discussing the design of living matter and its potential implications. Chieza is also a bioartist of great interest to this research in her own right, exemplified by her practice of utilising bacterial cultures such as Streptomyces coelicolor to dye textiles (Ginsberg and Chieza, 2018).

As evidenced by these industry examples, the potential of public engagement is a powerful method of design communication, and consequently, engagement has been a key theme explored throughout my candidature, resulting in numerous public presentations of research in progress including Life & Death (2020), a group exhibition during NGV Melbourne Design Week; two biodesign panel discussions at MPavilion (2020 and 2021); Play (2021), a group exhibition during the MONA FOMA festival; and Future U (2021), a group exhibition at RMIT Gallery. Documentation of these public engagements is included from figures 3.52 to figure 3.65 of this thesis.

FERMENTATION

As previously discussed in the BC chapter, fermentation is a method central to this research and is a proven method industrialised in numerous fields for manufacturing commercial products. These products can currently be defined in three main groups; food products (e.g yoghurt, alcohol, cheese), industrial chemicals (e.g. acetone, butanol, ethanol; enzymes; amino acids) and speciality chemicals (vitamins, pharmaceuticals) (Chojnacka, 2010).

This thesis identifies these other fields as precedents of industrialisation, to scaffold the argument that significant potential exists to add a fourth major group of fermentation products, that being the production of environmental textile products, as evidenced by the multiple practitioners in the field including the speculative artefacts of Suzanne Lee, Cass and Franklin, and startup textile companies including Bolt Threads, Mango Materials, Modern Meadow and Nanollose, all of which rely on fermentation methods to produce textiles.

INTERDISCIPLINARY COLLABORATION

Interdisciplinary is defined by the Merriam-Webster dictionary as “involving two or more academic, scientific, or artistic disciplines” (2021, p.1) while the same source defines collaboration as “ working jointly with others or together especially in an intellectual endeavour” (2021, p.1). As earlier stated, interdisciplinary collaboration is a key theme identified in this field and Myers’ book Biodesign, Antonelli contributes a foreword titled Vital Design, stating “These novel collaborations are often joyous contaminations in which scientists feel, even just for a moment, liberated from the rigour of peer review and free to attempt intuitive leaps”(Antonelli, 2012, p.6). Antonelli’s statement highlights both the value of interdisciplinary collaboration between design and science and the value of publishing scientific research outside scientific journals, both themes that are highly relevant to this thesis. This practice is further exemplified by the combination of designers, scientists, engineers and business people as founding members of key textile companies in the biodesign community (e.g. Algiknit, BioCouture, Bolt Threads, Modern Meadow). The value and relevance of interdisciplinary collaboration to this thesis will be further discussed in Section 2 where I discuss my collaborations with both scientists and scientific methods.

INTERSPECIES COLLABORATION

Another key theme I have observed is that of biodesigners engaging in interspecies collaborations, which prioritise a rejection of the traditional model of terminating a natural system before applying it as a design material, preferencing the potential to collaborate with living systems. Interspecies collaboration connects with the stance of Oliver Kellhammer, who lectures in Sustainable Systems at Parsons School for Design. Kellhammer contends that “By considering the subjective lives of non-human organisms to be as valid as our own, we open ourselves up to a richer, more engaged relationship with the biosphere with

the potential to undo some of the damage our pervasive anthropocentrism has inflicted.” (Kellhammer, 2017, p.1). Kellhammer’s position advocates a shift from viewing natural systems as resources for us to exploit, to that of natural systems as collaborators that are afforded the respect we assign to human collaborators. This stance is further supported by Daphne Mohajer va Pesaran, a fashion designer and academic who published a paper titled Interspecies Collaborative Design, exploring concepts of how design may contribute to interspecies collaborative design (Mohajer va Pesaran, 2017).

There are various notable examples of practitioners in the biodesign community publishing works that exemplify this theme. For instance, Oxman’s Silk Pavilion, which utilises live silkworms as collaborators, rejecting the traditional model of killing the silkworms to extract their fibre; Franklin’s speculative Fibre Reactive dress which builds ornamentation and thus qualitative value through the use of living mycelial technology fashioned into the shape of a living dress; also Zurr and Catts, whose Victimless Leather Jacket exhibited the speculative potential for living tissue to be a textile of the future (Rotkop, 2008). These examples are all important precedents to this thesis, which also explores the potential of interspecies collaboration to produce living textiles, a mode of practice further demonstrated and discussed in Studio- and Laboratory-based Experimentation.

MITIGATING ENVIRONMENTAL IMPACTS

I consistently observe actors in the biodesign community to be linked thematically through the utilisation of natural systems to produce textiles of less environmental harm. As previously evidenced in this chapter, numerous textile practitioners and companies are engaged in practice exemplifying this theme and I observe there to be a consistent dialogue in the biodesign community regarding the desire to alter the textile industries exploitative relationship with natural resources (Fletcher, 2007), preferencing a shift towards a new textile relationship that harmonises with natural systems. For example, practitioners I have discussed in this chapter are developing systems to capture waste and pollution, and transform these materials into regenerated textile fibre, thus reducing the impact of natural resources (e.g. Mango Materials, Nanollose, S.Cafe). Also, practitioners, pursuing methods to radically lower the use of toxic chemicals, water use and land use, are making valuable contributions to environmental impact mitigation (e.g. Modern Meadow, Bolt Threads, Ecovative Design). The potential to mitigate the environmental impacts of textiles utilising BC production methods is further explored in Section 2 through experiments that use resource recovered waste as a feedstock, do not require additional energy, toxic chemicals, and can be efficiently biodegraded by cellulose-metabolising fungi at end of life.

RESOURCE RECOVERY

Resource recovery is capturing waste to reduce the environmental impacts and economic cost of production (e.g. Crabyon, Ecovative Design, S.Cafe, Pinatex). Similarly, pollution recovery is another method of reducing impact and cost (e.g. Adidas, Nike, Vivobarefoot, Mango Materials). This theme links directly to this thesis in resource recovery, as a feedstock for BC production, explored as a key method during Studio-based Experimentation.

REJECTION OF FAST FASHION

Contemporary neoliberal values oppose previous incarnations of textiles that celebrated longevity in materials, excellence in workmanship, bespoke tailoring and timeless design aesthetics. Through this research, I have interrogated the works of many inspiring fashion practitioners and commentators who advocate a shift in the way fashion is designed, consumed and produced. These values are reemerging, exemplified by the oeuvre of fashion sustainability pioneer, design activist, writer, research professor and theorist Kate Fletcher. Fletcher is credited with coining the term ‘Slow Fashion’ which rejects the relevance of the fast fashion phenomenon, referencing Petrini’s ‘Slow Food Movement’, similarly calling for both a slowing down of consumption and an increase in quality to a greater appreciation of the value of consumer products (Fletcher, 2018). The Pulse Report conducted a study on the most critical environmental, social and ethical issues (Global Fashion Agenda, 2017). Fletcher critiques and rejects the report as a technocentric approach to fashion:

“They fail to deal with the reality of biophysical limits and their incompatibility with the logic of growth. They fail to acknowledge that efficiency improvements lead to more, not less, resource use. They fail to recognise that beyond a minimal level of consumption, increasing material goods and materialistic attitudes actually damage, not improve, human well-being.” (Fletcher, 2018, p.1).

Furthermore, a key project of Fletcher’s is a chapter titled The new synthetics: could synthetic biology lead to sustainable textile manufacturing? which is featured in a book titled The Routledge Handbook of Sustainability and Fashion. For this work, Fletcher collaborates with co-editor Mathilda Tham. Tham is a Professor in Design at Linnaeus University and has a long history as both a fashion designer and as an academic researching new ways of engaging with fashion. Fletcher and Tham state “the fashion industry is also a significant contributor to the degradation of natural systems, with the associated environmental footprint of clothing high in comparison with other products” (2015, p.209).

These views of Fletcher and Tham represent an academically rigorous recognition of the significant impacts of the fashion and textiles industries, illustrating their motivations to inspire both a slowing down in the consumption of fashion and textile products and also a seismic shift in the way these products are designed (Fletcher and Tham, 2015). These views align well with the biodesign principles explored in this thesis, as a reduction in consumption and a shift in the way textiles are designed are both key interest areas, topics further explored in the practice component of this thesis.

In addition to the key themes of biodesign already discussed in this chapter, this thesis also stands with numerous other non-anthropocentric theories that stress the importance of interspecies connectedness including animism, biocentrism, biofeminism, the biophilia hypothesis, bioregionalism, deep ecology, ecocentrism, environmental ethics, the overview effect, left-biocentrism (or ecofeminism) and localism. While it is beyond the scope to properly discuss all themes individually, it is notable that there are myriad theoretical

frameworks that align with both the field of biodesign and this thesis specifically.

BIOREGIONALISM

Nevertheless, I will discuss the potential of bioregionalism, as although I do not observe bioregionalism to currently be a theme central to biodesign, I argue that a shift towards practical implementation of this theory could radically reduce the impacts of textiles.

Bioregionalism is defined as “a social movement and action-oriented field of study focussed on enabling human communities to live, work, eat and play sustainably within Earth’s dynamic web of life” (Pezzoli, 2020, p.25). I acknowledge that I partially base this argument on anecdotal evidence during my 25 years of experience working in the fashion and textile industry, over which time I observed it to be commonplace for textile fibres to be grown, processed, consumed and even disposed of in separate countries.

Presently, while the main concentration of the textile industry is limited to China, India, Russia and the USA, the entire industry is spread over 90 countries (Chand, 2021) and thus a significant opportunity exists to produce textiles within bioregional borders. For example, India is the most prevalent cotton cultivator (Shahbandeh, 2020; Vinodkumar et al., 2017), China is the most prolific processor of cotton fibre (Chand, 2021), while cloth production is also prevalent in numerous other countries including Russia, the USA and Japan. The resultant textile impacts are further exacerbated through the prevalence of global distribution channels, over-consumption by consumers (Fletcher, 2007) and a lack of infrastructure available for the safe disposal and regeneration of post-consumer textiles, factors that aggregate to a huge amount of carbon miles for each fibre. While it has been challenging to locate theorists able to substantiate these observations specifically in regards to textiles, I contend these to be common industry practices. To address these interrelated impacts, this thesis stands with Allen Van Newkirk and his advocacy of Bioregionalism: the belief that human activity should be largely constrained by ecological or geographical boundaries rather than political trading boundaries. Bioregionalism was initially coined in 1975 by Newkirk, founder of the Institute for Bioregional Research, given currency by Peter Berg and Raymond Dasmann in the early 1970s, and has since been advocated by writers including David Haenke and Kirkpatrick Sale. The bioregionalism perspective opposes a homogeneous economy and consumer culture that lack sustainable stewardship towards the environment (Alexander, 1996).

This concept of bioregionalism is important, as to create meaningful ecological change in the textile industry, I argue that the production, consumption, disposal and regeneration of textiles within bioregional boundaries would radically reduce the overall carbon footprint of textiles. This argument is supported by fashion writer Meike Schipper who states “the key is to develop and choose materials that are flourishing in the climate of the region and fit our specific needs” (Schipper, 2019, p.1). This bioregional theory underpins an argument I earlier discussed in the BC chapter that a species of cellulose-producing bacteria should be chosen based on the climate of the bioregion, to reduce the impacts associated with maintaining an optimal cultivation temperature. In the practice component of this research, I discuss the potential to recover local waste as a feedstock, cultivate BC in my studio, apply the resultant materials to design applications, and efficiently biodegrade these materials at end of life, within a very localised bioregion.

CONCLUSION

This chapter reviewed an emergent community of biodesign practitioners underpinning the studio and laboratory-based practice undertaken during this research. Through situating my research within the nascent field of biodesign, I align my methodological framework within an emergent community of interdisciplinary bioartists, biodesigners, scientists, authors, curators, and theorists whose practice extend the boundaries of what may constitute near-future textiles. The subsequent Studio-based Experimentation chapter documents and describes the practice undertaken during this research.

SECTION 2: Practice-based Experimentation And Reflections

In the conference proceedings of Everything and everybody as material: beyond fashion design methods, co-editors Thornquist and Bigolin asked “Should the

designer lead the material or is it the other way around?” (2017, p.4). This section

of my thesis explores this provocation as I journey between leading materials

through studio-based design, and being led by materials through science and

laboratory-based experimentation.

This section discusses and documents the Studio and Laboratory-based Experimentation undertaken during the practice component of this research, underpinned by key themes identified in the Community of Practice chapter

such as resource recovery, DIY microbiology methods, mitigating environmental

impacts of textiles and the relevance of public engagement.

Laboratory-based Experimentation describes the protocols for a suite of

scientific tests undertaken in a laboratory setting that sought to identify and

isolate a specific species of cellulose producing microorganism, establish the

cultivation parameters, characterise the material properties of the resultant

biomaterials and determine the efficiency by which cellulose metabolising fungi

can biodegrade these biomaterials at end of life.

The final chapter of Section 2, Reflections, explores what this practice

experimentation meant and why it is important to the research as a whole,

reflecting upon studio- and laboratory-based experiments undertaken to produce

textiles with microorganisms, and discussing how these projects have irreversibly

transformed my practice from a fashion designer to a biodesigner and biodesign-

translator. Through this candidature, the inadvertent ‘mastery’ that emerged was

my ability to adapt to the language and methodology of science and scientific

procedures and apply these to design problems as further discussed in the

subsequent chapters of this section of the thesis.

CHAPTER 3

Studio-Based Experimentation

This chapter documents and describes my studio-based biodesign experimentation, underpinned by key themes identified in the Community of Practice chapter such as resource recovery and engagement. This chapter documents these experiments, designed to both lead and be led by the characteristics of cellulose-producing bacteria Komagataeibacter xylinus, a bacterium known to live in kombucha as discussed in the BC chapter. Also included are anecdotal observations of the cultivation process leading into the next chapter, Reflections, which discusses what these experiments mean to the thesis.

Experiments focus on the cultivation of cellulose utilising the ‘static’ method, variations of the cultivation parameters identified in the BC literature review, and manipulation of the resulting BC with surface modification methods, utilising my tacit knowledge of textile design. These tests determine how cultivation and processing variables impact the potential design applications of BC utilising the static method. All experiments utilising resource recovered waste were locally sourced, underpinned by bioregional principles discussed in the Community of Practice chapter.

BACTERIAL CELLULOSE CULTIVATION, DEHYDRATION AND OBSERVATIONS

To produce BC using the static method, 1 L of water is boiled to dechlorinate water, as chlorination reduces bacterial ability to form successful colonies due to its bactericidal capability (Kotula et al., 1997). Half a cup of sugar is dissolved, and 4 black tea bags are steeped in the boiled water, cooled to ± 30 ˚C then inoculated with K. xylinus, which reproduces exponentially, and thus any amount of live culture will colonise a growth medium. A larger amount of inoculant increases the rate of reproduction and mitigates the risk of airborne contaminants colonising the growth medium. A lid is placed on the growth tank to further mitigate contaminants, maintaining a gap for aerobic respiration. Unless K. xylinus is sufficiently oxygenated, it moves into stasis, and if deprived of water or nutrients for a prolonged period, may die completely.

A BC film forms at the air-liquid interface (figures 3.0 - 3.1) and when BC has matured sufficiently (subject to application), the pellicle is removed from the medium and air-dried (figures 3.2 - 3.3), fully dehydrating over ± 7 days at ambient temperatures (figure 3.4). Dehydration can be accelerated utilising an oven or vacuum cupboard, both adding energy to the process and thus an ambient room temperature (± 21 ˚C) is optimal. In many respects, the fully dehydrated BC is similar to handle as leather (protein), although BC is a three-dimensional matrix of cellulose nanofibres that self-organise into a biomaterial as observed via scanning electron microscopy (SEM) (figures 4.5 - 4.7), further discussed in Laboratory-based Experimentation.

Figure 3.0 Profile view of pure K. xylinus forming a pellicle at the air-liquid interface.

Figure 3.1 Aerial view of BC forming a thick layer of BC at the air-liquid interface. 30cm x 40cm

Figure 3.2 First successfully dehydrated bacterial cellulose pellicle. Diameter 20 cm. March 15, 2019.

Figure 3.3

Assorted BC pellicles air-drying. 40 cm x 30 cm each.

Figure 3.4

Large BC pellicle air-drying. Diameter 80 cm.

Figure 3.5 Assortment of dehydrated BC pellicles. Petri dishes on top row: 8 cm diameter. Larger rectangular pellicles ≈ 40 cm x 30 cm each.

As discussed in the BC chapter, the cultivation period significantly impacts the characteristics of the resultant BC. Experiments were conducted from 7 to 70 days (figures 3.6 - 3.10) to determine how the cultivation period altered the material properties and thus the potential design applications.

Figure 3.6 7 day cultivation; pale, paper-thin and soft. 8 cm in diameter.

Figure 3.7

14 day cultivation, slightly thicker and becoming more opaque. Detail of 8 cm in diameter pellicle.

Figure 3.8

42 day cultivation. Detail of pellicle that is 8 cm in diameter.

Figure 3.9

56 day cultivation.

Detail of pellicle that is 8 cm in diameter.

Figure 3.10

70 day cultivation.

8 cm in diameter.

BACTERIAL CELLULOSE WITH RESOURCE RECOVERED FEEDSTOCK

As discussed in Community of Practice, resource recovery is a key theme of biodesign underpinning studio-based practice experiments interrogating how local waste can be recovered and used as feedstock for the cultivation of BC to potentially reduce impacts.

I conducted an audit of the nutrient rich waste that was accessible to me, whilst conducting research from home, in and out of lockdowns and movement restrictions in Melbourne. I then referred to the literature to ascertain which of the available waste products may contain suitable nutrients and minerals that may be suitable as feedstock for the bacteria I was cultivating. I tested these particular waste streams as they all seemed likely to provide the necessary sustenance for K. xylinus to secrete cellulose.

These experiments helped me understand how BC properties may substantially differ with various feedstocks, as both aesthetic quality and material handle were observed to be significantly altered. These artefacts became important resources for my engagement projects, further discussed in Reflections. I will now discuss the main resource recovery experiments conducted utilising food waste. For each experiment conducted with food waste, I exchanged an equivalent volume of sugar (half a metric cup) and tea (four bags) for one cup of food waste blended into a fine pulp. These recipes are tabulated in the Appendices, titled “Food Waste Experiment Recipes”. To obtain a fine pulp, I blended the food waste for 5-10 seconds, using a standard domestic Nutribullet (model NB-201), operating on a 900 watt motor with cyclonic action, information gained from the product specifications. There are no settings on this processor, simply on and off. It was necessary to blend the food waste to a fine pulp to ensure the available vitamins and minerals could be suspended in liquid, to provide the cellulose secreting bacteria with a nutrient rich environment within which they were able to metabolise the available food necessary for cellulose cultivation. Once the growth medium had cooled to 30 ˚C each test was inoculated with one teaspoon of K. xylinus, cultivated at room temperature (≈ 21 ˚C) and harvested after 30 days.

Adding garlic peels resulted in a very thin and brittle pellicle measuring 0.3 mm in thickness, exhibiting peculiar surface characteristics observed to be powdered cellulose fragments that were subsumed (but not metabolised) by the BC matrix (figure 3.11). FTIR analysis of garlic skins indicated the presence of sulphur compounds, carbohydrate content of 26.58% and cellulose content of 18.62% (Sugave, 2014). Sulphur is known to be anti-microbial, but despite the bactericidal risk of sulphur, the percentage of carbohydrates provided enough energy for cellulose production. Banana skin produced a highly robust pellicle (figure 3.12), presumably due to the high carbohydrate and mineral content including magnesium, phosphorus, potassium and sodium (Osma et al., 2007).

Figure 3.11

Figure 3.12

BC utilising Allium sativum (garlic) peels as feedstock.

BC pellicle utilising Musa acuminata (banana) skin as feedstock.

8 cm in diameter.

Detail of 8 cm in diameter pellicle.

One cup of mouldy waste blueberries was recovered and boiled for 20 minutes, a period described in the literature that is known to kill most contaminant bacteria growing on them, cooled to room temperature, and inoculated, forming BC with a blue/violet hue (figure 3.13). The grapefruit peel experiment was contaminated during cultivation (figure 3.14), yet the fully dehydrated BC pellicle was seemingly unaffected, resulting in a notably orange-hued pellicle (figure 3.15). Both orange and grapefruit peel feedstock resulted in pellicles with more rigidity than the standard recipe, perhaps because of the crystalline phenolic compounds known to reside in citrus peels (Rafiq et al., 2018). Barley grain feedstock produced a compelling golden-hued pellicle. As this test dehydrated during excessively hot weather, the semi-blended barley grains indented upon the growing pellicle, creating a peculiar surface morphology (figure 3.61).

Figure 3.13 BC pellicle utilising Vaccinium species (blueberries) as feedstock. 8 cm in diameter.

Figure 3.14 Contaminated BC utilising Citrus ×paradisi (grapefruit) waste as feedstock. 8 cm in diameter.

Experiments undertaken with liquid waste did not require food processing as the nutrients were already dissolved in liquid. The urine test resulted in a notably yellow (figure 3.16) and flexible pellicle with an astringent stench and wine lees resulted in a violet-hued very thin pellicle 0.3 mm in thickness (figure 3.17) highly similar in colour and tensility to the blueberry experiment.

Figure 3.15 BC cultivated with grapefruit peel as feedstock (after dehydration). 8 cm in diameter.

Figure 3.16

BC pellicle utilising urine as feedstock. 40 cm x 30 cm.

Figure 3.17 BC pellicle utilising waste wine lees as feedstock. Detail of 8 cm in diameter pellicle.

BACTERIAL CELLULOSE CULTIVATION AT A LARGER SCALE

Having successfully cultivated multiple BC pellicles up to 40cm x 30cm (figure 3.18), I extrapolated these methods to cultivate a larger pellicle (220cm x 100cm). Initially, this pellicle grew successfully before becoming contaminated by airborne contaminants (figures 3.19 - 3.20). Overall, scaling was an onerous research process due to the numerous limitations of the studio-based method, but the potential for scalability remains, as evidenced by the large pellicles grown by industrial kombucha breweries.

Figure 3.18

Successfully cultivated large BC pellicle

40 x 30cm.

Figure 3.19

BC experiment at scale contaminated by airborne contaminants. Detail of pellicle 220 cm x 100 cm.

Figure 3.20 Detail of a large scale BC experiment contaminated by airborne contaminants. 220 cm x 100 cm.

This experiment sought to grow a BC pellicle 220 cm x 100 cm but was contaminated during cultivation and had to be abandoned. It is challenging to pinpoint precisely why this contamination occurred but here is my analysis. Because of the scale, the BC produced far more acetic acid vapour, which meant that I needed to keep the windows permanently open, both for my comfort and safety, and that of my neighbours. My studio is subjected to a lot of wind, and this experiment experienced unusually strong north-westerly desert winds, which blew a lot of sand and debris into my studio, some of which entered the growth tank and contaminated the experiment. I returned to the literature to determine if this contamination could be mitigated, spraying contaminated areas with bleach and cutting out contaminants with a sterilised scalpel. As the contaminants spread, it became evident the pellicle was not salvageable, and it was a challenging process to dispose of such a large pellicle, which was by now releasing a significant stench. As BC holds 99% water during cultivation, it was too heavy and slippery to pick up and so it was dissected into sections for disposal. This experiment was successfully metabolised into the compost ecosystem within a month. Setting up and managing this experiment took weeks, and the contamination was frustrating, but I remain confident pellicles can be cultivated at this size, so long as the environment is more sterile, such as a laboratory or an industrial-grade kitchen. However, like previous errors or unsuitable outcomes, the need to dispose of the large pellicle through my composting system led me later to set up a laboratory experiment

on quantifying the rate of decomposition of BC against other cellulose samples.

BACTERIAL CELLULOSE RESOURCE RECOVERY AS RAW MATERIAL

I corresponded with a kombucha brewery that donated 30 large pellicles that I was able to recover as waste (figures 3.21 - 3.25). I aimed to recover large homogenous pellicles facilitating the production of larger experimental design artefacts but due to the arduous nature of recovering BC at this scale, the pellicles were torn into smaller, less usable segments. Nevertheless, having an abundance of BC materials facilitated small-scale artisanal experiments including cutting, weaving, crocheting and knitting which proved important for public engagements, as documented later in this chapter.

Figure 3.21 Industrial BC pellicle cultivation in kombucha brewery. Detail of wet pellicle 2 cm thick x 80 cm in diameter.

Figure 3.22 Numerous 500 L tanks of industrial kombucha growing in industry. These tanks are stacked 6 m high on shelves.

Figure 3.23 BC waste recovered from kombucha brewery in transit for dehydration.

Figure 3.24

BC waste recovered from kombucha brewery dehydrating on Hills hoist.

Figure 3.25 Detail of BC resource recovered BC dehydrating on Hills hoist.

TEXTILE SURFACE MODIFICATION

Studio-based experimentation was undertaken with artisanal techniques as documented below and discussed in Reflections. In the book Principles of Textile Finishing, Choudhury (2017) defines textile finishing as “the ultimate appearance and aesthetic properties of textile material” (p.1). Furthermore, Reay et al. (2013) state that textile finishing processes “comprise washing, bleaching, dyeing and coating, as applied to bulk textiles or garments following weaving and/or production of synthetic materials. These are energy-intensive and use large amounts of water that is generally discharged as effluent” ( p.349).

Bacterial cellulose can be cultivated in studio-based practice to a predetermined size, thickness, and shape, conferring the advantage of applying textile finishing techniques to only the area of the textile that will be used, thus mitigating impacts. Textile surface modification experiments were undertaken to determine how these techniques may alter the qualitative and quantitative values of BC including appearance, handle, transparency and hydrophobicity, and thus potential design applications. These techniques include bleaching, oiling, painting, perforating, waxing and weaving as documented later in this chapter. Further modification opportunities lie in the potential to vary the cultivation parameters including period, feedstock and interspecies collaboration (figures 3.26 and 3.51), methods that may also work in combination with the aforementioned post-cultivation textile surface modifications.

A primary issue with BC is the lack of hydrophobicity. If a dehydrated pellicle is exposed to atmospheric moisture it will quickly rehydrate. To use BC for vegan-leather type applications, it will be necessary to apply coatings to the surface, potentially negating the possible environmental benefits of growing BC in the first place. Whilst experimenting with growing pellicles a new form of interspecies hydrophobicity was developed via the inadvertent colonisation of BC with a fungus (mould), which created a hydrophobic coating on the surface of the BC, identified through subsequent lab work as Penicillium glabrum (figure 3.27). This discovery garners possibilities for future research by utilising different species of microorganism to create BC pellicles with new qualitative and quantitative values provided that the fungus does not utilise the BC.

It was my intention to see how variations in the cultivation parameters and textile finishing techniques may impact the material properties of the BC I cultivated and artisanally finished, but due to Covid-19 travel restrictions I was not able to carryout the laboratory- based material testing I had planned to undertake. Therefore, in some instances, it was necessary to use qualitative terms in lieu of empirical laboratory-based analysis.

APPLICATIONS: OBSERVATIONS OF STUDIO-EXPERIMENTS

Through this studio- and laboratory-based BC experimentation I hold the position that the static method of BC production is not well suited to wearable design applications as BC is too reactive to atmospheric contamination to be a practical alternative to any of the current forms of cellulose derivation. Nevertheless, I do argue that BC has the potential to be applied to interior design applications, as BC exhibits stability when the temperature hovers around 21°C. For example, it may be possible to further develop BC for ambient lighting, cushion covers, upholstery, book covers or screens.

An airborne insect colonised a BC pellicle mid-dehydration formed larvae and began metabolising the cellulose (figure 3.26). This accident suggested the potential to create an experiment utilising known cellulose-metabolising organisms to inoculate a BC pellicle, to produce decorative and or functional changes to BC materials with lower environmental impacts. It was outside my scope to pursue yet another interspecies collaboration; nevertheless, this may be a very interesting, and potentially ecologically sustainable way, of creating aesthetic and/or functional patternation on BC.

Figure 3.26

BC pellicle partially metabolised by unidentified larvae. Detail of pellicle 40 cm x 30 cm.

WAX FINISHING

Due to BC’s susceptibility to atmospheric fluctuations, the static method of producing BC results in textiles that are unlikely to be suitable for wearable applications. Nevertheless, the potential exists to apply non-toxic finishes such as oil and wax to stabilise BC for non- wearable homeware applications that do not need to withstand the rigour of being worn and washed regularly.

To combat BC’s hygroscopicity, I conducted experiments to reduce the hygroscopic characteristic of BC. I placed melted wax onto the BC and observed that BC became less susceptible to atmospheric fluctuations, resulting in the material becoming hydrophobic. This method also enables BC to become more stain-resistant.

Recovered waste soy candle wax was placed directly onto the pellicle in large chunks, covered with brown waste paper (to protect the iron and prevent sticking), and heat-set onto the pellicle using a domestic iron on the coolest nylon setting (≈ 110 ˚C) for approximately 30 seconds, until it was apparent that the wax had melted sufficiently (figure 3.28). Red, biodegradable paraffin wax waste was recovered, melted and coated onto BC, resulting in a hydrophobic surface (figure 3.29). In all tests, the wax bonded thoroughly onto the BC pellicle surface creating a hydrophobic surface. Waxed pellicles exhibited more stability compared to non-wax treated pellicles controls. That is, the wax dramatically reduced BCs susceptibility to changes in climatic conditions, indicating this may be a technique worthy of further exploration for homeware textile applications.

Figure 3.28 Recovered soy candle wax heat set onto BC. Detail of 8 cm in diameter pellicle.

Figure 3.29 Red wax waste (recovered from banana peel wax tip) heat set onto BC pellicle. Detail of 8 cm in diameter pellicle.

MOULDING

Experiments were undertaken to explore the potential of hydrated BC to mould around three-dimensional objects during dehydration. A BC pellicle was massaged to mould to the surface of asphalt (figure 3.30), dried over a foam head form, resulting in a permanently curved form (figure 3.31) and moulded over a mannequin form during dehydration (figure 3.32, 3.33). This moulding method may be used for applications that require a curvaceous shape, where it is advantageous not to have a seam, such as a lampshade.

Figure 3.30

BC pellicle moulding to the surface morphology of asphalt. 40 cm x 30 cm.

Figure 3.31 BC pellicle was moulded over a foam head during air-drying resulting in a permanently curved shape. 20 cm in diameter.

Figure 3.32 40 cm x 30 cm BC, moulding over a mannequin.

Figure 3.33

Various BC pellicles measuring 60 cm x 30 cm, drying over a mannequin.

CROCHETING AND KNITTING

For both the crocheted and knitted samples, 5mm strips of BC were hand-cut and hand- twisted (figure 3.34). A crocheted BC sample was produced (figure 3.35). A defining characteristic of hand crocheting is that its geometric complexities and also the three- dimensional potential of hand crocheting can not yet be achieved with ‘machine crocheting’, as only two-dimensional crochet stitches can be mechanically achieved with a warp knitting machine. On this basis, crocheting BC does not offer the industrial potential of machine knitting, although there could be potential for a niche industry utilising hand crocheting methods.

Figure 3.34 Hand-cut and hand- twisted strands of dehydrated BC pellicle. Each strand is ≈ 4 mm in thickness.

Figure 3.35 BC pellicle dehydrated and cut into ≈ 4 mm yarn, twisted and crocheted into a 7 cm diameter biomaterial.

A small hand-knitted BC sample was successfully produced (figure 3.36). In future iterations of this test, it should be possible to laser-cut the strips of BC to reduce the manufacturing time. At this stage, it would not be advisable to try and machine knit this material, as it is likely the strips would not be long or homogeneous enough to withstand the rigours of machine knitting. That said, as discussed in Community of Practice, Australian textile company Nanollose has developed a method of dissolving BC, and wet spinning it into regenerated BC yarn that is suitable for knitting and weaving.

Figure 3.36

BC pellicle dehydrated and cut into 4 mm wide yarn, twisted and knitted into a 8 cm x 3cm biomaterial.

TENSILE STRENGTH

Extending the cultivation period increases BC’s tensile strength, and can be increased further by compositing BC with other polymers. An experiment was conducted exploring the potential of augmenting BC via the addition of a composite material. An artefact was produced by harvesting two pellicles, between which a layer of plastic orange bag waste was placed. As the two BC pellicles dehydrated, they self-adhered around the plastic mesh, forming one stable composite pellicle with interesting surface detailing and a much higher level of tensile strength, without the need for additional glue (figure 3.37)

Figure 3.37 BC pellicle reinforced with plastic orange bag mesh textile waste. Detail of 8 cm in diameter pellicle.

The problem with this method is that the plastic layer will preclude the textile from being easily biodegraded by cellulose-eating fungi (as proven experimentally in the laboratory- based section of this thesis). Nevertheless, if plastic mesh orange bags continue to be a readily available form of local waste, there may still be value in upcycling the waste, before it is eventually sent for recycling. That is, the mesh can still be recycled after the BC has been biodegraded in a two-step recycling process.

This method may be applied as the submerged mesh morphology is visually compelling, whilst also resulting in a thicker, stronger and more opaque biomaterial. This method may be relevant for applications requiring an increased level of strength in combination with the natural absorbency of BC, such as the lining of a shoe or a reusable shopping bag.

WEAVING

Two wet pellicles were sliced into 10 mm wide strips and handwoven, self-adhering to themselves (figures 3.38 - 3.39), resulting in an artefact not requiring any additional glueing or stitching. This method produced a visually engaging textile, potentially applicable when mechanical drape and shadows are desirable, such as a decorative curtain.

Figure 3.38

Strips of BC pellicle hand- woven into a biomaterial 8 cm in diameter.

Figure 3.39

Detail of ≈ 15 mm strips of BC pellicle hand-woven into a biomaterial.

PERFORATIONS

Artisanally perforating BC (figures 3.40 - 3.42) resulted in an engaging textile applicable where the ability to cast interesting shadows is advantageous, such as a lampshade. To improve efficiency, it is possible to achieve similar effects through laser cutting. Kane et al. (2009) state that non-contact laser cutting is a sustainable alternative to utilising toxic chemicals for textile surface modification. BC can be laser-cut but since this test had already been published (Suzanne Lee laser-cut BC for BioCouture), it was unnecessary to prioritise the replication of this modification.

Perforation was also achieved inadvertently via an unidentified airborne insect colonising a partially dehydrated pellicle. The insect hatched larvae that fed on the cellulose creating a non-uniform series of perforations (figure 3.26).

Figure 3.40 Pin perforation of dehydrated BC pellicle. 8 cm in diameter.

Figure 3.41 Pin perforation of BC pellicle. Detail of 8 cm in diameter pellicle.

Figure 3.42 Hole punch perforation in dehydrated BC pellicle. Detail of 8 cm in diameter pellicle.

PACKAGING

By exhibiting the capacity to be easily crinkled into three-dimensional shapes (figure 3.43), BC confers the potential to perform packaging applications that are currently predominated by materials with environmental impacts, notably petrochemical-based bubble wrap and styrofoam. In order to produce this packaging sample, I crinkled the sample in my hands using a medium amount of pressure, comparable to the pressure used to crinkle a standard piece of office paper into a ball. The biomaterial felt soft, comparable to a ball of paper. The biodesign community is beginning to address these impacts, including Ecovative Design, which cultivates mycelium into moulded shapes for packaging applications and I argue that BC also exhibits the potential to reduce the impacts of textile packaging.

Figure 3.43 BC crinkled up into an amorphous shape 30 cm x 20 cm.

BLEACHING

A BC pellicle was bleached for 24 hours, transforming it from the standard honey-brown hue to white with increased transparency and reduced overall strength (figures 3.44 - 3.45). Although bleach is well known to deteriorate cellulose, the pellicle maintained a high level of tensile strength, and this method may be appropriate for non-abrasive applications including lampshades, or room dividers, where a neutral palette combined with transparency may be desirable.

Figure 3.44 BC bleached for 24 hours, washed, air-dried, highly transparent. 8 cm in diameter.

Figure 3.45 Hand-woven and bleached dehydrated BC biomaterial ≈ 30 cm x 30 cm, consisting of ≈ 15 mm hand-cut strips of BC.

TRANSPARENCY AND LIGHT

Figures 3.46 to 3.5.5 all demonstrate varying levels of wet and dry transparency that may be advantageous characteristics enabling the application of BC to fit-for-purpose design applications, such as textile products requiring a level of transparency, including lampshades, privacy screens or curtains.

Figure 3.46

Dehydrated BC pellicle demonstrating transparency.

Detail of amorphous 30 cm x 30 cm pellicle.

Figure 3.47

Dehydrated BC pellicle demonstrating a high level of transparency.

Detail of 8 cm diameter pellicle.

Figure 3.48

Wet BC pellicle placed over a colourful painting to demonstrate its high transparency.

40 cm x 30 cm.

COLOURATION

Experiments utilising a variety of waste feedstock exhibited BC’s potential to be dyed through the cultivation process. For example, the blueberry experiment produced a characteristically blue hue (figure 3.13) due to the presence of anthocyanins, urine feedstock produced a yellow pellicle due to the urochrome pigment (figure 3.16), and the grapefruit peel (figure 3.15) and resulted in a notably orange hue due to the carotene. In another test, I dry brushed black ink onto BC creating an alluring surface detail (figure 3.49). These results indicate aesthetically desirable environmental alternatives to the honey-brown hue of the standard tea recipe.

Figure 3.49 BC dry brushed with ink. Detail of 8 cm diameter pellicle.

METAL OXIDATION

A flesh-coloured and flexible wet pellicle was placed on a raw steel mesh. As the BC dried it oxidised, turning black and became rigid, exhibiting a compelling surface morphology (figure 3.50). This method may be useful for producing a lampshade or similar homeware product requiring these characteristics.

Figure 3.50

A wet pellicle oxidised as it dehydrated on raw steel resulting in a black and rigid pellicle.

8 cm diameter pellicle.

FLAMMABILITY

Certain BC applications may require a coating with a fire retardant to mitigate the potential flammability issue. To address this, a BC/mycelium interspecies hybrid pellicle (figure 3.51) was cultivated as the cell walls of mycelium are chitin, a natural, fire-retardant biopolymer, thus an interspecies composite may be a method of producing a non-flammable BC biomaterial applicable to homewares including diffused lighting. To test the level of flammability I burnt BC samples using a standard domestic lighter, using the yellow part of the flame with a temperature of ≈ 1,000 °C. A dehydrated BC pellicle caught fire very easily and was highly flammable, comparable to the way a piece of paper burns. I observed the BC/mycelium hybrid to be significantly less flammable, burning minimally around the edges, experimentally suggesting that a BC/mycelium hybrid may be an efficient way of making a less flammable biomaterial.

Figure 3.51 BC fed to cellulose-metabolising white oyster mushroom mycelium (Pleurotus ostreatus). 8 cm diameter pellicle.

ENGAGEMENT

As discussed in Community of Practice, engagement is a key theme of biodesign practice underpinning the translation of this research into numerous public exhibitions, lectures and panel discussions as visually documented in this chapter (figures 3.52 - 3.65). As discussed in Background and Motivations I have developed a practice of public engagement over the last 20 years including: hosting solo and group exhibitions, operating a direct to public studio/ retail environment, trade shows, magazine interviews, radio interviews, online interviews, public lectures, keynote speaking, TV appearances, film appearances, blog posting, and contributing to social media channels. I have prioritised sharing my practice and research throughout my career as I continually see the value in sharing knowledge. The importance of these engagements to this thesis is further discussed in the Reflections chapter.

Figure 3.52 Vertically placed pellicles are 40 cm x 30 cm. Horizontally placed pellicles are 8cm in diameter. LIFE & DEATH, (group exhibition), NGV Melbourne Design Week, March 13 - March 27, 2020, Meat Market Stables, Victoria.

Figure 3.53 Ray Edgar, IS IT TIME FOR PLANET B? THE AGE, March 14, 2020.

Figure 3.54 Stephen Todd, Sea Urchin Delights and Future-Proof Cabinets, Life & Leisure, THE FINANCIAL REVIEW, March 6-8, 2020 (1/2).

Figure 3.55 Stephen Todd, Sea Urchin Delights and Future-Proof Cabinets, Life & Leisure, THE FINANCIAL REVIEW, March 6-8, 2020 (2/2).

Figure 3.56 Excerpt from ISOLATE DIARY, (group exhibition) Australian Design Centre, Sydney, 2020. BC pellicle shown is 8cm in diameter.

Figure 3.57 Amorphous assortement of various sized BC pellicles on plinths. PLAY, (group exhibition), Design Tasmania, Mona Foma Festival, January - February 2021.

Figure 3.58 Amorphous assortement of various sized BC pellicles on plinths. BC pellicle (bottom right) utilising waste Hordeum vulgare (barley grain) as feedstock recovered from a local beer brewery compared with BC pellicle from tea + sucrose (top right).

Figure 3.59 PLAY, Designer floor talk, Design Tasmania, Mona Foma Festival, January 2021.

Figure 3.60 PLAY, Designer floor talk, Design Tasmania, Mona Foma Festival, January 2021.

Figure 3.61 PLAY, Designer floor talk, Design Tasmania, Mona Foma Festival, January 2021.

Figure 3.62 Regenerative Biodesign; Co-evolving Sustainability, Presented By MPavilion, March 14, 2020, NGV Melbourne Design Week, Victoria. Photography: Anthony Richardson

Figure 3.63 Biodesign; Reconciling, decolonising and indigenising our urban environments. MPavilion, Melbourne, 28th February 2021.

Figure 3.64 Assorted BC practice experimentation exhibited at FUTURE U (group exhibition), RMIT Gallery, Victoria, July 29 - March 2022.

Figure 3.65 Assorted BC practice experimentation ranging from 5 cm – 8 cm in diameter. Exhibited at FUTURE U (group exhibition), RMIT Gallery, Victoria, July 29 – March 2022.

CONCLUSION

This section documented Studio-based Experimentation and corresponding engagement components of this research, enabling a deepened practical understanding of BC from cultivation, artisanal and discursive perspectives. This led to an evolution of my traditional studio-based practice methods to pursue a new toolkit in scientific methods, the depth of which is documented in Laboratory-based Experimentation. I reflect on my experiences traversing across design and science fields in the subsequent Reflections chapter, whilst discussing the textile design potentialities arising from these experiments and the value of engagement to this thesis.

CHAPTER 4

LABORATORY-BASED EXPERIMENTATION

This chapter describes the protocols for a suite of scientific laboratory-based biodesign experiments that sought to identify and isolate a specific species of cellulose-producing microorganism, establish the cultivation parameters, characterise the material properties of the resultant biomaterials and determine the efficiency by which cellulose-metabolising fungi can biodegrade these materials. An additional experiment explored the potential to introduce a secondary microorganism to create a hydrophobic coating on a piece of BC biomaterial (figure 3.25). The results of these experiments are discussed and reflected upon in the subsequent Reflections chapter. Unless otherwise stated, this laboratory-based research took place at the Plant Pathology Laboratory, RMIT University, Bundoora.

PART 1:

Isolation And Identification Of The Bacterial Cellulose Producing Microorganisms In Kombucha

To produce evidence-based scientific data, an identified strain of BC-producing microorganisms was required to define BC’s ability to compete with plant-derived cellulose. Purchasing a known strain (Gluconacetobacter xylinus - strain number ATC53264) from In Vitro Technologies was deemed prohibitively expensive and unnecessary, as the microorganisms could be isolated from the BC-producing culture already located in the studio kombucha

culture, utilising relatively standard microbiology identification procedures.

METHODS AND RESULTS

To assay the microbial composition of liquid culture, four types of agar media were selected due to their suitability for the cultivation of cellulose-forming bacteria contained within kombucha liquid culture:

Nutrient Agar, Oxoid (NA) containing per litre: 1 g Lab-Lemco® powder, 2 g yeast extract, 5 g peptone, 5 g sodium chloride (NaCI), 15 g agar (LabMal, 2018). Nutrient agar is a medium containing many nutrients essential for bacterial growth.

Potato dextrose agar (PDA) Oxoid containing per litre: 4 g potato extract, 20 g glucose (dextrose), 20 g agar (Aryal, 2019). PDA is a medium for cultivating yeasts, moulds and bacteria, but tends to favour yeasts and other fungi over bacteria.

Hestrin-Schramm (HS) agar containing per litre: 5 g yeast extract, 5 g peptone (protein), 20 g glucose, 15 g agar, pH 6 (Hestrin and Schramm, 1954). HS is the prevalent medium for laboratory-based cultivation of BC-producing bacteria ever since its inception in 1954.

LGI agar containing per litre: 0.6 g/L monopotassium phosphate (KH2PO4), 0.2 g/L dipotassium phosphate (K2HPO4), 0.6 g/L magnesium sulfate (MgSO4), 0.02 g/L calcium chloride (CaCl2), 0.01 g/L ferric chloride (FeCl3), 0.002 g/L sodium molybdate (Na2MoO4), 100 g/L sucrose, pH 4.5 with the addition of 150 mg l-1 cycloheximide and 150 mg nystatin l−1 (antibiotics) (Dutta and Gathui, 2007). This nitrogen-free medium was used to select out microorganisms that are nitrogen-fixing (Dutta and Gachhui, 2007).

These growth media were prepared and autoclaved at 121 ˚C before being poured into sterilised Petri dishes (plates) and plates were used within 24 h. The preparation of ten plates of each of the four media resulted in forty plates (figure 4.0). These media were used to determine how a selection of potentially suitable food sources would affect the growth of the microorganisms contained within kombucha culture.

Figure 4.0 Kombucha isolates and subcultures growing on agar plates. Order of plates (left to right in each group): LGI, HS, PDA, NA. The top row shows isolates from the brown part of the pellicle, the second-row isolates from the white part of the pellicle, the third and fourth row are subcultures obtained from the liquid culture.

Having obtained liquid and pellicle from a culture I cultivated before beginning this research, serial dilution was used to isolate the microorganisms contained within kombucha. This procedure was conducted in a laminar flow cabinet to reduce the risk of contamination from environmental pathogens.

Utilising a micropipette, ten-fold serial dilutions of the kombucha liquid were prepared by first adding 0.1 mL of the kombucha liquid to 0.9 mL of sterile water and vortexing to produce a 10-1 dilution. Further ten-fold dilutions were prepared in the same way to give a 10-1 to 10- 10 series. From each dilution, 100 microlitres were streaked out across one plate of each of the four types of agar prepared earlier. These forty plates were randomised, sealed in groups of five inside zip-lock plastic bags and statically incubated at 30 ˚C for 72 h along with small segments of white-flesh colour (upper layer) and brown (lower layer) pellicles which were prepared by teasing apart 3 mm2 pieces of the pellicle and used as three-point inocula for separate plates of each type of agar. The final cellulose-producing culture was isolated from the brown pellicle cultivated on LGI agar by repeated subculture on various media. The white layer grew a bacterium in the Bacillus cereus complex (identified by sequencing the 16S region of DNA) but the brown layer grew K. xylinus (identified by sequencing) and the yeast Zygosaccharomyces lentus (identified by MALDI-TOF as it reached a quality score of 1.8 - 2.0).

Serial dilution of the kombucha broth alone and pellicle regions resulted in relatively few microorganisms (figure 4.0). All media resulted in the isolation of at least one organism, albeit at relatively small dilutions (10-1 to 10-3).

Microscope slides of each colony type were prepared by Gram-staining revealing rod-shaped bacteria and budding yeasts consistent with the microorganisms present in the BC literature (figure 4.1) (Lavasani et al., 2017).

Figure 4.1 Gram-stained rod-shaped microorganisms observed via light microscopy.

MALDI-TOF IDENTIFICATION OF BACTERIAL CELLULOSE MICROORGANISMS

Once initial microscopy of Gram-stained preparations indicated that individual colonies of microorganisms had been isolated, 3 mm-diameter colonies were streaked onto a metal plate for analysis (figure 4.2) against a database of 8468 known microorganisms for Matrix- Assisted Laser Desorption/Ionization-Time Of Flight (MALDI-TOF) mass spectrometry. A Bruker Maldi Microflex LT was used according to the manufacturer’s instructions. MALDI-TOF utilises mass spectrometry to break apart molecules into smaller recognisable compounds, allowing for the larger molecules to be identified relative to a database of known microorganisms (Leushner, 2001).

Figure 4.2 MALDI-TOF plate with templates for 3 mm microbial smears.

Ferreira et al. (2011) define a MALDI-TOF score between 1.70 and 1.90 as indicating species identification. The Bruker manufacturer guidelines define scores values ranging from 1.70-1.99 as low-confidence identification. Utilising MALDI-TOF, ten successive tests failed to identify any cellulose-producing organisms. It was later discovered that no cellulose- producing organisms are included in this particular database of 8468 microorganisms. The instrument is used primarily in clinical pathology laboratories to identify pathogenic bacteria in humans and the database focuses on the most important human pathogens.

Zygosaccharomyces lentus was identified, scoring 1.80. Zygosaccharomyces lentus is a slow-growing yeast, a close relative of Z. kombuchaensis. Both demonstrate resistance to acetic acid and are known to exist within fermented kombucha culture (Steels et al., 2002). Bacillus cereus was tentatively identified from the white pellicle with a score of 1.76. The B. cereus complex contains some of the most common bacteria isolated from soil and water (Ross, 2019). A summary of results is tabulated below (Table 4.3).

Table 4.3 Summary of MALDI-TOF identification results.

DNA SEQUENCING

Isolated cultures unidentified by the MALDI-TOF were analysed by 16S ribosomal DNA sequencing by extracting DNA from broth cultures, amplifying the 16S region using the primers fD1 and rP2 (Weisburg et al., 1991) and Sanger sequencing followed by electrophoresis of the products at Micromon, Monash University as described in Tehranchian et al. (2020).

This resulted in the identification (>99.5% similarity) of K. xylinus (isolate 1E1) or K. rhaeticus (isolate 3E1) from the kombucha liquor. These are both known cellulose- forming microorganisms included in the database of the National Centre for Biotechnology Information (NCBI) the results of which are summarised in Table 4.4. Komagataeibacter xylinus is well-known for synthesising cellulose at a highly efficient rate and although K. rhaeticus is lesser-known, it is a closely related species that can also produce BC at a viable rate (Machado et al., 2016).

Table 4.4 Summary of 16S DNA sequencing results.

A 16S sequence of a bacterium (WPB) isolated from the pellicle was >99.5% similar to a Bacillus species in the Bacillus cereus complex. The B. cereus complex (B. cereus sensu lato) consists of several species from various habitats and lifestyles (Nguyen and Broussolle, 2005). One of these species, B. cereus sensu stricto (in the strict sense), is a toxin-forming bacterium described as one of the most prevalent sources of food poisoning (Ross, 2019).

However, the bacterium isolated from kombucha most resembles species in other parts of the B. cereus complex. These consist of non-pathogenic environmental bacteria such as B. oryzaecorticis (Hong et al., 2014) and B. weihenstephanensis (Lechner et al., 1998) that increase plant growth (e.g. B. toyonensis) (Jiménez et al., 2013), inhibit the growth of pests like caterpillars (e.g. B. thuringiensis) (Palma et al., 2014) and have even been used as probiotics in animal feed (Zhu et al., 2016). Given the minuscule amount of B. cereus isolated, from only the top part of the pellicle, it is likely to be an aerial contaminant trapped there. The pellicle has previously been suggested to protect the growing kombucha culture from contamination (Meza-Contreras et al., 2018).

MORPHOLOGY OF BACTERIAL CELLULOSE BY KOMAGATAEIBACTER XYLINUS

LOCATION: RMIT Microscopy and Microanalysis Facility (RMMF), RMIT University.

The crystalline structure of cellulose has been extensively interrogated since its establishment by Carl von Nageli (1858), findings later verified utilising X-ray crystallography (Meza-Contreras et al., 2018). Komagataeibacter xylinus nanofibrils self-organise to form a three-dimensional matrix that exhibits morphological and structural similarities closely resembling collagen (Bäckdahl et al., 2006; Mualla et al., 2016).

Scanning Electron Microscopy (SEM) is a powerful analysis tool widely used in life sciences. BC has been analysed to establish the morphology encompassing both the surface structure and the subterraneous three-dimensional matrix of BC. To prepare the BC for SEM analysis, the following procedure was executed:

• Cultivate BC for ± 30 days.

• Harvest pellicle and air dry for ±7 days

• Freeze-dry pellicle for 24 hours in a cryogenic chamber (freezer under vacuum).

• Parts of the colonies of K. xylinus cultivated in plates were also freeze-dried.

• Sputter-coat the pellicle with iridium. Creating an ultrathin conductive

layer of metal on the sample inhibits charging, reduces thermal damage and improves the secondary electron signal required for topographic examination in the SEM (Höflinger, 2013).

The surface morphology of biomaterials was examined with an FEI Quanta 200 SEM (2002) and the pellicles were viewed at 15 kV, spot size 4 at a pixel resolution of 1024 x 884.

At 25 times magnification, the BC fibrils were observed to self-organise into a non-woven biomaterial (figure 4.5). At 6000 times magnification, rigid and crystalline nanofibrillar biopolymers were observed (figure 4.6). As discussed, cellulose is known to have a crystalline structure (Nageli, 1858), yet these crystalline forms may be partially due to the grapefruit feedstock, as standard BC feedstock (e.g Hestrin Schramm medium) produces wavier and more woven structures (Hestrin Schramm, 1954). At 10,000 times magnification rod-shaped organisms, splitting by fission and forming into chains were observed (figure 4.7) as shown by Mohainin et al. (2014). These bacterial chains extrude cellulose forming a three-dimensional matrix, giving this material its significant tenacity.

Figure 4.5 BC nanofibrils at 25 times magnification self- organising into a non- woven biomaterial.

Figure 4.6 The three-dimensional matrix of bacterial cellulose observed at 6000 times magnification revealing rigid and crystalline nanofibrillar biopolymers.

Figure 4.7 BC at 10,000 times magnification rod-shaped organisms, splitting by fission and forming into chains were observed.

CHEMICAL ANALYSIS OF KOMAGATAEIBACTER XYLINUS

LOCATION: Centre for Advanced Materials and Performance Textiles, RMIT University.

Chemical analysis was undertaken to determine if BC cultivated during this research is chemically identical to plant-derived cellulose, as reported by Klemm et al. (2011). BC has previously been characterised as pure cellulose biofabricated by multiple strains of bacteria, including K. xylinus (Yamada et al., 2012).

Fourier-transform infrared (FTIR) spectroscopy was used to assay the chemical purity of the BC cultivated during this research. FTIR is a high-resolution infrared apparatus for chemical analysis, identification and characterisation of textile fibres over a wide spectral range. FTIR enabled the spectral testing of six BC material explorations against a plant-derived control textile of cellulose (figure 4.8).

Under the supervision of material scientist Dr Shelley MacRae, the interpretation and analysis of the resultant FTIR graph demonstrates that the BC I cultivated synthesise cellulose within a spectral range consistent with the spectroscopy of plant cellulose; that is, the dips at the different spectral wavelengths on the x-axis are interpreted to be similar enough to conclude that the BC I have cultivated is chemically identical to plant-based cellulose. As the BC biomaterials tested have not undergone purification, it is reasonable to conclude that the cellulose-forming bacteria produced pure cellulose nanofibrils. While it is beyond the scope of this research to determine the precise cause of the fluctuations between all samples tested, this spectral range is consistent with other reports of FTIR analysis (Yung et al., 2009, Anicuta et al., 2010; Zeng et al., 2011).

Figure 4.8 Fourier-Transform Infrared (FTIR) spectra of BC compared to pure cellulose.

DISCUSSION AND ANALYSIS

Having identified the cellulose-producing bacteria contained within kombucha, I compared K. xylinus literature to results obtained through the biofabrication of K. xylinus during this research. These comparisons deepened my understanding of the characteristics of K. xylinus as a BC-producer and informed the tailoring of experiments that sought to augment cultivation systems for producing environmentally friendly cellulose fibres relevant to the textile industry.

Meza-Contreras et al. (2018) identify K. xylinus as a model cellulose-producing bacterium occurring in kombucha culture. It is the most widely studied bacterium due to its high cellulose production efficiency. The yeast Z. lentus also occurs in kombucha, inverting sucrose to form ethanol, which Komagataeibacter (Acetobacter) species convert to acetic acid (Steels et al., 2002).

On this basis, May et al. (2019) conjectured that yeast is contributing to the biofilm structure of BC. Furthermore, by identifying the cohabitation of K. xylinus (bacteria) and Z. lentus (yeast), it is concluded kombucha contains a symbiotic mixed-species assemblage (Léon- Romero et al., 2016). As this mixed-species culture works symbiotically to convert nutrients into ethanol, acetic acid and BC, symbiosis is regarded as playing a crucial role in protecting kombucha culture from microbial competitors vying for the same nutrients (May et al., 2019). While research has focused primarily on cellulose-producing bacteria occurring in kombucha, yeasts including Dekkera and Brettanomyces are also known to produce biofilms that are directly affected by pH and carbon concentrations (Joseph et al., 2007).

These identifications should be performed in duplicate or triplicate to ensure the results are reliable. Ideally, these repeated tests would be performed at various stages of fermentation as the balance between the microorganisms present in the kombucha culture may change throughout the fermentation process, depending on various cultivation factors including cultivation period, type of feedstock, temperature, exposure to ultraviolet radiation, pH etc. When conducting these tests, across the different media the same organisms were isolated several times. It was important for my practice to learn microbiology procedures to set up tests that would provide evidence for the ecological sustainability of BC. Learning these procedures has significantly increased my understanding of the relevance of cultivating BC as a sustainable alternative to incumbent plant-based fibres such as cotton.

PART 2:

Biodegradation Of Bacterial Cellulose By Fungi

As reviewed earlier in the BC chapter, textile production constitutes 4.3% of global carbon emissions in 2015 (Global Fashion Agenda, 2017) highlighting the need to sustainably biodegrade textile waste to mitigate the negative environmental impact of textiles after their use phase. Depending on their constituents, waste textiles can take long time frames to break down in generic waste treatment systems. Natural fabrics such as unbleached cotton biodegrade faster than more processed forms (Chana, 2020). Synthetic fabrics vary greatly in the time for decay. Those derived from plant-based fibres (e.g. cotton, flax, hemp), generally biodegrade faster than synthetics composed of long-chain polymers, e.g. polyester, polyamides (nylon), lycra etc.s (Stanes & Gibson, 2017). Biodegradation of textiles relies on a diversity of specific microorganisms and fungi being present, which is currently not the norm in generic waste management systems. The bacteria and fungi exhibit the capacity to metabolise the compounds present within textile waste. Generally, simple carbohydrates, (e.g. sugars), are degraded faster than polymers, such as cellulose, in leaving components), and lignin in plant residues, that are more recalcitrant to biodegradation.

The buoyant cellulose that resides on the surface of kombucha consists of pure cellulose produced by K. xylinus during fermentation of the substrate. This suggests that it would be easily degraded by microorganisms with cellulase enzymes. Most of these microorganisms are ascomycete fungi, (e.g. Chaetomium globosum), that have been implicated in spoilage of paper. Other such fungi with cellulose-degrading abilities are in common and abundant genera such as Penicillium, Paecilomyces and Aspergillus. Even more degradative ability is shown by basidiomycete fungi that grow naturally on wood and straw. These can degrade and use not only long-chain carbohydrates such as starch and cellulose but also more complex compounds such as lignin and metabolise them as energy sources for growth.

This section aimed to investigate the biodegradability of BC by selected fungi and compare the rate of breakdown of BC with those of a range of common materials.

100

MATERIALS AND METHODS

The protocol used was adapted from the previous Australian Standard (AS1157) for the ability of fungi to grow on and degrade textiles and leather. This standard and its parts were:

• Committee CH/20 Resistance to fungal growth(1998) Australian Standard.

AS1157.1-1998. Methods of testing materials for resistance to fungal growth. Part 1: General principles of testing. Standards Australia, Homebush, NSW.

• Committee CH/20 Resistance to fungal growth. (1998) Australian Standard

AS1157.2-1998. Methods of testing materials for resistance to fungal growth. Part 2: Resistance of textiles to fungal growth. Standards Australia, Homebush, NSW.

• Committee CH/20 Resistance to fungal growth. (1998) Australian

Standard AS1157.2-1998. Methods of testing materials for resistance to fungal growth. Part 6: Resistance of leather and wet ‘blue’ hides to fungal growth. Standards Australia, Homebush, NSW.

STERILISATION OF TEXTILES

Textiles and dried scoby were cut into squares 5 mm x 5 mm. Textile edges were trimmed with pinking shears to minimise fraying. All textiles except the t-shirt material were new, whereas the t-shirt material was at the end-of-life stage. Textile samples are documented in Table 4.9.

Table 4.9 Textile samples for biodegradation with fungi experimentation.

101

Table 4.9 (continued) Textile samples for biodegradation with fungi experimentation.

102

Air-dried textile and scoby specimens were numbered and weighed individually before sterilisation. Pieces were hung from a metal frame (Meccano) using paper clips so that they did not touch and so obstruct the penetration of the sterilant (figure 4.10). The frame was placed on a perforated stand inside a vacuum desiccator that contained an open dish (15 cm diameter Petri dish base) with methanol in the base (under the perforated stand). The desiccator was closed and evacuated for 15 min to pull methanol vapour into the atmosphere inside the desiccator. The desiccator was closed using the tap in the base and left for a minimum of 18 h to allow methanol vapour to penetrate and sterilise the textiles.

At the end of the sterilisation period, the desiccator was opened and the methanol removed. The desiccator was evacuated for a minimum of 2 h to remove residual methanol vapour from the specimens. At the end of this time, sterile specimens were removed and stored inside pre-sterilised paper bags at ambient temperature (22 °C) until used, within 3 weeks of sterilisation.

Figure 4.10 Apparatus used to sterilise materials in methanol vapour for 18 h minimum.

103

TEST FUNGI

Fungi that matched as closely as possible to the ascomycetes recommended in AS1157-1998 were obtained as shown in Table 4.11. Basidiomycetes were not included in AS1157-1998 but were included in this test to investigate if they degraded BC and textiles to the same extent as the ascomycetes.

Table 4.11 Known cellulose-digesting ascomycete fungi used to test biodegradability.

104

Table 4.12 Fungi used to inoculate specimens of textiles.

* Edible mushrooms cultivated commercially. # Used for medicinal teas/preparations in South East Asia/China.

105

All fungi were cultivated on half-strength potato dextrose agar (½ PDA) made fresh from raw ingredients (see below) in 9 cm diameter Petri dishes (plates). Ascomycetes were cultured for 14 days and basidiomycetes for 17 days at 25 °C before use. Half-strength PDA was prepared per litre by peeling and chopping 100 g of potatoes, tying all of this into a piece of nylon net curtaining and boiling in 500 mL of water for 20 min. The cooled liquor was poured off (potato extract) and the potato solids were discarded. To the liquid was added 10 g glucose and 15 g agar. The volume was adjusted to 1 L and the ingredients were mixed by stirring for 5 min. The medium was autoclaved at 121 °C for 20 min, poured into pre-sterilised plastic Petri dishes at 20 mL per plate and left to set in a laminar flow cabinet. Plates were used within the same day.

PREPARATION OF SOLID TEST MEDIUM AND CONTROL TEST MEDIUM

Solid test medium (STM) was prepared by adding the ingredients in Table 4.13, stirring for 5 min, autoclaving at 121 °C for 20 min and pouring into plastic Petri dishes at 20 ml per plate in a laminar flow cabinet. This medium has no organic carbon source, which the fungi need to grow, and so any growth means that the fungus is using the test material as a carbon source.

A control test medium was prepared for STM but with the addition of 10 g sucrose per litre to provide a carbon source (1) to check that fungi grew satisfactorily and (2) for comparison with growth on specimens.

Table 4.13 Composition of solid test medium (STM).

106

INOCULATION OF TEST SPECIMENS

Three sterile, pre-weighed specimens of each textile were removed from their paper bag and one was placed on each of three plates of STM to act as uninoculated controls. Three similar specimens of each textile were placed on STM to be inoculated by mixed ascomycetes and three to be inoculated by mixed basidiomycetes.

For ascomycete fungi, the three specimens of each test specimen were inoculated by spraying each plate with 10 sprays of conidial suspension (4.15 x 105 conidia). The suspension was prepared by flooding one plate of each ascomycete fungus with sterile water and scraping with a sterile metal spatula to release conidia into suspension. The suspension was repeatedly pipetted off and flooding was repeated to give 10 mL of suspension. The process was repeated with each ascomycete fungus and the suspensions combined to give 50 mL of dense suspension, which was repeatedly drawn up and expelled using a 1 mL syringe and a 21 gauge needle to separate clumps. Conidial density was counted using separate samples with a haemocytometer and density was adjusted to give 4.15±0.99 x 105 conidia per mL. The suspension was transferred to a 50 mL glass spray bottle with a volume per spray of 0.1 mL.

For basidiomycete fungi, which do not produce multiple spores on media, each specimen was inoculated with a 4 mm x 4 mm block of each fungus cut from the growing edge of the colony in the pattern shown in Diagram: 4.14. All plates were incubated at 30 °C in the dark for 28 - 31 days.

Diagram 4.14 The pattern of inocula used for basidiomycete fungi.

Key:

Top left to right: Ga, Gl, Plc,

HS top to bottom: Ple, Plo,

Bottom right to left: Plp, Pb;

LHS bottom to top Sc, Tv.

Total of 9 fungi.

ABBREVIATIONS

Pl. ostreatus*

Ga - Ganoderma australe# G. lucidum # Gl - Plc - Pleurotus cornucopiae* Ple - Pl. eryngii* Plo - Plp - Pl. pulmonarius* Pb - Sc - Tv -

Polyporus brumalis# Schizophyllum commune*# Trametes versicolor#

* Edible mushrooms grown commercially. # Used for medicinal teas preparations in South East Asia/China.

107

ASSESSMENT OF BIODEGRADATION

For each textile and scoby specimen, biodegradation by the fungi was recorded separately by noting the following for both control (uninoculated) and test (inoculated) specimens.

GROWTH

This is assessed on a six-point scale in AS1157.1-1998, from barely visible (0) to dense (5) growth. Scores were not recorded because the fungi often grew over the test specimens completely but the amount of growth was little indication of the amount of biodegradation.

LOSS OF MASS (WEIGHT)

This was assessed by killing the fungi in each specimen by immersion in methanol for 2 min followed by rinsing with water as in AS1157.1-1998. Each specimen had the fungal growth thoroughly scrubbed off, followed by rinsing with water. Specimens were air-dried, weighed

and the final weights were compared with the original weights.

LOSS OF TENSILE STRENGTH

This is assessed by testing according to AS2001.2.3 and AS2001.2.20 but could not be carried out. The aim was then to test the tensile strength of the samples to determine how the biodegradation with fungi affected their strength. These results were then to be compared with those of control samples that had not been exposed to cellulose-metabolising fungi. In the end, it was not possible to conduct these tensile strength tests as the fungi degraded the samples to the point that they had to be scraped off the agar plates. That is, at the end of the biodegradation period, there was nothing left of sufficient stability to test under textile laboratory conditions.

108

RESULTS AND DISCUSSION

The appearance of the inoculated and control (uninoculated) specimens was different soon after the ascomycete fungi experiment started because some of the fungi produced dark spores once the fungi had started to grow (figures 4.15 - 4.16).

Figure 4.15 All materials tested by spraying with spores of five ascomycete fungi causing decay of textiles 4 days after spraying with a mixture of spores: Penicillium chrysogenum, Paecilomyces variotii, Chaetomium globosum, Aspergillus flavus, Aspergillus niger. Textiles are labelled below left to right. AF = from Alexi Freeman.

Bottom row: 8. New pudding cloth beige AL, 9. New grey leather AF,

Top row: 1. Fleece: 53% cotton, 45% polyester, 2% elastane, white/blue AL,

Middle row: 5. BC (thick) AF, 5b. BC (thin) AF, 6. Used T-shirt white,

100% cotton,

7. Cotton poplin pale yellow

last=CTM (same basal medium (STM) but with sucrose that supports the growth of fungi inoculated).

2. Bradmill 0492Q246M blue denim AF: 100% cotton, 3. 8003 'oasis: 57%, cotton/ 43% rayon pink/mauve AF,

4. Lycra: White stretchy AF

109

Figure 4.16 All textiles on STM at 4 days, showing differences in appearance between test plates sprayed with ascomycete fungal spores (left) and those left unsprayed (control) (right).

110

Figure 4.17 Textiles after inoculation with basidiomycete fungi as blocks of agar growth cut from Petri dishes. Reflections are from the back of the laminar flow cabinet providing sterile air.

Figure 4.18 Growth of basidiomycete fungi on textiles and BC after 10 days. Reflections are from the back of the laminar flow cabinet providing sterile air to avoid contamination during the experiment.

111

The ascomycete fungi reduced the weight of the test specimens by 0.4 - 93.6% (Diagram 4.19). The least loss was from leather (keratin), which was included because of the leather-like feel of the thick pellicle. The largest loss was from Oasis (57% cotton, 43% rayon - both cellulose). Other textiles with over 80% loss were both thick and thin BC, Lycra (elastane), and used t-shirt (cotton). Pudding cloth and denim (both 100% cotton) surprisingly lost less weight but both were new and may have had manufacturing inhibitors that would be removed by laundering in use. Fleece and polyester/cotton were biodegraded down to their percentage of non-cotton (knitted and woven polyester respectively). This is as found previously by the investigation into biodegradation of fabrics by soil burial (Sular and Devrim, 2019), which found that cotton fabrics (modal, cotton and viscose) lost 90% of their weight but that all types of synthetic fabric had negligible losses.

By contrast, with basidiomycete fungi only both BC samples were biodegraded, by over 80%, the equivalent of the losses with ascomycete cellulose-degrading fungi. Of the other textiles, pudding cloth lost the most (37%) and all others lost less than 20% of their weight. Losses from leather were again negligible. There seems no obvious reason why BC was so greatly degraded by the basidiomycete fungi while the other textiles were less degraded. These fungi tend to grow and metabolise more slowly than ascomycetes and so the ultimate losses from other textiles may increase with greater time.

Diagram 4.19 Percentage weight loss over control for BC biodegradation with fungi tests.

112

Part 3:

Hydrophobic Fungus On Bacterial Cellulose

METHODS

The green hydrophobic fungus found growing on the surface of the pellicle (figure 3.27) was isolated onto potato dextrose medium (figure 4.20) and was typical microscopically of the genus penicillium in its sporulation (figure 4.21). As the identification of penicillium species is difficult by morphology alone, it was sequenced in the ribosomal DNA internal transcribed spacer (its) region, which is the ‘gold standard’ for fungal identification (figure 4.22) and compared with closely similar sequences of the same and other sequences in a phylogenetic tree, which groups together the same sequences and enables identification (figure 4.23).

Figure 4.20 Macroscopic appearance of fungus grown on fresh potato dextrose agar.

113

Figure 4.21 Microscopic appearance of fungus grown on fresh potato dextrose agar, showing the diagnostic ‘penicillus’ (broom-like) structure of Penicillium species.

Figure 4.22 ITS sequence of hydrophobic fungus growing on BC.

5 ’ - C G G C T G G C G C C G G C C G G G C C T A C A G A G C G G G T A CAAAGCCC CATA CGCTC GA GGAC CGGA CT CGGT G CCGCCGCTGCCTTTCGGACCCGTCCCCGGGGGGACG GAGCCCAACACACAAGCCGTGCTTGAGGGCAGCAAT G A C G C T C G G A C A G G C A T G C C C C C C G G A A T A C C A G G GGGCGCAATGTGCGTTCAAAGACTCGATGATTCACT G A A T T C T G C A A T T C A C A T T A G T T A T C G C A T T T C G C T G C G T T C T T C A T C G A T G C C G G A A C C A A G A G A T C C G T T G T T G A A A G T T T T A A C T T A T T T A G T T T A T G C T C A G A C T G C A A T C T T C A G A C A G A G T T C A A T A G T G T C T C C G G T G C G C G C G G A C C C G G G G G C A G A A G C C C C C C G G C G G C C G T G A G G C G G G C G C A C C G A A G C A A C A A G G T A C A A T A A A C A C G G G T G G G A G G T T G G A C CCAGAGGGCCCTCACTCAGTAATGATCCTTCCGC-3’

Figure 4.23 Relationships between ITS sequences from a fungal isolate from BC (top sequence) and Penicillium species. Those labelled TYPE at the end are from the original (Type) cultures.

114

RESULTS

The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model (Tumara & Nei, 1993). The tree with the highest log likelihood (-1076.90) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach and then selecting the topology with a superior log-likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 18 nucleotide sequences. All positions containing gaps and missing data were eliminated. There are 436 positions in the final dataset. Evolutionary analyses were conducted in MEGA7 (Kumar et al., 2016).

DISCUSSION

This experiment identified the BC contaminant as P. glabrum, which has very common airborne spores and is best known for infecting strawberries. It remains unclear as to why P. glabrum did not digest the BC as would be normally expected, but it may be a mutant without cellulase, which would be very useful to confer hydrophobicity as a scaffold for BC cellulose fabric.

Undertaking this process of identification and analysis of P. glabrum elicited the potential to utilise interspecies collaboration to produce a hydrophobic cellulose biomaterial that may be applicable to the textile industry. Due to the risk of contaminating the student research facility with airborne spores, it was beyond the scope of this thesis to pursue this experiment further. Nevertheless, this hybridisation is worthy of further investigation for future researchers seeking to make a waterproof textile with a mitigation of environmental impacts.

CONCLUSION

Undertaking these laboratory-based experiments has enabled the application of microbiology methods and methodologies I researched in my literature review of BC. This laboratory-based practice-led research has developed my comprehension of the complexities of working with life science protocols under strict laboratory conditions, providing insights into how my design practice specifically, and the field of design more broadly, can develop more sustainable textiles through interdisciplinary collaboration with scientists and scientific methods. I reflect further on these laboratory-based experiments and what they mean to my practice in the subsequent and final chapter, Reflections.

115

CHAPTER 5

Reflections

This chapter reflects upon studio- and laboratory-based experiments undertaken to produce textiles with microorganisms, discussing how these projects have irreversibly transformed my practice from a fashion designer to a biodesigner and biodesign- translator. Also discussed are examples of pre-research experiences motivating this thesis into the way biological methods may be applied to reduce textile impacts and themes highlighted in Community of Practice namely engagement, interdisciplinarity, reducing environmental impacts and resource recovery.

Early in this thesis journey, I reviewed industrial ecology, biodesign, environmental textiles and life science literature leading to the perusal of BC as an alternative derivation of cellulose for textile design applications. I became interested in the potential of BC as an alternative form of cellulose for numerous reasons. These include the mitigation of chemical treatments to remove impurities, its potential to be grown on food waste, rapid biodegradability and because BC is yet to be fully industrialised as a method of cellulose cultivation for textile applications.

Initially, I reviewed scientific journals to deepen my knowledge about microbiology, BC and explicitly to K. xylinus and it was challenging to comprehend this literature given the unfamiliarity of the terminology. I have since familiarised myself with myriad scientific terms, apparatus and procedures that were not previously part of my vocabulary or methodologies, those of which are used in this thesis are listed in the Glossary.

I became interested in comprehending the issues and improving the methods of producing textiles with microorganisms, to bring environmentally relevant knowledge of BC back to the design industry. However, the analysis and proof of BC’s environmental performance compared to other forms of cellulose regarding environmental advantages would have required a different set of experiments involving the use of tools such as life cycle analysis (LCA). Although LCA remains an important theme in the field of biodesign, it became outside the scope of this thesis as the inadvertent ‘mastery’ has been my ability to adapt to the language and methodology of science and scientific procedures and hybridise these into my existing design practice. Consequently, the journey of this thesis became how my design practice was transformed through collaboration with scientists, experiencing, learning and applying scientific methods to understand BC in ways studio-based practice could not offer. This chapter offers reflections on this journey back and forth between creative practice and scientific methods.

116

QUALITATIVE VERSUS QUANTITATIVE

Before this research, I practised in the studio and the associated contexts to produce, present and commercialise design work. This research has required me to step outside the familiarity of the design studio and enter the domains of science literature and the microbiology laboratory, undertaking interdisciplinary research interrogating the nexus of biology and design, known as biodesign. This was necessary as the design studio limited my ability to efficiently determine the value of BC from an empirical perspective, leading to the undertaking of scientific laboratory-based practice, eliciting the potential to characterise BC through a qualitative and quantitative lens.

My design practice prioritised my subjective design vision, whereas entry into science has required a rapid comprehension of the procedures and methodologies of objectivity and the distinction between qualitative opinions and empirically verified facts. Where studio-based design was predominantly qualitative, laboratory-based experimentation required a more quantitative approach. While my industry practice often revered the intuitive interpretations of memories, dreams and the subconscious, life science practice predominantly required the rational logic of the conscious mind.

Whilst practising design in industry, every purchasable textile was derived from plant, animal or petrochemicals/minerals, yet BC exhibits a potential fourth category of textile - derived from microbes. Upon undertaking this research interrogating a microorganism known to produce cellulose, it became apparent I could not undertake any research of value to the scientific community without sequencing the DNA of this organism, as described in Laboratory-based Experimentation.

I learned hypotheses must be tested and proven empirically to hold gravitas in science, necessitating a process of correspondence with life science experts to seek guidance, and consequently laboratory-based practice interrogating microorganisms. Microbiology protocols were used to sequence the DNA of the microorganism K. xylinus, a predictable result that may have been assumed in the design industry, but assumption is a luxury seldom afforded when working with scientific protocols.

This research constitutes a significant departure from interdisciplinary practice undertaken in industry, being my first foray into collaboration with life science and the analysis of textile fibres at a molecular level. Undertaking laboratory-based practice experiments enabled a deepened understanding of the quantitative values of textiles; aspects unable to be observed merely from handling a textile with tacit knowledge, leading to experimentation with scientific procedures and apparatus to determine the value of BC from a quantitative perspective. Cultivation parameters were experimented with to determine how these may alter the resultant BC, chemically identified as cellulose using Fourier-transform infrared spectroscopy (FTIR). Scanning electron microscopy (SEM) facilitated microscopic analysis revealing the nanofibres self-organised into three-dimensional matrices at the molecular level.

117

My prior design practice was predominantly intuitive, subjective and qualitative, yet reviewing the scientific literature and working with scientists elucidated the value of combining these cornerstones with a rational, objective and quantitative approach. Combining my existing design methods with these newly acquired science methods provided me with a more diverse and powerful toolkit to tackle my practice research and corresponding engagement outcomes.

DESIGN STUDIO VERSUS SCIENCE LABORATORY

Reflecting upon the research process and outcomes resulting from the studio and laboratory- based experimentation, the studio was suitable for the cultivation of BC, although the difficulty in maintaining sterile cultivation protocols increased the risk of experimental contamination, limiting the studio-based method. The sterility of the laboratory and the apparatus it contained were better suited to microbial experimentation, and the examination of BCs characteristics. Nevertheless, the studio was appropriate for textile surface modifications and thus a combination of studio and laboratory-based practice was an optimal method of undertaking biodesign research.

However, the lack of sterility also produced an accidental outcome, outlined in Studio- based Experimentation, when a pellicle was colonised by a fungus, creating a hydrophobic coating on the surface (figure 3.27). This accident offered a tantalising glimpse into the potential of cultivating two types of microorganisms together to biofabricate a hydrophobic surface. While the colonising fungus was successfully sequenced in the laboratory as P. glabrum (figure 4.12) this particular test could not be pursued further due to the perceived risk of contaminating a student laboratory with airborne spores, this process highlighted the importance of serendipity in both design and science. It also taught me that studio-based experimentation must be repeated reliably in a laboratory setting (ideally in triplicate) under strict procedural protocols, to determine the potential for scalability in industry.

Figure 3.27 Penicillium glabrum forming a hydrophobic coating on a BC pellicle.

118

THE ODIFEROUS SCENTS OF BIO-INVENTION

During industry, my studio was frequented by well-heeled clients seeking luxurious bespoke garments and accessories. This practice necessitated that my studio be kept as an immaculate and convivial space which enabled clients to disrobe for fittings in the sanctuary of a safe environment. Transforming my studio into a biodesign research facility for metabolising food waste into BC dramatically changed the ambience of my studio in numerous meaningful ways. At their most superlative, the bacteria would release a curious acetic smell which would intensify as the BC neared maturity. At their most repugnant, the bacteria would inadvertently be colonised by airborne contaminants, transforming a comparatively palatable acetic acid smell into a pungent stench that could not easily be acclimated. This metamorphosed my studio from a convivial space to engage with luxury fashion to that of a mildly unpleasant experimental environment, dedicated to the cultivation of cellulose-producing bacteria. Working with BC changed not only how I worked but the very physical nature of my work environment.

GETTING A GRIP

My previous industry practice primarily utilised luxurious textiles including wool, silk and leather embellished with beads, sequins and foil printing. These textiles always had a je ne sais quoi, be it diaphanous, softness, lustre, three-dimensional texture, transparency or fluidity. The pellicles I developed through studio-based experimentation were engaging due to the novelty of the method, but BC rarely conflated alluring characteristics valued during industry practice.

The thicker artefacts exhibited significant tensile strength but were too inflexible for wearability, while the softer artefacts lacked the tensile strength to be worn and all were more susceptible to atmospheric fluctuations than incumbent industrialised textiles. As BC is hygroscopic, it absorbs moisture during cooler periods and the impracticality of a textile that is highly susceptible to atmospheric changes precludes it from most wearable applications with the notable exception of shoe lining, requiring an absorbent textile to draw moisture. Most BC samples oxidised to a darker hue over time, anecdotally due to their hygroscopic capacity. Conversely, to mitigate excessive dehydration in summer, I tried storing BC in a fridge. Upon removal, the BC was dramatically more brittle than before refrigeration.

Through studio-based experimentation, a correlation between the duration of the cultivation period and the characteristics of the biomaterial was observed. Cultivation for 7 days (figure 3.5), produced a papery-thin, golden-hued, highly transparent pellicle with very low tensile strength, potentially appropriate for ambient lighting applications. Longitudinal cultivation periods up to 70 days produced multiple individualised layers of BC. Upon harvesting, these layers self-aggregate into a homogenous, midnight-brown, opaque pellicle, exhibiting high-tensile strength (figure 3.1.1), potentially applicable as a vegan-leather alternative for upholstery, bags, footwear or protective matting.

119

Having cultivated BC in the studio and observed its characteristics, I was motivated to deepen my understanding through a scientific lens, which led to laboratory-based experimental collaborations with scientists and started my extensive journey into science and using scientific methods.

THE TURNING POINT: BIODEGRADATION WITH CELLULOSE-METABOLISING FUNGI

Whilst disposing of a contaminated studio-based experiment I observed the capacity for BC to be rapidly metabolised in a compost ecosystem. This led to a literature review which uncovered a surprisingly shallow body of literature published on the potential to biodegrade cellulose textile waste with cellulose-metabolising microorganisms and fungi. In Laboratory- based Experimentation, an experiment is documented investigating this potential. This test experimentally demonstrated the significant potential for fungi to efficiently metabolise BC, as samples inoculated were almost fully metabolised within 30 days (Diagram 4.2.2). While an accurate determination of the scalability of this method is beyond the scope of this thesis, I argue that designing an industrial system capable of feeding cellulose textile waste to fungi could mitigate the environmental impacts of textiles.

ENGAGEMENT: BECOMING A BIOTRANSLATOR

Throughout my design career, I have practiced engagement as a method of contributing discursive dialogue. Underpinned by the prevalence of public engagement, as discussed in the Community of Practice chapter, there has been significant value in continuing this practice through this research. Translating research in discursive ways applicable for exhibitions, trade shows, keynote lectures and panel discussion, alerted the public to the transformative potential of biodesign, and growing environmentally relevant cellulose with microorganisms contributed to the expansion of the biodesign field.

Studio and laboratory-based experiments produced important artefacts for engaging with other designers and the public around biodesign. I observe there to be a growing interest from creative practice institutions and the public in the field of biodesign and an openness to creative practice melding with scientific knowledge in new and experimental ways. However, it was my formative experience as a designer who engaged frequently that prepared me for this new role as a ‘biodesign-translator’. As outlined in the Community of Practice chapter, designers including Susanne Lee and Neri Oxman have emerged as important advocates for the biodesign field and the capacity to present and publicly discuss our work is embedded deeply within the professional practice of the design community.

120

INTERDISCIPLINARITY

Interdisciplinarity is another theme discussed in Community of Practice that also underpinned my industry practice, involving numerous longitudinal collaborations with practitioners such as artists, architects, jewellers, shoemakers, perfumers and composers. These industry experiences were invaluable in preparing me for the challenges of collaborating with science and scientific methods.

In transforming my practice from a fashion designer to a biodesigner, I retained the tacit knowledge I gained in the design industry, whilst learning a new science toolkit. This transformation enabled a transition to an interdisciplinary biodesign practitioner with growing literacy in the design studio and microbiology laboratory, able to traverse the siloed fields of biology and design. I aim to translate design into science, science into design, and ultimately biodesign research into industry, positioning my practice in the nexus that incorporates the most environmentally relevant characteristics of both disciplines.

REDUCING ENVIRONMENTAL IMPACTS

A key theme discussed in Community of Practice is the prevalence of biodesigners collaborating with biological systems to create biomaterials that mitigate the impacts of the textile industry. While this research remains motivated by the aim to mitigate textile impacts, it was beyond the scope to conduct LCA. Nevertheless, the BC chapter discusses the high purity of BC, a characteristic circumventing the environmental impacts of removing impurities (e.g. hemicellulose, pectin and lignin) from plant-derived cellulose, highlighting the potential environmental benefits of developing BC for textile design applications (Hestrin and Schramm, 1954; Yudianti and Indrarti, 2008; Dufresne, 2018). The stated environmental benefits highlighted in these peer-reviewed studies underpin the ecological motivations behind this research into optimising methods of cultivating BC for textile design applications.

RESOURCE RECOVERY

Another theme of biodesign discussed in Community of Practice is resource recovery. This theme underpins experiments documented in Studio-based Experimentation exploring the potential to recover nutrient-rich waste from local food and beverage industries to mitigate food waste going to landfill and reduce BC cultivation impacts. These experiments also examined how the varying nutritional value of waste streams may impact the characteristics of BC, all of which are important as these factors help determine how BC may be used for textile applications.

I also recovered BC waste from the kombucha industry to further reduce the impacts of BC production and increase the design applications through access to larger pellicles than I could cultivate in an experimental setting. I engaged in a protracted period of correspondence with numerous Victorian-based kombucha brewers regarding access

121

to their waste BC including a company that offered gargantuan pellicles as a waste by-product of their kombucha brewery (figure 3.2.2). This offer was never realised due to their concerns regarding IP.

After correspondence with a rival brewer, I was eventually invited to climb towering shelves (figure 3.2.3) and dive into 500 L vats, to wrestle incredibly slippery and heavy 100 cm diameter pellicles out of their tanks. Suffice to say this was quite a surreal, relatively dangerous and rather grotesque way to recover waste BC. Due to the technical difficulty of recovering the pellicles without damaging them and because the pellicles were not as homogenous as the smaller ones I had grown, I ended up with much smaller fragments than I was anticipating. These pellicles were transported (figure 3.2.4) and dehydrated on a Hills hoist (figure 3.2.5), resembling flayed animal flesh (figure 3.2.6) more than cellulose.

The hills hoist I loaned for this purpose was already partially covered, and I further covered it with plastic to mitigate the potentially counter productive effects of rain, sun, animals and other living organisms interacting with the pellicles. That is, as my aim was to dry them into a stable biomaterial suitable for design applications, thus I did not want them to get rained on and/or potentially scorched by the sun. I made this decision to cover the wet pellicles as I had both read in the literature, and observed through my own experiments that the pellicles were highly hydrophilic and I also wanted to minimise the potential for bacterial and fungal contamination.

I aimed to have significantly larger pieces to produce design artefacts including making bags, curtains, lampshades, light shades, cushion covers. As the pieces were all smaller and more fragile than anticipated, they offered little more than the smaller and more homogenous pieces I had cultivated myself. Nevertheless, I still have many boxes of fragments of dehydrated BC, and I am confident this will be useful for future iterations of BC experimentation, albeit beyond the scope of this thesis.

Another experiment recovered my urine as both water and feedstock for BC cultivation as a proximitous and nutrient-rich liquid containing minerals and trace elements metabolisable by cellulose-producing bacteria. This experiment resulted in a notably brighter yellow-hued BC pellicle (figure 3.1.7), than the standard tea/sugar recipe also exhibiting a more pungent odour, an odour that dissipated over time. I observed a general (albeit irrational) fear of bacteria in the textile-buying public. Consequently, a urine-fed bacterial textile is unlikely to be adopted, no matter how ecologically sound, and therefore I will not pursue this as a commercially viable mode of resource recovery. Nevertheless, on a technical basis, urine provides nutrients (e.g. carbon and nitrogen) that K. xylinus requires for growth. Furthermore, a lot of drinkable water is used in flushing urine down the toilet, and significant time and energy are used in processing urine at sewerage treatment plants, and therefore the potential for urine recovery as a feedstock for a textile product offers discursive value. On this basis, I have included this experiment in various public engagements throughout this candidature.

Yeast lees is a nutrient-rich waste product that is abundantly available due to the popularity of the winemaking industry, and was recovered from a local winemaker. The resulting pellicle

122

was an appealing red hue although it was relatively brittle (figure 3.1.8); this method may be iterated to produce a higher quality biomaterial, more applicable to textile applications.

HOW HAS THIS RESEARCH CHANGED MY DESIGN PRACTICE?

As discussed in the Introduction, textiles contribute significantly to global ecological degradation (Bick et al., 2018; Hines, 2007). Undertaking this research deepened my understanding of how textiles are impacting the environment and I have learned that not everything that counts can be counted when quantifying the impact of textiles on the environment. I stand with fashion commentators including Kate Fletcher and Carole Collet in arguing the need for a seismic shift away from high-impact textiles towards greener materials biofabricated utilising biological systems. These systems have been evolving since the genesis of life on Earth, yet since the first industrial revolution designers have travelled down a divergent path.

I have observed scientists working within life sciences attuned to the awe-inspiring capabilities of natural systems, encompassing methods capable of producing quantitatively environmentally relevant textiles. Nevertheless, the textile industry is yet to fully engage with methods to commercialise biomaterials that are simultaneously qualitative, environmentally efficient and circular, engineered with the capability for materials to be biodegraded and metabolised back into the manufacturing cycle at end of life.

For example, hydrophobic textiles are predominantly manufactured utilising petrochemicals that off-gas dangerous chemicals and shed myriad microfibres during their use phase and can not easily be biodegraded at their end of life, and this research highlighted the importance of developing methods that mitigate the impacts of such practices. I argue the potential of combining the most ecologically relevant aspects of textile design with life science methods, as I am fascinated by the potential of hybridising fields to combat the compounding impacts of textiles.

Through this research journey, I arrived at a deepened appreciation of the importance of evaluating the quantitative aspects of textiles. For example, what quantity of raw material and energy is used for production? What off-gassing, microfibres or toxic dyes may a textile emit during its life cycle? How will waste textiles be reused, recycled, or biodegraded efficiently? What is the total carbon footprint of a textile product? I also learnt that for a new textile to be industrially competitive, it must incorporate both qualitative and quantitative advances as it is redundant to produce an environmentally friendly textile unless it conflates the qualitative appeal to replace a less environmentally friendly incumbent textile.

123

During studio-based experimentation, I documented a variety of BC biomaterials cultivated utilising the static method, resulting in qualitatively compelling textiles, exhibiting desirable characteristics including opacity/transparency, softness/hardness, flexibility/ rigidity, surface irregularity/homogeneity. These materials were also compelling from a quantitative perspective, exhibiting the potential to be grown utilising minimal space, water and feedstock, with a low carbon footprint, highly biodegradable, without the risk of toxic off-gassing, micro-fibres or harmful dyes being emitted.

Despite these BC experiments exhibiting significant potential from both a qualitative and quantitative perspective, it is yet to become evident what function BC biomaterials are best suited to from a textile design perspective. Nevertheless, undertaking this research has deepened my ability to apply critical thinking to design problems, conflating qualitative and quantitative value systems.

ETHICAL IMPLICATIONS OF INTERSPECIES COLLABORATION

Through this research journey I have perhaps been shaped by collaborating with K. xylinus as much as the resulting biomaterials have been shaped through the various methods I have used to manipulate them into shapes that resemble potentially utilitarian biomaterials.

I have searched for cleaner ways of cultivating, processing, using and disposing of biomaterials with methods that aim to create or enhance ecological balance. In so doing, this research has provided an environment for microorganisms to grow and reproduce when they might have never otherwise existed. I fully acknowledge that there are ethical implications when working with biological systems, and although these implications are of great interest to me personally, the focus of my thesis has centred on how biodesign methods may mitigate the environmental impacts of the fashion and textile industries. Nevertheless, I will state that my personal view towards the ethics of utilising BC for cultivating biomaterials with a mitigation of environmental impacts is predominantly a pragmatic one. That is, my stance is that if BC can be cultivated in a way that outpeforms incumbent sources of cellulose on the basis of key performance indicators (KPIs) as they pertain to sustainability, then ultimately this use of K. xylinus positively benefits the Earth holistically, and is not yet another example of humans selfishly benefitting from the enslavement of non-human organisms. These KPIs may include an incontrovertibly lower carbon footprint, greater biodegradability, greater potential to contribute to circular systems, less contribution to habitat loss, less water use and a mitigation of the flow of eco-toxic chemicals and microplasitcs throughout the entire biosphere.

Through this process I have observed that K. xylinus naturally secrete cellulose biomaterials in a manner (albeit inadvertently) that creates wearable architectural textiles to protect themselves from the sun, wind, rain and other competitive organisms, in a way that is reminiscent of the way humans also utilise textiles to protect ourselves from external factors. As biodesign grows as a field, there are important questions to be asked, discussed and answered that sit beyond the scope of this thesis. That is, questions that sit beyond the

124

aesthetic representation, utilitarian uses and quantitative impact of biomaterials, pertaining to how much agency non-human organisms have in collaborating with biodesigners to achieve a more ecologically sustainable relationship between design and the natural world.

I acknowledge that there is a vast amount of published literature and research pertaining to both bioart and biodesign that provokes viewers to question the ramification and ethics of using non-human species for our benefit. These are important questions regarding the ethics of using living organisms and there are numerous interspecies collaboration projects that add gravitas to discursive dialogue around the importance of these issues. As previously discussed, prominent examples include a paper by Dr Daphne Mohajer ve Pesaran titled Interspecies Collaborative Design (Mohajer va Pesaran, 2017) and the Victimless Jacket bioartwork by Catts and Zurr that utilises laboratory grown materials to specifically address fashion through the archetype of the jacket, questioning whether it is infact possible for a design product to be victimless (Rotkop, 2008). Kellhammer’s discussion calling for an undoing of ‘pervasive anthropocentrism’ and for non-human collaboraters to be afforded the respect we assign to human collaborators also adds weight and philosophical complexity to this debate regarding the ethical implications of working with microorganisms (Kellhammer, 2017).

In the Community of Practice chapter I further discussed a number of pre-eminent speculative bioart/biodesign practitioners whose individual and indeed aggregated voices carry cultural significance (e.g. Collet, Franklin, Ginsberg, Lee, Oxman, Sherer etc.) as it is important to acknowledge that speculative bioartworks continue to play an important role in inspiring actualised functional biodesign products utilising living systems. Nevertheless, it remains beyond the scope of this thesis to deeply discuss the ethical implications of working with these livings systems.

CONCLUSION: AM I STILL A DESIGNER?

This chapter has reflected on the studio and laboratory-based experimentation and how this research has irrevocably changed my practice as a designer. In the subsequent Conclusion chapter of this thesis, I will expand upon these reflections and offer my final analysis on the relevance of this practice research undertaking.

125

CONCLUSION

I began this research motivated to comprehend and address the environmental impacts of the fibre, fashion and textile industries. Upon reflection, I had comparatively little understanding of the magnitude of the environmental impacts resulting from the textile industry before undertaking this research. I now have a far more holistic understanding of these impacts and the potential of biodesign methods to address these impacts.

I reviewed design literature whilst undertaking studio-based practice. As my interrogation of BC deepened, I found studio practice increasingly limiting, necessitating a shift into the scientific literature and laboratory-based procedures. Consequently, my primary research question became ‘To what extent does my practice change when design meets science?’. This question was explored through a review of both BC and Community of Practice literature, underpinning the Studio-based Experimentation, Laboratory-based Experimentation and Reflections chapters.

Transitioning from industry practice focussed on the aesthetics, ethics and economics of running a fashion design business to a researcher engaging with science literature and laboratory-based protocols was a challenging endeavour. Nevertheless, this challenge was rewarding, enabling my return to industry practice with an updated set of interdisciplinary skills and knowledge that will facilitate the design of fashion and textile products embedded within a sustainable ethos.

I interrogated K. xylinus, a species of cellulose-producing bacteria that self-organises into a pellicle at the air-liquid interface of the fermentation tank. The Community of Practice chapter reviewed key biodesign practitioners, commentators and companies, including Suzanne Lee, Neri Oxman and Nanollose. Other key themes discussed are interdisciplinarity, biofabrication, resource recovery, mitigation of environmental impacts and engagement. These themes underpinned the practice research discussed in Studio and Laboratory-based Experimentation that documented BC cultivation utilising liquified food waste as feedstock, exhibiting the potential to reduce impacts on natural resources. Upon reflection on research practice, I conclude that cultivating BC using the static method is a valid method of producing an environmentally relevant biomaterial. Nevertheless, BC requires more research before it can be optimised to compete commercially with incumbent cellulose fibres.

The limitations of cultivating BC utilising the static method led to explorations of BC’s potential in laboratory settings, as documented in Laboratory-based Experimentation. In one test, I successfully dissolved BC fibres for regeneration through a wet-spinning process, although campus closures arising from Covid-19 precluded the completion of wet-spinning experiments. Nevertheless, I argue wet-spinning BC exhibits the potential to produce a disruptive alternative to plant-based cellulose.

126

As discussed in Community of Practice, textile company Nanollose claims to be pilot- testing the dissolution of BC into a viscosity able to be wet spun into yarn suitable for knitting and weaving (Nanollose, 2021). This method offers significant potential for BC to be produced at scale utilising resource recovered feedstock from high-nutrient liquid food industries. However, wet-spinning requires energy and synthetic chemicals, and so LCA should be implemented to validate the ecological relevance of this method.

In a subsequent laboratory experiment, I successfully demonstrated BC’s efficient biodegradation by cellulose-metabolising fungi, a method worthy of further development to target the impacts of cellulose-based textile waste.

The primary achievement of this thesis journey has been reviewing and discussing scientific knowledge and applying it to practice experiments augmented with my tacit knowledge of fashion and textiles derived from industry practice, enabling a deeper understanding of biodesign principles.

I successfully cultivated artefacts that experimentally demonstrated the potential to recover bioregional food waste as feedstock for the biofabrication of BC. Both the static and wet-spinning methods embody advantages and disadvantages. For example, the static method produces biomaterials of high-qualitative value utilising basic apparatus, very little water, no energy, and can be fed food waste as feedstock. Yet these BC pellicles are far more hydrophilic than incumbent plant-based cellulose, and cultivating large BC pellicles with a homogenous morphology utilising the static method is challenging, factors reducing BC’s fashion and textile applications.

This journey has increased my knowledge of scientific processes, developing my interdisciplinary skills and thus transforming my practice from that of a traditional fashion designer, becoming a biodesigner and biodesign translator between design and science. Numerous engagements documented in the Studio chapter contributed to timely public discussion regarding the need for the textile industry to research and develop more environmentally friendly methods of producing textile fibres.

I have concluded this research with a hybridised knowledge of the nexus between design and science, aggregating in a dissertation that discusses the environmental impacts of the fibre, fashion and textile industries; the community of practitioners addressing these impacts; and the potential of BC as an alternative fibre. This thesis also documents the suite of practice artefacts that experimentally demonstrate the potential of BC and reflects on how this research has irreversibly changed my design practice.

Fibre, fashion and textile industries face myriad challenges to reduce environmental impacts underpinning the relevance of this research. I interrogated the potential to optimise BC by augmentation of fibre cultivation methods, arguing the need to understand and improve cultivation parameters, eventually moving towards the scalability of BC biofabrication.

127

I will apply the knowledge gained through this research to further studio- and laboratory-based research for industry applications. While this may include continued research with BC specifically, this knowledge may have broader uses, applicable to the cultivation of alternative biomaterials utilising biodesign methods.

Nevertheless, while I acknowledge this has not been a sustainability thesis in the strict sense, the motivations underpinning this research have interrogated methods towards improving the sustainability of the textile industry. This research has reviewed, discussed, practised and reflected on the relevance of researching, developing and optimising potentially more ecologically friendly methods of cultivating cellulose applicable to the textile industry through greater use of biomaterials of which BC is but one potential source.

This thesis has contributed to a community of practitioners designing in collaboration with biological systems in the field of biodesign. While this research was primarily about developing my interdisciplinary practice and deepening my understanding of the complex issues related to mitigating the environmental impact of textile products, I acknowledge that for meaningful change to happen, new research-based innovations must be applied to industry, communities and real world systems with multiple stakeholders.

Through this research journey, I have shifted my focus from contributing to the vernacular of fashion and textile design, to a deeper comprehension of how laboratory- based practice methods can provide a new toolkit for designers to produce materials and products that seek to disrupt the incumbent modes, methods and technologies that dominate textile-based products.

Textile waste is a local, national and global problem, and I strongly urge textile producers to undertake a thorough analysis of waste streams to scaffold a global agenda that seeks to shift the textile industry away from environmental impacts and toward more cyclical and sustainable approaches. This likely requires both top down and bottom up approaches, that may need to start with municipalities developing textile waste recycling facilities that operate with the efficiency that other prevalent forms of consumer waste are afforded including paper, plastic, metal and glass. For example, the research I undertook whereby I experimentally cultivated biomaterials that were fed with locally available foodwaste, that could then be biodegraded at end of life utilising cellulose-metabolising fungi could be further developed into a closed- loop system for developing and recycling textiles within bioregions.

There is also great potential for state and federal governments to legislate policy regarding which textiles can be traded, used, and how they can be disposed of at end of life. Academic researchers, designers, textile companies, NGOs, and waste management communities can also collaborate to develop fit for purpose solutions, all of whom may find value in some of the provocations put forward in this thesis.

Alexander 'Alexi' Freeman, September 2021

128

REFERENCES

Abbas, M., (2018). Genetically Engineered (modified) Crops (Bacillus thuringiensis crops) and The World Controversy On Their Safety, Egypt. Journal of Biological Pest Control, 28, p. 52. Andersen, H., Hepburn, B., (2020). "Scientific Method", The Stanford Encyclopedia of Philosophy (Winter 2020 Edition), Edward N. Zalta (ed.). https://plato.stanford.edu/archives/ win2020/entries/scientific-method/>.

Agency for Toxic Substances & Disease Registry, (2014). (Retrieved July 15, 2021). https://www. atsdr.cdc.gov/MMG/MMG.asp?id=1141&tid=249

Andrews, K., Bullen, J., (2017). Endocrine- disrupting chemicals: Is your home making you sick? (Retrieved December 15, 2020). https:// www.abc.net.au/news/science/2017-05-20/ endocrine-disrupting-chemicals-is-your- home-making-you-sick/8536926

A & G Engineering, (2020). Stainless Steel Wine Storage And Fermentation Tanks. (Retrieved June 19, 2021). https:// www.agengineering.com.au/stainless-steel- wine-storage-and-fermentation-tanks/

Anguelov, N., (2016). The Dirty Side of the Garment Industry: Fast Fashion and Its Negative Impact on Environment and Society. CRC Press. https://doi-org. ezproxy.lib.rmit.edu.au/10.1201/b18902 Ahmed, N., (2012). Textiles: types, uses, and production methods, Nova Science Publishers.

Ahram, Y., Slow Factory Foundation, (2020). Fast Fashion Is A Feminist Issue, teenvogue. (Retrieved Nov 15, 2020). https://www.teenvogue. com/story/fast-fashion-is-a-feminist-issue

Ansari, J., (2017). Bottoms up! Discover the Microbes in Probiotic Drinks, American Society for Microbiology. https://www.asm.org/Articles/2017/ August/bottoms-up-discover-the-microbes-in- probiotic-drin#:~:text=Bacillus%20coagulans,of%20 bacteria%20and%20yeast%E2%80%9D)

Alavanja, M., (2009). Introduction: Pesticides use and exposure is extensive worldwide. Reviews on environmental health, 24(4), 303–309. https://doi.org/10.1515/reveh.2009.24.4.303

Aryal, S., (2019). Potato Dextrose Agar (PDA)- Principle, Uses, Composition, Procedure and Colony Characteristics. https://microbiologyinfo. com/potato-dextrose-agar-pda-principle-uses- composition-procedure-and-colony-characteristics/

Albu, M.G., Vuluga, Z., Panaitescu, D., (2014). Morphology and thermal stability of bacterial cellulose/collagen composites. Central European Journal of Chemistry, 12, 968–975. https://doi.org/10.2478/s11532-014-0545-z

Alexander, D., (1996). Bioregionalism: The Need For a Firmer Theoretical Foundation, Trumpeter, University of Waterloo, ISSN: 0832-6193 Aslanli, A., Stepanov, N., Razheva, T., Podorozhko, E., Lyagin, I., Lozinsky, V., Efremenko, E., (2019). Enzymatically Functionalized Composite Materials Based on Nanocellulose and Poly(Vinyl Alcohol) Cryogel and Possessing Antimicrobial Activity. Materials (Basel, Switzerland), 12(21), 3619. https://doi.org/10.3390/ma12213619

Atwood, M., (2012). Rachel Carson's Silent Spring, 50 years on. https://www.theguardian.com/ books/2012/dec/07/why-rachel-carson-is-a-saint Alkhatib, Y., Blume, G., Kralisch, D., & Fischer, D., (2018). Challenging the hydrophilicity of natural bacterial nanocellulose for dermal applications, Gesellschaft für Dermopharmazie, Seminaris Campus Hotel, Berlin.

Australian Pesticides and Veterinary Medicines Association (APVMA), (2017). Final regulatory position: Consideration of the evidence for a formal reconsideration of glyphosate. https://apvma.gov.au/node/13891

Almeida, D., Prestes, R., Fonseca, A., Woiciechowski, A., Wosiacki, G., (2013). Minerals consumption by Acetobacter xylinum on cultivation medium on coconut water. Brazilian Journal of Microbiology, 44(1), 197-206. https:// dx.doi.org/10.1590/S1517-83822013005000012

129

Ambrose, J., (2019). Renewable energy to expand by 50% in next five years, https:// www.theguardian.com/environment/2019/ oct/21/renewable-energy-to-expand- by-50-in-next-five-years-report Augimeri, R., Strap, J., (2015). The Phytohormone Ethylene Enhances Cellulose Production, Regulates CRP/FNRKx Transcription and Causes Differential Gene Expression within the Bacterial Cellulose Synthesis Operon of Komagataeibacter (Gluconacetobacter) xylinus ATCC 53582. Frontiers in Microbiology, 6(1282). https://doi.org/10.3389/fmicb.2015.01459

Biello, D., (2010). Slick Solution: How Microbes Will Clean Up the Deepwater Horizon Oil Spill. https://www.scientificamerican.com/ article/how-microbes-clean-up-oil-spills/

Augimeri, R. V., Varley, A. J., & Strap, J. L. (2015). Establishing a role for bacterial cellulose in environmental interactions: Lessons learned from diverse biofilm producing proteobacteria. Frontiers in Microbiology, 6(1282). https://doi-org. ezproxy.lib.rmit.edu.au/10.3389/fmicb.2015.01282

Bismarck, A., Mishra, S., & Lampke, T. (2005). Plant fibres as reinforcement for green composites. In Natural fibres, biopolymers, and biocomposites (pp. 52-128). CRC Press. Aziz, A., (202). Milk or Casein Fibre: An Overview. https://www.textileblog.com/ milk-or-casein-fiber-an-overview/

Blanc, P., (1996). Characterization of the tea fungus metabolites. Biotechnology Letters. 18 (2): 139–142. https://doi:10.1007/BF00128667.

Bäckdahl, H., Helenius, G., Bodin, A., Nannmark, U., Johansson, B., Risberg, B., Gatenholma, P., (2006). Mechanical properties of bacterial cellulose and interactions with smooth muscle cells. Biomaterials 27, 2141–2149. https://doi. org/10.1016/j.biomaterials.2005.10.026 Boekhoff, K., (1996). Structural Fabric Design http://schwartz.eng.auburn. edu/polyester/history.html

Bartl, A., (2011). Waste: Textile Waste, A Handbook for Management, Academic Press, Pages 167-179. https://doi.org/10.1016/B978-0-12-381475-3.10012-9 Blackburn, R., (2015). In Woodhead Publishing Series in Textiles, Sustainable Apparel, Woodhead Publishing, Pages i-iii. https://doi. org/10.1016/B978-1-78242-339-3.09987-8.

Blocktexx, (2020). Monetising textile waste is the fashion industry’s new frontier. https://www.blocktexx.com/about Beadle, A.,(2018). The Hemp Farm Bill passes Congress with ease, Analytical Cannabis: Extraction, science, testing, https://www. analyticalcannabis.com/articles/the-2018- farm-bill-what-this-means-for-hemp-311394

Bomgardner, M., (2018). These new textile dyeing methods could make fashion more sustainable, Vol 96, Issue 29.

Bell, S., (2010). Victimless Leather—A Prototype of Stitch-less Jacket grown in a Technoscientific “Body”. In: Scapp, R., Seitz B. (eds) Fashion Statements. Palgrave Macmillan, New York. https://doi.org/10.1057/9780230115408_9

Boström, M., Micheletti, M. Introducing the Sustainability Challenge of Textiles and Clothing. Journal of Consumer Policy 39, 367–375 (2016). https://doi.org/10.1007/s10603-016-9336-6

Bouril, T., (1997). Marijuana and Hemp: The Untold Story, Cannabis Action Network. https:// www.hempcar.org/untoldstory/hemp_5.html Bellon, T., (2019). California jury hits Bayer with a $2 billion award in Roundup cancer trial. US Legal News. (Retrieved Aug 23, 2020). https:// www.reuters.com/article/us-bayer-glyphosate- lawsuit/california-jury-hits-bayer-with-2-billion- award-in-roundup-cancer-trial-idUSKCN1SJ29F

Branwyn, G., (2018). Making Faux Leather from Kombucha, Makezine. https:// makezine.com/2018/03/01/making- faux-leather-from-kombucha/ Bendix, A., (2019). 7 toxic chemicals hiding in your waterproof, stain-resistant and wrinkle-free clothes. https://www.businessinsider.com.au/toxic- chemicals-in-clothes-cancer-2019-7?r=US&IR=T

Benyus, J., (1997). Biomimicry: Innovation Inspired By Nature, Perennial, New York

Brigden, K., Labunska, I., House, E. Santillo, D., Johnston, P., (2012). Hazardous chemicals in branded textile products on sale in 27 places during 2012, Greenpeace Research Laboratories Technical Report 06/2012.

Bergman, Å., Heindel, J., Jobling, S., Kidd, K., Zoeller, R.T., (2013). State of the science of endocrine-disrupting chemicals, 2012, Toxicology Letters. United Nations Environment Programme and the World Health Organization, New York and Geneva. doi:10.1016/j.toxlet.2012.03.020 Brones, A., (2017), Upcycled Coffee Textiles: Out Of The Garbage Can And Into The Dyer, Sprudge. https://sprudge.com/can-you- wear-the-coffee-you-drink-125116.html

130

Bick, R., Halsey, E., Ekenga, C., (2018). The global environmental injustice of fast fashion. Environ Health 17, 92. https:// doi.org/10.1186/s12940-018-0433-7 Brown, A., (1887). XLIII: On an Acetic Ferment Which Forms Cellulose, Journal of the Chemical Society, Transactions, Volume 49, 172, 432; 51,643. https://doi.org/10.1039/CT8864900432

Chand, N., Fahim, M., (2008). Tribology of Natural Fiber Polymer Composites, Researchgate, North South University. https:// doi.org/10.1533/9781845695057.108 Brown, R., (2004). Cellulose structure and biosynthesis: what is in store for the 21st century? Journal of Polymer Science, Part A: Polymer Chemistry., 42, pp. 487- 495, https://doi.org/10.1002/pola.10877

Britannica, The Editors of Encyclopaedia (2021, May 8). Anselme Payen. Encyclopedia Britannica. https://www.britannica. com/biography/Anselme-Payen

Chan, E., (2019). How Sustainable is Organic Cotton Really, Vogue.com.au https://www. vogue.com.au/fashion/news/how-sustainable- is-organic-cotton-really/image-gallery c60f8278705a7b76f2fafd069#:~:text=It%20 isn't%20completely%20eco,produces%20 fewer%20greenhouse%20gas%20 emissions.&text=According%20to%20the%20 WWF%2C%20it,make%20just%20one%20T%2Dshirt. Britannica, The Editors of Encyclopaedia (2021, June 28) DuPont Company. https:// www.britannica.com/topic/DuPont-Company

Bureau of Meteorology (2020). Australian Weather Calendar, Australian Government. http:// www.bom.gov.au/calendar/annual/climate.shtml

Chand, N., Fahim, M., (2008). Tribology of Natural Fiber Polymer CompositesWoodhead Publishing Series in Composites Science and Engineering, Elsevier, pages 1-58. https://doi.org/10.1533/9781845695057.1 Cadbury, D., (1997), The Feminisation of Nature: Our Future at Risk, Penguin Group.

Cambridge University Press, (2020). Sustainable, Cambridge Dictionary. https://dictionary. cambridge.org/dictionary/english/sustainable Chand, S., (2020). Leading Producers of Cotton Yarn in the World. (Retrieved June 29, 2021). https://www.yourarticlelibrary. com/industries/leading-producers-of- cotton-yarn-in-the-world/25406

Chen, C., Li, Y., Xu Z., (2010), Chemical principles and bioactivities of blueberry, 45(4):422-9 https:// www.ncbi.nlm.nih.gov/pubmed/21355205

Campano, C., Merayom, N., Negro, C., Blanco, A., (2018). In Situ Production of Bacterial Cellulose to Economically Improve Recycled Paper Properties, International Journal of Biological Macromolecules, 118(Pt B), https:// doi.org/10.1016/j.ijbiomac.2018.06.201

Chen, J., (2015). Synthetic Textile Fibers in Textiles and Fashion, Woodhead Publishing. https://doi.org/10.1016/C2013-0-17410-7

Canali, M., Amani, P., Aramyan, L., Gheoldus, M., Moates, G., Östergren, K., Silvennoinen, K., Walon, K., & Vittuari, M. (2017). Food waste drivers in Europe, from identification to possible interventions. Sustainability (Basel, Switzerland), 9(1), 37–37. https://doi.org/10.3390/su9010037 Cheng, K., Catchmark, J., Demirci, A.,(2009). Enhanced production of bacterial cellulose by using a biofilm reactor and its material property analysis. Journal of Biological Engineering, 3, 12. https://doi.org/10.1186/1754-1611-3-12

Chi, T., (2011). Building a sustainable supply chain: an analysis of corporate social responsibility (CSR) practices in the Chinese textile and apparel industry. Journal of Textiles Institute, 102, 837–848.

Cataldo, C. G. (2009). Cultivating Communities of Practice: A Guide to Managing Knowledge, by Wenger, E., McDermott, R., Snyder, W., Boston, MA: Harvard Business School Press, 2002. 284 pages, hardcover. Academy of Management Learning & Education, 8(2), 301–303. https:// doi.org/10.5465/amle.2009.41788855

Choi, C., (2017). How Did Multicellular Life Evolve? Astrobiology at NASA, Life In The Universe. https://astrobiology.nasa.gov/ news/how-did-multicellular-life-evolve/

Centre for Disease Control and Prevention (CDCP), (2017), Phthalates Fact Sheet, National Biomonitoring Program. https://www.cdc.gov/ biomonitoring/Phthalates_FactSheet.html

Choi, S., Shin, E., (2020). The Nanofication and Functionalization of Bacterial Cellulose and Its Applications. Nanomaterials, 10, 406. https://doi.org/10.3390/nano10030406

Chan, C., Shin, J., Jiang, S. (2018). Development of Tailor-Shaped Bacterial Cellulose Textile Cultivation Techniques for Zero-Waste Design. Clothing and Textiles Research Journal, 36(1), 33-44. https://doi.org/10.1177/0887302X17737177 Choudhury, A., (2017). Principles of Textile Finishing. Elsevier Science & Technology. https:// doi.org/10.1016/B978-0-08-100646-7.00001-1

131

Chana, A., (2020), Synthetic vs. Natural Fabrics in Clothing. https://www.attiremedia. com/articles/synthetic-vs-natural-fabrics

Culter, C., (2020). The Next Green Revolution, National Geographic https://www.nationalgeographic.com/ foodfeatures/green-revolution/ Chojnacka, K., (2010). CHEMICAL ENGINEERING AND CHEMICAL PROCESS TECHNOLOGY – Volume V: Chemical Engineering Education and Main Products, Fermentation Products, Encyclopedia of Life Support Systems (EOLSS)

Cirino, E., (2018). The Environment’s New Clothes: Biodegradable Textiles Grown from Live Organisms https://www.scientificamerican. com/article/the-environments-new-clothes- biodegradable-textiles-grown-from-live-organisms/ Daba Wami, S., Chercos, D., Dessie, A., (2018). Cotton dust exposure and self- reported respiratory symptoms among textile factory workers in Northwest Ethiopia: a comparative cross-sectional study. Journal of Occupational Medicine and Toxicology. 13, 13 https://doi.org/10.1186/s12995-018-0194-9

Clarke, C., (2017). The Most Toxic Pesticide You've Never Heard Of, Kcet.org https:// www.kcet.org/shows/earth-focus/the-most- toxic-pesticide-youve-never-heard-of Dauvergne, P., (2008). The Shadows of Consumption: Consequences for the Global Environment. Cambridge MA: The MIT Press.

Claudio L. (2007). Waste couture: environmental impact of the clothing industry. Environmental health perspectives, 115(9), A448–A454. https://doi.org/10.1289/ehp.115-a449 Delmer, D., (1999). Cellulose biosynthesis: exciting times for a difficult field of study. Annual Review of Plant Biology, 50(1), 245-276. https://doi.org/10.1146/annurev.arplant.50.1.245

Cogdell, C. (2011). From BioArt to BioDesign. American Art, 25(2), 25–29. https://doi.org/10.1086/661966 Dietz, D., (2013). Protecting Our Planet and Protecting Ourselves: The Importance of Organic Cotton

Down to Earth (DTE), (2019). Fashion Industry May Use A Quarter of the World's Carbon Budget by 2050. https://www.downtoearth.org.in/news/ environment/fashion-industry-may-use-quarter- of-world-s-carbon-budget-by-2050-61183 Collet, C., (2012). Studies in Material Thinking, BioLace: An Exploration of the Potential of Synthetic Biology and Living Technology for Future Textiles. http://www.materialthinking. org Vol. 7,Where Art, Technology and Design Meet. ISSN 1177-6234, AUT University

Conaway, M., (2018). H.R.2 - Agriculture Improvement Act of 2018, Congress.gov, https:// www.congress.gov/bill/115th-congress/house-bill/2 Drennan, K., (2015). How the Fashion Industry is Picking Up the Threads After Rana Plaza, Alternatives Journal https://www. alternativesjournal.ca/policy-and-politics/how- fashion-industry-picking-threads-after-rana-plaza

Costa, A., Almeida, F., Vinhas, G., Sarubbo, L., (2017). Production of Bacterial Cellulose by Gluconacetobacter hansenii Using Corn Steep Liquor As Nutrient Sources, Frontiers in Microbiology, Vol.8. https:// doi.org/10.3389/fmicb.2017.02027 DTIE, United Nations Environment Program Chemicals Branch,(2011). The Chemicals in Products Project: Case Study of the Textiles Sector. http://www.health.gov.vc/health/images/PDF/ cip_textile_case_study_report_21_feb_2011.pdf

Cotton Australia, (2020). Biotechnology and cotton. https://cottonaustralia.com.au/fact-sheet

Dufresne, A., (2018). Nanocellulose: From Nature to High-Performance Tailored Materials. The International School of Paper, Print media and biomaterials. (Second edition.). De Gruyter. https://doi.org/10.1515/9783110480412 Cotton Australia, (2020). Where is Cotton Grown? https://cottonaustralia. com.au/where-is-cotton-grown

Dufresne, C., Farnworth, E., (2000). Tea, kombucha, and health: a review. Food Research International, 33:409–21. https:// doi.org/10.1016/S0963-9969(00)00067-3

Cox, D., (2019). The Roundup row: is the world’s most popular weed killer carcinogenic? https://www.theguardian.com/ environment/2019/mar/09/spray-pray-is-roundup- carcinogenic-monsanto-farmers-suing

Dutta, D., Gachhui, R., (2007). Nitrogen-fixing and cellulose-producing Gluconacetobacter kombuchae isolated from Kombucha tea, International Journal of Systematic and Evolutionary Microbiology, 57, 353–357. https://doi.org/10.1099/ijs.0.64638-0

132

Colborn, T., vom Saal, FS., Soto, A., (1993). Developmental effects of endocrine- disrupting chemicals in wildlife and humans, Environmental Health Perspect. 101 (5): 378–84. https://doi.org/10.2307/3431890.

Dutta, D., Gachhui, R., (2006). Novel nitrogen- fixing Acetobacter nitrogenifigens isolated from Kombucha tea. International Journal of Systematic and Evolutionary Microbiology, 56, 1899–1903.

Entine, J., Ryan, C., (2014). Vandana Shiva, Anti-GMO Celebrity: 'Eco Goddess' Or Dangerous Fabulist, Science & Technology, https:// www.forbes.com/sites/jonentine/2014/01/29/ vandana-shiva-anti-gmo-celebrity-eco-goddess- or-dangerous-fabulist/#259f735b1c47

DuVall, E., (2017). U.N. report estimates pesticides kill 200,000 people per year https:// www.upi.com/Top_News/World-News/2017/03/09/ UN-report-estimates-pesticides-kill- 200000-people-per-year/1161489037649/

Environmental Safety and Health Group, (2020). Carbon Dioxide: Health Hazard Information Sheet. (Retrieved July 15, 2021). https://www.fsis.usda. gov/wps/wcm/connect/bf97edac-77be-4442-aea4- 9d2615f376e0/Carbon-Dioxide.pdf?MOD=AJPERES

Eastman (2021). About Eastman. (Retrieved Aug 15, 2021). https://www.eastman.com/Company/ About_Eastman/Pages/Introduction.aspx

Fairbrother, R., (1970), Fairbrother's Textbook of Bacteriology, Chapter V Bacterial Growth and Multiplication, William Heinemann Medical Books LTD, Elsevier. https://doi. org/10.1016/B978-0-433-10100-0.50009-1

Eastman Naia, (2020). Eastman Naia and DuPont biomaterials collaborate on sustainable fabric. https://www.eastman.com/Company/News_ Center/2020/Pages/Eastman-Naia-and-DuPont- biomaterials-collaborate-sustainable-fabric.aspx

Farmers, (2019). Glyphosate lawsuit reaches Australian soil. (Retrieved Aug 14, 2021). https://farmers.org.au/news/glyphosate- lawsuit-reaches-australian-soil/

European Chemicals Agency (ECHA), (2016). Annex XV Restriction report proposal for a restriction substance names: four phthalates (DEHP, BBP, DBP, DIBP). Helsinki, Finland.

Farrelly, L., (2017). How Does Mold Grow on Cheese? (Retrieved July 15, 2021). https://sciencing. com/why-does-mold-grow-food-4966797.html

Ecocult, (2018). What’s the Difference Between Green, Sustainable, Eco-Friendly, Ethical, Fair Trade, Clean, Organic, Non-Toxic, and Conscious? https://ecocult.com/whats-the-difference- between-green-sustainable-eco-friendly-ethical- fair-trade-clean-organic-non-toxic-and-conscious/ Federal Register of Legislation (FRL), (1994). Plant Breeders’ Rights Act 1994, Australian Government. (Retrieved Aug 16, 2021). https:// www.legislation.gov.au/Details/C2019C00089

Ecolabel Index, (2020). Textile Ecolabels http://www.ecolabelindex.com/ ecolabels/?search=textile&as_values_089=

Ferreira, L., Sánchez-Juanes, F., García-Fraile, P., Rivas, R., Mateos, P., Martínez-Molina, E., (2011). MALDI-TOF Mass Spectrometry Is a Fast and Reliable Platform for Identification and Ecological Studies of Species from Family Rhizobiaceae. PLoS ONE 6(5): e20223. https:// doi.org/10.1371/journal.pone.0020223 Edelstein, M., (2012). Disaster By Design: The Aral Sea and its Lessons for Sustainability. Research in Social Problems and Public Policy, Emerald Publishing.

Finlay, V., (2003). Colour: Travels Through the Paintbox. Hodder & Stoughton. (Retrieved Aug 15, 2020). https://www.bookdepository. com/Colour-Victoria-Finlay/9780340733295 Eisen, M., (2012). #GMOFAQ How Bt Corn And Roundup Ready Soy Work, And Why They Should Not Scare You http:// www.michaeleisen.org/blog/?p=1135

Ellenby, D., (2019). The five: new uses for bacteria https://www.theguardian.com/ technology/2019/jul/21/five-new-uses-for-bacteria- graphene-plastic-waste-oil-spills-tumours Fletcher, K. (2008). Sustainable Fashion and Textiles: Design Journeys. https://www.semanticscholar.org/paper/ Sustainable-Fashion-and-Textiles%3A-Design- Journeys-Fletcher/6730caf438ce62ecd98c11dc92f70 06268b9cc61?citationIntent=result#citing-papers

Engelhardt, J., (1995). Sources, industrial derivatives and commercial application of cellulose. Carbohydr Eur, 12, 5-14. Fletcher, K., (2007). Slow Fashion. (Retrieved June 29, 2021). https://theecologist. org/2007/jun/01/slow-fashion

133

Fletcher, K., (2018). Towards a Future Framework for Fashion. https://katefletcher. com/towards-a-future-framework-for-fashion/ Ellen MacArthur Foundation (EMA), (2017). A new textiles economy: Redesigning fashion’s future http://www. ellenmacarthurfoundation.org/publications

Fletcher, K., & Tham, M., (2015). The new synthetics: could synthetic biology lead to sustainable textile manufacturing? Routledge Handbook of Sustainability and Fashion (pp. 209–218). Routledge. https:// doi.org/10.4324/9780203519943-31 Gallegos, A., Sonia Herrera, S., Roberto, C., Roberto, P., Iqbal, H., (2016). Bacterial Cellulose: A Sustainable Source to Develop Value-Added Products – A Review. Project: PhycoPigments: Novel manufacturing methods for high value pigments products from microalgae, Bioresources 11(2):5641- 5655. https://doi.org/10.15376/biores.11.2.Gallegos

Gambino, M. (2013). The beauty of life: from a bunny that glows to a cathedral that grows, artists are borrowing from biology to create dazzling “biodesigns” that challenge our aesthetics--and our place in nature. Smithsonian, 43(11), 66.

Flint, D., (1996). Escherichia coli contains a protein that is homologous in function and N-terminal sequence to the protein encoded by the nifS gene of Azotobacter vinelandii and that can participate in the synthesis of the Fe-S cluster of dihydroxy- acid dehydratase. Journal of Biological Chemistry. 271(27):16068-74. PMID: 8663056.

Folger, T., (2014). The Next Green Revolution. https://www.nationalgeographic.com/ foodfeatures/green-revolution/ Gao, Q., Shen, X., Lu, X., (2011). Regenerated bacterial cellulose fibers prepared by the NMMO·H2O process, Carbohydrate Polymers, Elsevier. https:// doi.org/10.1016/j.carbpol.2010.09.029

Forsdyke, G., (2020). A Brief History of the Sewing Machine. http://ismacs. net/sewing_machine_history.html

García-Sánchez, M.E., Robledo-Ortíz, J.R., Jiménez-Palomar, I., González-Reynoso, O., González-García, Y., (2020), Production of bacterial cellulose by Komagataeibacter xylinus using mango waste as an alternative culture medium, Revista Mexicana de Ingeniería Química, 19 (2), pp. 851-865. https://doi.org/10.24275/rmiq/Bio743 Fortenbery, T., (2014). Industrial Hemp: Opportunities and Challenges for Washington, Thomas B. Mick Endowed Chair, School of Economic Sciences.

Garrity, G.M., Bell, J., Lilburn, T.G., Lansing, E., (2004). Taxonomic outline of the prokaryotes. Bergey’s Manual Syst. Bacteriol:1–399.

Fortune, (2021), Cellulose Market, https:// www.fortunebusinessinsights.com/cellulose- market-102062Franklin, D. (2009). DONNA FRANKLIN. Leonardo (Oxford), 42(5), 389–389. https://doi.org/10.1162/leon.2009.42.5.389

Ge, W., Haitao, C., Genlin, T., (2010). Structures of Bamboo Fibers for Textiles, Textile Research Journal Vol 80(4): 334–343. https://doi.org/ 10.1177/0040517509337633

Franklin, D., (2016). Donna Franklin - Creatures of The Future Garden (Exhibition at Spectrum Project Space, Edith Cowan University, Perth, Western Australia, June 21-30, 2012). https:// www.ddca.edu.au/events/event-media/2016/6/9/ dr-donna-franklin-creatures-of-the-future-garden Gemser, G., Bont, C., (2016), Research: A Study of Publication Patterns in Design Journals. https://doi.org/10.1016/j.sheji.2016.05.002

Franklin, D., (2012). PUBLIC TALK: Donna Franklin: CREATURES OF THE FUTURE GARDEN. https:// events.uwa.edu.au/event/20120716T06003 3Z-1691-2624@events.uwa.edu.au/whatson/cultural Gest, H., (2004). The Discovery of Microorganisms by Robert Hooke and Antoni Van Leeuwenhoek, Fellows of the Royal Society, 58(2):187-201. https://doi.org/10.1098/rsnr.2004.0055

Frosch, R., and Gallopoulos, N., (1989). Strategies for manufacturing. Scientific American 261(3):144-152.

Giacomin, A. M., Garcia, J. B., Zonatti, W. F., Silva- Santos, M. C., Laktim, M. C., & Baruque-Ramos, J. (2017). Silk industry and carbon footprint mitigation. IOP Conference Series. Materials Science and Engineering, 254(19), 192008–. https:// doi.org/10.1088/1757-899X/254/19/192008

Ginsberg, A., (2021). Talks. (Retrieved Dec 2, 2021) https://www.daisyginsberg.com/talks.php

Gaggìa, F., Baffoni, L., Galiano, M., Nielsen, D. S., Jakobsen, R. R., Castro-Mejía, J. L., Bosi, S., Truzzi, F., Musumeci, F., Dinelli, G., & Di Gioia, D. (2019). Kombucha beverage from green, black and rooibos teas: A comparative study looking at microbiology, chemistry and antioxidant activity. Nutrients, 11(1), 1–. https://doi.org/10.3390/nu11010001

Ginsberg, A., Chieza, N., (2018). Editorial: Other Biological Futures, Journal of Design and Science. (Retrieved Dec 2, 2021) https://jods.mitpress. mit.edu/pub/issue4-ginsberg-chieza/release/5

134

Gallagher, C., (2019). Obsessive Consumption Disorder. https://www.fashionrevolution. org/obsessive-consumption-disorder/

Givhan, R. (2019). The Troubling Ethics of Fashion in the Age of Climate Change, The Washington Post. (Retrieved July 26, 2020). https://www. washingtonpost.com/magazine/2019/11/18/ troubling-ethics-fashion-age-climate-change/ Hall, L., Burton, D., Graves, W., Margrey, S. (1981). Effects of dechlorination on early life stages of striped bass (Morone saxatilis). Environmental science & technology, 15(5), 573–578. https://doi.org/10.1021/es00087a009

Goodman, E., (2021). BIODESIGN IS THE NEWEST TECHNOLOGY IN SUSTAINABLE FASHION. (Retrieved Aug 25, 2020). https:// bricksmagazine.co.uk/2021/02/19/biodesign- newest-technology-in-sustainable-fashion/ Hamblin, J., (2016). Is Fermented Tea Making People Feel Enlightened Because of Alcohol? The Atlantic. (Retrieved Aug 15, 2021). https:// www.theatlantic.com/health/archive/2016/12/ the-promises-of-kombucha/509786/

Gorgieva, S., & Trček, J. (2019). Bacterial Cellulose: Production, Modification and Perspectives in Biomedical Applications. Nanomaterials, 9(10), 1352. https://doi.org/10.3390/nano9101352

Hartline, N.L., Bruce, N.J., Karba S.N., Ruff, E.O., Sonar, S.U., Holden, P.A., (2016). Microfiber Masses Recovered from Conventional Machine Washing of New or Aged Garments, Environmental Science & Technology, Vol. 50, No.21, pp.11532-11538"

Gough, P., Forman, J., Pataranutaporn, P., Hepburn, L-A., Ramirez-Figueroa, C., Cooper, C., Vujic, A., Kong, D., Kim, R., Maes, P. , Ishii, H., Sra, M., Ahmadpour, N., (2021). Speculating on Biodesign in the Future Home. https://doi.org/10.1145/3411763.3441353 Hawley, J., (2006). Digging for diamonds: a conceptual framework for understanding reclaimed textile products. Clothing and Textiles Resource Journal 24 (3), 262–275.

Hawke, E., (2019). Theo Colborn: a pioneer in identifying the problems caused by endocrine disrupting chemicals. https:// chemtrust.org/dr-theo-colborn/ Gullo, M., Giudici, P., (2008). Acetic acid bacteria in traditional balsamic vinegar: phenotypic traits relevant for starter cultures selection. International Journal of Food Microbiology. 125:46– 53. https://doi.org/10.1016/j.ijfoodmicro.2007.11.076

Global Fashion Agenda (GFA), (2019). Pulse of the Fashion, Boston Consulting Group, Sustainable Apparel Coalition, Copenhagen. Heiss, L., (Doctoral Thesis, 2018). Designing Emotional Technologies, School of Fashion and Textiles, College of Design and Social Context, RMIT University.

Hemp Victoria, (2020). Welcome to Hemp Victoria https://hempvictoria.org.au/

Grey, S, (2020). Kombucha Leather: Your Guide To SCOBY Leather. (Retrieved August 8, 2021). https://growyourpantry.com/blogs/kombucha/ kombucha-leather-your-guide-to-scoby-leather

Hesseltine, C., (1965). A millennium of fungi. Food and fermentation. Mycologia 57:148–67. https://doi.org/10.1080/00275514.1965.12018201

Grushkin, D., (2015). Meet Woman Who Wants Growing Clothing Lab (Retrieved March 5,2020). https://www.popsci.com/meet- woman-who-wants-growing-clothing-lab/

Hestrin, S., Schramm, M., (1954). Synthesis of cellulose by Acetobacter xylinum. II. Preparation of freeze-dried cells capable of polymerizing glucose to cellulose. Biochemistry Journal, 58, 345–52.

Gupta, B., (2013), Manufacture, types and properties of biotextiles for medical applications, Biotextiles as Medical Implants, Woodhead Publishing Series in Textiles, Pages 3-47 https://doi.org/10.1533/9780857095602.1.3

Hestrin, S., Schramm, M., (1954). Factors affecting production of cellulose at the air/liquid interface of a culture of Acetobacter xylinum, Journal of Genetic Microbiology, 11, 123–129. https://doi.org/10.1099/00221287-11-1-123

Gupta, D., Gulrajani, M., (2015). Self cleaning finishes for textiles, Functional Finishes for Textiles: Improving Comfort, Performance and Protection, Woodhead Publishing Series in Textiles, Pages 257-281 https:// doi.org/10.1533/9780857098450.1.257 Hines, T., & Bruce, M., (2007). Globalization: Global markets and global supplies, Fashion Marketing Contemporary Issues 2nd Edition. Oxford, Elsevier.

Haines, B.M., Barlow, J.R., (1975). The anatomy of leather. J Mater Sci 10, 525–538. https://doi.org/10.1007/BF00543698 Hirsh, S., (2019) Desserto’s Cactus Leather Is The Newest Eco-friendly fabric. https://www. greenmatters.com/p/vegan-cactus-leather-desserto

135

Hitti, N., (2019). Central Saint Martins Launches Masters in Biodesign. https:// www.dezeen.co.uk/2019/05/21/Central- saints-martins-biodesign-ma/amp/

Höflinger, G., (2013), Leica Microsystems https://www.leica-microsystems.com/ science-lab/brief-introduction-to-coating- technology-for-electron-microscopy/ Isik, Z., Ünyayar, A., Dizge, N., (2018). Filtration and Antibacterial Properties of Bacterial Cellulose Membranes for Textile Wastewater Treatment. https://doi.org/10.15171/ajehe.2018.14

Iverson, JO (2011) Knowledge, belonging, and Communities of Practice. In: Canary, HE, McPhee, RD (eds) Communication and Organizational Knowledge: Contemporary Issues for Theory and Practice. New York: Routledge, 45–52.

Jung, H.-I., Lee, O.-M., Jeong, J.-H., Jeon, Y.-D., Park, K.-H., Kim, H.-S., An, W.-G., & Son, H.-J. (2010). Production and Characterization of Cellulose by Acetobacter sp. V6 Using a Cost- Effective Molasses–Corn Steep Liquor Medium. Applied Biochemistry and Biotechnology, 162(2), 486–497. https://doi.org/10.1007/s12010-009-8759-9

James, R., (2009). Dechlorination by ultraviolet radiation: a suitable alternative to activated carbon in dialysis water systems? Journal of renal care, 35(4), 205–210. https://doi. org/10.1111/j.1755-6686.2009.00117.x

Hong, S., Kwon, S., Kim, S., Kim, S., Kim, J., Lee, J., Oh, M., Kim, A., Chung, K., (2014). Bacillus oryzaecorticis sp. nov., a moderately halophilic bacterium isolated from rice husks. International Journal of Systematic and Evolutionary Microbiology, 64:2786-2791. https://doi.org/10.1099/ijs.0.058768-0

Jansen, K., (2019). ‘Forever Chemicals’ No More? These technologies aim to destroy PFAS in water, Chemical & Engineering News, Volume 97, Issue 12. https://cen.acs.org/ environment/persistent-pollutants/Forever- chemicals-technologies-aim-destroy/97/i12

Hördt, A., López, M., Meier-Kolthoff, J., Schleuning, M., Weinhold, L-M., Tindall, B., Gronow, S., Kyrpides, N., Woyke, T., Göker, M., (2020). Analysis of 1,000+ Type-Strain Genomes Substantially Improves Taxonomic Classification of Alphaproteobacteria, Frontiers in Microbiology, Volume 11, https:// doi.org/10.3389/fmicb.2020.00468

Jayabalan, R., Malbaša, R., Lončar, E., Vitas, J., Sathishkumar, M., (2014). A Review on Kombucha Tea—Microbiology, Composition, Fermentation, Beneficial Effects, Toxicity, and Tea Fungus. Comprehensive Reviews in Food Science and Food Safety. 13 (4): 538–550. http://doi:10.1111/1541-4337.12073

Huang, L., Liu, Q., Sun, X., Li, X., Liu, M., Jia, S., Xie, Y., & Zhong, C. (2020). Tailoring bacterial cellulose structure through CRISPR interference mediated downregulation of galU in Komagataeibacter xylinus CGMCC 2955. Biotechnology and Bioengineering, 117(7), 2165–2176. https://doi.org/10.1002/bit.27351 Jayabalan, R., Malini, K., Sathishkumar, M., Swaminathan, K., Yun, S., (2010). Biochemical characteristics of tea fungus produced during kombucha fermentation. Food Science and Biotechnology, 19(3), 843-847. https:// doi.org/10.1007/s10068-010-0119-6

Jeyaratnam J. (1990). Acute pesticide poisoning: a major global health problem. World Health Stat Q. 43(3):139–144 Iqbal, N., Manalil, S., Chauhan, B., Adkins, S., (2019). Glyphosate-tolerant cotton in Australia: successes and failures, Archives of Agronomy and Soil Science, 65:11, 1536-1553, https:// doi.org/10.1080/03650340.2019.1566720

Ji, K., Wang, W., Zeng, B., (2016). Bacterial cellulose synthesis mechanism of facultative anaerobe Enterobacter sp. FY-07. Scientific Reports, 6, 21863 https://doi.org/10.1038/srep21863

International Agency for Research on Cancer, (2015). IARC Monographs Volume 112: evaluation of five organophosphate insecticides and herbicides https://www.iarc.fr/wp-content/ uploads/2018/07/MonographVolume112-1.pdf

Jiménez, G., Urdiain, M., Cifuentes, A., López-López, A., Blanch, A., Tamames, J., Kämpfer, P., Kolstø, A., Ramón, D., Martínez, J., (2013). Description of Bacillus toyonensis, a novel species of the Bacillus cereus group, Systems Applied Microbiology 36(6):383-91.

International Agency for Research on Cancer (2017). Some Organophosphate Insecticides and Herbicides. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans Volume 112. IARC. http://publications.iarc.fr/Book-And-Report- Series/Iarc-Monographs-On-The-Identification- Of-Carcinogenic-Hazards-To-Humans/Some- Organophosphate-Insecticides-And-Herbicides-2017

Johnston, R., Boddy, L., Weightman, A., (2016). Bacteria in decomposing wood and their interactions with wood-decay fungi, FEMS Microbiology Ecology, Volume 92, Issue 11, fiw179, https://doi.org/10.1093/femsec/fiw179

136

International Union for Conservation of Nature (IUCN), (2017). Primary microplastics in the oceans: A global evaluation of sources, p.21

Joseph, C., Kumar, G., Su, E., Bisson, L., (2007). Adhesion and biofilm production by wine isolates of Brettanomyces bruxellensis. American Journal of Enology and Viticulture, 58(3), 373-378. Kim, H., Kim, D., Lee, J., (2019). Effect of Wet Spinning and Stretching to Enhance Mechanical Properties of Cellulose Nanofiber Filament. Int. J. of Precis. Eng. and Manuf.-Green Tech. 6, 567–575. https://doi.org/10.1007/s40684-019-00070-z

Klemm, D., Heublein, B., Fink, H., Bohn, A., (2005). Cellulose: Fascinating Biopolymer and Sustainable Raw Material, Angewandte Chemie, Edition 44 (22): 3358–93. https:// doi.org/10.1002/anie.200460587 Jozala, A., de Lencastre-Novaes, L., Lopes, A., de Carvalho Santos-Ebinuma, V., Mazzola, P. G., Pessoa, A., Jr, Grotto, D., Gerenutti, M., Chaud, M., (2016). Bacterial nanocellulose production and application: a 10-year overview. Applied microbiology and biotechnology, 100(5), 2063– 2072. https://doi.org/10.1007/s00253-015-7243-4

Judelson, H., Ah-Fong, A., (2019). Exchanges at the Plant-Oomycete Interface That Influence Disease. https://doi.org/10.1104/pp.18.00979

Klemm, D., Kramer, F., Moritz, S., Lindström, T., Ankerfors, M., Gray, D., Dorris, A., (2011). Nanocelluloses: A New Family of Nature- Based Materials. Angewandte Chemie International Edition 50 (24): 5438–5466. https://doi.org/10.1002/anie.201001273.

Kadolph, S., Langford, A., (2013). Textiles: Pearson New International Edition, Pearson Education Limited

Klemm, D., Schumann, D., Udhardt, U., Marsch, S., (2001). Bacterial synthesized cellulose — artificial blood vessels for microsurgery. Progress in Polymer Science. 26 (9): 1561–1603. https://doi.org/10.1016/S0079-6700(01)00021-1

Kamiński, K., Jarosz, M., Grudzień, J. et al. Hydrogel bacterial cellulose: a path to improved materials for new eco-friendly textiles. Cellulose 27, 5353–5365 (2020). https://doi.org/10.1007/s10570-020-03128-3

Koller, M., (2019). DuPont's Sorona fabric is made from corn. (Retrieved Aug 30, 2021). https://www.outsidebusinessjournal.com/ issues/sustainability/dupont-sorona-fabric/

Kane, F., Shen, J., Morgan, L., Prajapati, C., Tyrer, J., & Smith, E. (2020). Innovative Technologies for Sustainable Textile Coloration, Patterning, and Surface Effects. In Sustainability in the Textile and Apparel Industries (pp. 99–127). Springer International Publishing. https://doi.org/10.1007/978-3-030-38545-3_4 Komagata, K., Iino T., Yamada, Y., (2014) The Family Acetobacteraceae. In: Rosenberg E., DeLong E.F., Lory S., Stackebrandt E., Thompson F. (eds) The Prokaryotes. Springer, Berlin, Heidelberg. https://doi.org/10.1007/978-3-642-30197-1_396

Kant, R., (2012). Textile dyeing industry an environmental hazard, Natural Science, Vol.4, No.1, 22-26. http://dx.doi.org/10.4236/ns.2012.41004

Kongruang, S., (2008), Bacterial cellulose production by Acetobacter xylinum strains from agricultural waste products. Applied Biochemistry and Biotechnology, 148:245–256. https://doi.org/10.1007/s12010-007-8119-6

Karanjekar, R., Bhatt, A., Altouqui, S., Jangikhatoonabad, N., Durai, V., Sattler, M., Sahadat-Hossain, M., Chen, V., (2015). Estimating methane emissions from landfills based on rainfall, ambient temperature, and waste composition: The CLEEN model, Waste Management, Volume 46, Pages 389-398. Kotula, I., Kotula, A., Rose, E., Pierson, C., Camp. M., (1997). Reduction of aqueous chlorine by organic material. Journal of Food Protection. 60:276-282. https:// doi.org/10.4315/0362-028X-60.3.276

Keist, C. N. (2009). Rayon and its impact on the fashion industry at its introduction, 1910- 1924. Iowa State University Digital Repository. https://doi.org/10.31274/etd-180810-1410

Kragh, H., (2017). Sulphuric acid was the bedrock of the Industrial Revolution: And is still used in fertilisers the world over today, Niels Bohr Institute, University of Copenhagen. https://sciencenordic.com/chemistry-denmark- researcher-zone/sulphuric-acid-was-the- bedrock-of-the-industrial-revolution/1450988

Kellhammer, O., (2017). Becoming Non-human/ Designing Non-human. Interalia Magazine. (Retrieved June 29, 2021). https://www. interaliamag.org/articles/oliver-kellhammer- becoming-non-humandesigning-non-human/

137

Kranthi, S., R. Kranthi, K., Rodge, C., Chawla, S., Nehare, S. (2019). Insect Resistance to Insecticides and Bt Cotton in India, Natural Resource Management: Ecological Perspectives, Sustainability in Plant and Crop Protection, Springer. Khan, S., Malik, A., (2014). Environmental and health effects of textile industry wastewater, in Environmental deterioration and human. health. Springer. p. 55–71.

Kudlicka, K., & Brown, M. R. J., (1996). Cellulose biosynthesis in higher plants. Acta Societatis Botanicorum Poloniae, 65(1-2), 17–24. https://doi.org/10.5586/asbp.1996.003 Lee, S., (2011, March). Grow Your Own Clothes (Video Podcast). https://www. ted.com/talks/suzanne_lee_grow_your_ own_clothes/transcript?language=en

Lenzing, (2016). The Global Fiber Market in 2016. http://www.lenzing.com/en/investors/ equity-story/global-fiber-market.html Kumar, S., Stecher, G., Tamura, K., (2016). MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33:1870-1874.

Kuo, C., Chen, J., Liou, B., Lee, C., (2016). Utilization of acetate buffer to improve bacterial cellulose production by Gluconacetobacter xylinus. Food Hydrocolloids, 53, 98-103. https://doi: 10.1016/j.foodhyd.2014.12.034

León-Romero, Á., Domínguez-Manzano, J., Garrido-Fernández, A., Arroyo-López, F. N., & Jiménez-Díaz, R. (2015). Formation of In Vitro Mixed-Species Biofilms by Lactobacillus pentosus and Yeasts Isolated from Spanish- Style Green Table Olive Fermentations. Applied and environmental microbiology, 82(2), 689– 695. https://doi.org/10.1128/AEM.02727-15

Kurian, J., (2004-2005). A New Polymer Platform for the Future — Sorona® from Corn Derived 1,3-Propanediol. Journal of polymers and the environment, 2005-04, Vol.13 (2), p.159-167

Leushner, J., (2001). MALDI-TOF mass spectrometry: an emerging platform for genomics and diagnostics, Expert Review of Molecular Diagnostics, 1:1, 11-18, https:// doi.org/10.1586/14737159.1.1.11

Kurosumi, A., Sasaki, C., Yamashita, Y., Nakamura, Y., (2009), Utilisation of various fruit juices as carbon source for production of bacterial cellulose by Acetobacter xylinum NBRC 13693. Carbohydrate Polymer. 2009;76:333–335. https://doi.org/10.1016/j.carbpol.2008.11.009 Linnenkoper, K., (2019). Textile recycling pioneers weave their magic, Recycling International. https:// recyclinginternational.com/technology/textile- recycling-pioneers-weave-their-magic/28471/

Laghi, I., (2013). Cellulose Strand. (Retrieved Nov 25, 2021). WikiCommons. https://commons.wikimedia.org/ wiki/File:Cellulose_strand.svg

Liu, C., Hsu, W., Lee, F., & Liao, C., (1996). The isolation and identification of microbes from a fermented tea beverage, Haipao, and their interactions during Haipao fermentation. Food Microbiology, 13, 407±415. https://doi.org/10.1006/fmic.1996.0047

La Reau, A., Suen, G., (2018). The Ruminococci: Key Symbionts of the Gut Ecosystem. Journal of Microbiology. 56 (3): 199–208. https:// doi.org/10.1007/s12275-018-8024-4.

Liu, D., Yao, K., Li, J., Huang, Y., Brennan, C., Chen, S., Wu, H., Zeng, X., Brennan, M., Li, L., (2019), The effect of ultraviolet modification of Acetobacter xylinum (CGMCC No. 7431) and the use of coconut milk on the yield and quality of bacterial cellulose. International Journal of Food Science Technology, 54: 3099- 3108. https://doi.org/10.1111/ijfs.14225 Land, B., (2005). Using Vitamin C To Neutralize Chlorine in Water Systems, United States Department of Agriculture, Forest Service Technology & Development Program. https://www.fs.fed.us/t-d/pubs/ htmlpubs/htm05712835/page12.php

Lawrence, C., (2015). Fibre to Yarn, Textiles and fashion: Materials, design and technology. Cambridge, UK, Woodhead Publishing. https:// doi.org/10.1016/B978-1-84569-931-4.00010-6

Liu, S., Constable, G., Reid, P., Stiller, W., Cullis, B., (2013), 30 years of cotton breeding evaluation trials. The interaction between breeding and crop management in improved cotton yield. Field Crops Research 148, 49–60. https://doi.org/10.1016/j.fcr.2013.04.006

Luna, K., Mair, C., (2020). Speaking of Psychology: Psychology of Fashion, American Psychological Association, Episode 83 https://www.apa.org/ research/action/speaking-of-psychology/fashion Lavasani, P. S., Motevaseli, E., Shirzad, M., & Modarressi, M. H. (2017). Isolation and identification of Komagataeibacter xylinus from Iranian traditional vinegars and molecular analyses. Iranian Journal of Microbiology, 9(6), 338–347. https://www.ncbi. nlm.nih.gov/pmc/articles/PMC5825934/

138

Lechner S, Mayr R, Francis KP, Prüß BM, Kaplan T, Wießner-Gunketl E, Stewart GSAB, Scherer S (1998) Bacillus weihenstephanensis sp. nov. is a new psychrotolerant species of the Bacillus cereus group. International Journal of Systematic and Evolutionary Microbiology 48: 1373-1 382.

Merriam-Webster Dictionary, (2021). Collaborate. (Retrieved June 29, 2021). https://www. merriam-webster.com/dictionary/collaborate

Machado, R., Meneguin, A., Sábioa, R., Francoc, D., Antonioc, S., Gutierrezd, J., Tercjakd, A., Berrettaf, A., Ribeiroc, A., Lazarinia, S., Lustria, W., Barud, H., (2018). Komagataeibacter rhaeticus grown in sugarcane molasses- supplemented culture medium as a strategy for enhancing bacterial cellulose production. Industrial Crops & Products 122: 637–646. https://doi.org/10.1016/j.indcrop.2018.06.048 Mettler, M., Vlachos, D., Dauenhauer, P.,. (2012). Top Ten Fundamental Challenges of Biomass Pyrolysis for Biofuels. Energy & Environmental Science. 5 (7): 7797. https://doi.org/10.1039/C2EE21679E

Malai, (2021), About our Story, (Retrieved Nov 24, 2021). https://malai.eco/

de Meijer, E., (1995). Fibre hemp cultivars: A survey of origin, ancestry, availability and brief agronomic characteristics, Journal of the International Hemp Association 2(2): 66- 73. http://www.internationalhempassociation. org/jiha/iha02207.html Mancini, F., (2005). Acute pesticide poisoning among female and male cotton growers in India. International Journal of Occupational and Environmental Health, 11:221–232.

Markets World Report, (2019). Cellulose Fibre Market, https://www.marketreportsworld. com/cellulose-fiber-market-13386075

Meza-Contreras, J., Manriquez-Gonzalez, R., Gutiérrez-Ortega, J., Gonzalez-Garcia, Y., (2018). XRD and solid-state 13C-NMR evaluation of the crystallinity enhancement of 13C-labeled bacterial cellulose biosynthesized by Komagataeibacter xylinus under different stimuli: A comparative strategy of analyses, Carbohydrate Research, Elsevier. https://doi.org/10.1016/j.carres.2018.03.005

Matchar, E., (2017), New Artificial Spider Silk: Stronger Than Steel and 98 Percent Water, Smithsonian Mag. https://www.smithsonianmag. com/innovation/new-artificial-spider-silk- stronger-steel-and-98-percent-water-180964176/

Micklin, P. (2007). The Aral Sea disaster. Annual Review of Earth and Planetary Sciences, 35(1), 47–72. https://doi.org/10.1146/ annurev.earth.35.031306.140120

Material District (2016), A fruitful idea: Fabric made from orange peel by Orange Fiber https://materialdistrict.com/article/fabric- orange-peel-orange-fiber/#:~:text=The%20 start%2Dup%20Orange%20Fiberher%20 thesis%20in%20fashion%20design

Miller, M., (2017). A Guide To The $13.4 Billion Biodesign Industry. (March 2, 2017). https://www.fastcompany.com/90181171/a- guide-to-the-134-billion-biodesign- industry-2?itm_source=parsely-api Matthews, B., (2015), Closing The Loop: Circular Economy Work, MCL Group

Minor, J. L., (1994). Hornification, its origin and meaning, Progress in Paper Recycling 3(2), 93- 95. https://doi.org/10.1007/s00226-003-0216-2.

May, A., Narayanan, S., Alcock, J., Varsani, A., Maley, C., & Aktipis, A. (2019). Kombucha: a novel model system for cooperation and conflict in a complex multi-species microbial ecosystem. PeerJ, 7, e7565. https://doi.org/10.7717/peerj.7565

Mintel Press Team, (2017). Brits hung up on online fashion. https://www.mintel.com/press-centre/ fashion/uk-online-sales-of-clothing-fashion- accessories-and-footwear-grow-by-17-in-2017

Maycroft, N. (2000). Re-valorizing Rubbish: Some Critical Reflections on “Green” Product Strategies. Capital & Class, 24(3), 135–160. https://doi.org/10.1177/030981680007200107 MIT Media Lab, (2020). Silk Pavilion: CNC Deposit Silk Fiber & Silkworm Construction. https:// mediatedmattergroup.com/silk-pavilion

McCarthy, A., (2018). Are Our Clothes Doomed for the Landfill? Remakeworld. com https://remake.world/stories/news/ are-our-clothes-doomed-for-the-landfill/

Mohainin, S., Mohammad, S., Rahman, N., Rozaimah, S., Abdullah, S., Abdullah, S., (2014). An Overview of Biocellulose Production Using Acetobacter xylinum Culture, Biological research 8(6):307-313 https:// doi.org/10.5829/idosi.abr.2014.8.6.1215 McCord, G., (2018), What Are Anthocyanins? https://www.thespruceeats.com/ what-are-anthocyanins-2774852

139

McKinney, M., Schoch, R., (2003) Environmental Science, Systems and Solutions. Third edition, University of Tennessee, Knoxville, USA. Mohajer va Pesaran, D., (2018). Making and Growing Washi Paper Clothes: A Framework for Interspecies Fashion Design in the Anthropocene. Bunka Gakuen University Graduate School. http://hdl.handle.net/10457/2888

Musk, P., (2016). Vegan leather fashion. Journal of the Home Economics Institute of Australia, Vol. 23, No. 1, 2016: 31.

Mualla, S., Farahat, R., Basmaji, P., Olyveira, G., Costa, L., Oliveira, J., Francozo, G., (2016) Study of Nanoskin ECM-Bacterial Cellulose Wound Healing/United Arab Emirates. Journal of Biomaterials and Nanobiotechnology, 7, 109- 117. https://doi.org/10.4236/jbnb.2016.72012 Myers, W., & Antonelli, P. (2012). Bio design : nature, science, creativity. Thames and Hudson. (2nd edition)

McFall-Johnsen, M., (2019). The fashion industry emits more carbon than international flights and maritime shipping combined. Here are the biggest ways it impacts the planet, Business Insider. https://www.businessinsider.com.au/ fast-fashion-environmental-impact-pollution- emissions-waste-water-2019-10?r=US&IR=T Myers, W., (2013). Biodesign: On the Cross-Pollination of Nature, Science, and Creativity (Exhibition at The New Institute, Rotterdam, Netherlands, September 27, 2013 - January 26, 2014) https://www. biology-design.com/biodesign-rotterdam

Myers, W., (2018). Biodesign: From Inspiration to Integration (Exhibition at Woods Gerry Gallery, Providence, Rhode Island School of Design, Rhode Island, USA, August 25 - September 27, 2018. https://www.biology-design.com/risd Medronho, B., Romano, A., Miguel, M.G., Stigsson, L., Lindman, B., (2012), Rationalizing cellulose (in)solubility: reviewing basic physicochemical aspects and role of hydrophobic interactions. Cellulose 19, 581–587 https:// doi.org/10.1007/s10570-011-9644-6

Nabi Saheb, D., Jog, J., (1999). "Natural fibre polymer composites: a review". Advances in Polymer Technology. 18 (4): 351–363. https://doi.org/10.1002/(SICI)1098- 2329(199924)18:4<351::AID-ADV6>3.0.CO;2-X

McGregor, B., (2018). Physical, chemical, and tensile properties of cashmere, mohair, alpaca, and other rare animal fibers, The Textile Institute Book Series, Handbook of Properties of Textile and Technical Fibres (Second Edition), Woodhead Publishing, Pages 105-136. https:// doi.org/10.1016/B978-0-08-101272-7.00004-3.

Naeem, M., Lv, P., Zhou, H., Naveed, T., Wei, Q., (2018). A Novel In Situ Self-Assembling Fabrication Method for Bacterial Cellulose- Electrospun Nanofiber Hybrid Structures, Polymers 10, 712; https://doi.org/10.3390/polym10070712

Mew, E., Padmanathan, P., Konradsen, F., Eddleston, M., Chang, S., Phillips, M., Gunnell, D., (2017). The Global Burden of Fatal Self- poisoning with Pesticides 2006-15: Systematic review https://doi.org/10.1016/j.jad.2017.05.002

Narasimhan, S., Srikanth, B., Poltronieri, P., (2016). Biotransformation of Agricultural Waste and By-Products, The Food, Feed, Fibre, Fuel (4F) Economy, Pages 49-67 Mithen, S., (2003). After the Ice: A Global Human History, 20,000-5000 BC.

Nazir, R., Zaffar, M., Amin, I., (2019). Freshwater microbiology: Perspectives of bacterial dynamics in lake ecosystems. London, Academic Press. Mohajan, H., (2019). The First Industrial Revolution: Creation of a New Global Human Era, MPRA Paper 96644, University Library of Munich.

Nguyen, V. T., Flanagan, B., Gidley, M. J., & Dykes, G. A. (2008). Characterization of cellulose production by a Gluconacetobacter xylinus strain from Kombucha. Current Microbiology, 57(5), 449. https://doi.org/10.1007/s00284-008-9228-3

Moonmangmee, D., Adachi, O., Ano, Y., Shinagawa, E., Toyama, H., Theeragool, G., Lotong N., Matsushita, K., (2000) Isolation and Characterization of Thermotolerant Gluconobacter Strains Catalyzing Oxidative Fermentation at Higher Temperatures; Bioscience, Biotechnology, and Biochemistry, 64:11, 2306- 2315, https://doi.org/10.1271/bbb.64.2306

Nguyen, C., Broussolle, V., (2005). Bacillus cereus: factors affecting virulence. In: Griffiths M (Ed) Understanding pathogen behaviour, Vol. 2: Virulence, stress response and resistance. CRC/AP. Ch. 12, pages 309-330.

Morgan, L., Birtwistle, G., (2009). An investigation of young fashion consumers' disposal habits, Volume 33, Issue 2, Pages 190-198. https:// doi.org/10.1111/j.1470-6431.2009.00756.x

Ng, F. M. ., & Wang, P. W. (2016). Natural Self- grown Fashion From Bacterial Cellulose: A Paradigm Shift Design Approach In Fashion Creation. The Design Journal, 19(6), 837–855. https://doi.org/10.1080/14606925.2016.1208388

Muthu, S., (2015). Carbon Footprint of Textile and Clothing Products. The Handbook of Sustainable Apparel Production (pp. 156–181). CRC Press. https://doi.org/10.1201/b18428-11

140

Nimkar, U., (2018). Sustainable chemistry: A solution to the textile industry in a developing world. Current Opinion in Green and Sustainable Chemistry, 9, 13-17.

Occupational Health & Safety Administration (OSHA), (2020). Occupational Chemical Database. https://www.osha.gov/chemicaldata/

Nishi, Y., Uryu, M., Yamanaka, S., Watanabe, K., Kitamura, N., Iguchi, M., Mitsuhashi, S., (1990). The structure and mechanical properties of sheets prepared from bacterial cellulose. 2. Improvement of the mechanical properties of sheets and their applicability to diaphragms of electro-acoustic transducers. Journal of Material Science. 25:2997–3001 Oren, A., Garrity, G., (2020). List of changes in taxonomic opinion no. 32. Notification of changes in taxonomic opinion previously published outside the IJSEM. International Journal of Systematic and Evolutionary Microbiology; 70:4061-4090.

Northolt, M., Boerstoel, H., Maatman, H., Huisman, R., Veurink, J., Elzerman, H., (2001), The structure and properties of cellulose fibres spun from an anisotropic phosphoric acid solution, Polymer, Elsevier, https:// doi.org/10.1016/S0032-3861(01)00211-7 Osma, J. F., Toca Herrera, J. L., & Rodríguez Couto, S. (2007). Banana skin: A novel waste for laccase production by Trametes pubescens under solid-state conditions. Application to synthetic dye discoloration. Dyes and Pigments, 75(1), 32–37. https://doi.org/10.1016/j.dyepig.2006.05.021

Nunes, R., (2017). Progress in Rubber Nanocomposites, Woodhead Publishing Series in Composites Science and Engineering, Pages 463-494, Progress in Rubber Nanocomposites, 13. https://doi.org/10.1016/B978-0-08-100409-8.00013-9 Oxman, N., (2020). Neri Oxman: Material Ecology, (Exhibition at MoMA, New York, USA, 22 February - 25 May, 2020). https:// www.moma.org/magazine/articles/315

O Ecotextiles, (2017). Volatile Organic Compounds (VOCs). https://oecotextiles.wordpress. com/2010/03/17/volatile-organic-compounds-vocs/ Palma, L., Muñoz, D., Berry, C., Murillo, J., & Caballero, P. (2014). Bacillus thuringiensis toxins: an overview of their biocidal activity. Toxins, 6(12), 3296–3325. https://doi.org/10.3390/toxins6123296

O Ecotextiles, (2014). Climate Change and the Textile Industry https://oecotextiles. wordpress.com/2014/10/15/climate- change-and-the-textile-industry/

Pandey, K., (2018). Fashion Industry May Use Quarter of World’s Carbon Budget by 2050: Emissions from this sector are to rise by more than 60 per cent by 2030. https:// www.downtoearth.org.in/news/environment/ fashion-industry-may-use-quarter-of- world-s-carbon-budget-by-2050-61183

Oelerich, J., Bijleveld, M., Bouwhuis, G., Brinks, G., (2017). The life cycle assessment of cellulose pulp from waste cotton via the SaXcell™ process. IOP Conf. Ser.: Mater. Sci. Eng. 254 192012 https:// doi.org/10.1088/1757-899X/254/19/192012

Park, J., Jung, J., Park, Y., (2003). Cellulose production by Gluconacetobacter hansenii in a medium containing ethanol. Biotechnology Letters. 2003;25(24):2055–2059. https://doi. org/10.1023/B:BILE.0000007065.63682.18.

OGTR (Office of the Gene Technology Regulator), (2020). Table of authorisations for commercial releases of GM plants (a subset of the list of licences involving Intentional Release). http://www.ogtr.gov.au/ internet/ogtr/publishing.nsf/Content/cr-1

Park, J., Jung, Y., Khan, T., (2009). Handbook of Hydrocolloids, 26 - Bacterial cellulose, Woodhead Publishing Series in Food Science, Technology and Nutrition, Pages 724-739. https://doi.org/10.1533/9781845695873.724 Onions, A., Allsopp, D., Eggins, H., (1981). Smith’s Introduction to Industrial Mycology, 7th edition. Edward Arnold (Publishers) Ltd, London, UK.

Ophardt, C., (2003). Cellulose, Virtual Chembook, Elmhurst College. http://chemistry. elmhurst.edu/vchembook/547cellulose.html Pensupa, N., (2020). Recycling of End of Life Clothes, Sustainable Technologies for Fashion and Textiles, Woodhead Publishing Series in Textiles, p.251-309. https://doi. org/10.1016/B978-0-08-102867-4.00012-8

Organic Cotton, (2020). World Cotton Production. https://www.organiccotton.org/oc/Cotton-general/ World-market/World-cotton-production.php PETA, (2021). The Silk Industry https://www. peta.org.uk/issues/animals-not-wear/silk/

Organic Trade Association (OTA), (2012). Organic Cotton Facts. https://ota.com/sites/default/ files/indexed_files/Organic-Cotton-Facts.pdf

141

Petersen, N., Gatenholm P., (2011). Bacterial cellulose-based materials and medical devices: current state and perspectives. Applied Microbiology Biotechnology, 91 (2011), p. 1277, https://doi.org/10.1007/s00253-011-3432-y

Rauturier, S., (2018). What Is Fast Fashion? Good On You. (Retrieved Aug 19, 2021). https:// goodonyou.eco/what-is-fast-fashion/ Pezzoli, K. (2020). Bioregionalism. In Keywords for Environmental Studies (Vol. 3, pp. 25–28). New York University Press. https:// doi.org/10.18574/9780814760741-010

Piadozo, E., (2016). Nata de Coco Industry in the Philippines, Bacterial Nanocellulose. https://doi.org/10.1016/B978-0-444-63458-0.00013-5 Rangaswamy, B., Vanitha, K., Hungund, B., (2015). Microbial cellulose production from bacteria isolated from rotten fruit. International Journal of Polymer Science. https://doi.org/10.1155/2015/280784

Plell, A., (2018). There Are Hidden Chemicals In Our Clothing. https://remake.world/stories/news/ there-are-hidden-chemicals-in-our-clothing/

Rathinamoorthy, R., & Kiruba, T. (2020). Bacterial cellulose-A potential material for sustainable eco-friendly fashion products. Journal of Natural Fibers, 1–13. https://doi. org/10.1080/15440478.2020.1842841

Poland, K., (2020). There is no Waste in Nature, Hackney Citizen. https:// www.hackneycitizen.co.uk/2020/03/05/ citizen-gardener-no-waste-nature/

Ray, D., (2019). In London, a Researcher Guides Biodesign into Uncharted—and Newly Relevant—Territory. (September 4, 2019) https://www.metropolismag.com/ ideas/carole-collet-biodesign-textiles/ Poltronieri, P., D'Urso, O., (2016). Biotransformation of agricultural waste and by-products: The food, feed, fibre, fuel (4f) economy (First ed.). Elsevier.

Reay, D., Ramshah, C., Harvey, A., (2013). In Process Intensification : Engineering for Efficiency, Sustainability and Flexibility. Application Areas – Miscellaneous Process Industries. (pp. 349–391). https://doi.org/10.1016/B978-0-08-098304-2.00010-9

Post, R., (2014), The strange science behind design: materials from unusual sources, The Guardian. (Retrieved Aug 11, 2020). https://www.theguardian.com/ sustainable-business/2014/jun/20/science- design-materials-sources-sustainable

Preston, E., (2018). That Kombucha Looks Fabulous on You. (Retrieved Aug 20, 2021). https://medium. com/neodotlife/kombucha-leather-9a79826d1a66

Rebitzer, G., Ekvall, T., Frischknecht, R., Hunkeler, D., Norris, G., Rydberg, T., Schmidt, W.-P., Suh, S., Weidema, B., Pennington, D., (2004). Life cycle assessment: Part 1: Framework, goal and scope definition, inventory analysis, and applications. Environment International, 30(5), 701–720. https://doi.org/10.1016/j.envint.2003.11.005

Prince, A., (2008). Energy conservation in textile industries & savings. Fibre 2 Fashion. https:// www.fibre2fashion.com/industry-article/3377/ energy-conservation-in-textile-industries-savings

Reiss, J., (1994). Influence of different sugars on the metabolism of the tea fungus. Zeitschrift Für Lebensmittel-Untersuchung Und -Forschung, 198(3), 258–261. https://doi.org/10.1007/BF01192606

Prior, M., (2018). How safe is GM cotton? Frontiers Science News. (Retrieved Aug 20, 2021). https://blog.frontiersin.org/2018/09/28/ gm-agriculture-mexico-cotton-environment/

Revin, V., Paramonova, E., Revina, N., Kolesnikova, S., Liyaskina, E., (2018). Bacterial Cellulose/Alginate Nanocomposite for Antimicrobial Wound Dressing, PhysBioSymp17 https://doi.org/10.18502/ken.v3i2.1814

Pyrko. I., Dorfler, V., Eden., C. (2016). Thinking Together: What makes Communities of Practice work? Sage Journals. (Retrieved Aug 20, 2021). https://doi.org/10.1199/0018726716661040

Richter, R., (2021). Biodesign Marks 15 Years With New Name, (Retrieved Aug 19, 2021). https://:med. Stanford.edu/news/all-news/2016/05/biodesign- marks-15-years-with-new-name-focus.htmlp

Qiao, F., Huang, J., Wang, S., Li, Q., (2017). The Impact of BT Cotton Adoption on the Stability of Pesticide Use, Journal of Integrative Agriculture, 16(10): 2346–2356

Riello, G., (2013). Cotton: The Fabric That Made the Modern World, Cambridge University Press, MPG Books Group.

Rackham, M. (2009). Coded Cloth: A 21st-Century Revolution in Art, Fashion and Design: From the exhibition produced by Australian Network for Art and Technology (ANAT). Leonardo (Oxford), 42(5), 386–388. https://doi.org/10.1162/leon.2009.42.5.386

Riley, K., Fergusson, M., Shen, J.,(2017). Sustainable fabric choice for regularly laundered healthcare uniforms, The Journal of The Textile Institute, 108:3, 440-444. https:// doi.org/10.1080/00405000.2016.1171025

142

Roche, J., 1998. The history and spread of Kombucha. Źródło. http://users.bestweb. net/~om/~kombu/roche.html. (accessed 10.10.20) Rafiq, S., Kaul, R., Sofi, S. ., Bashir, N., Nazir, F., & Ahmad Nayik, G. (2018). Citrus peel as a source of functional ingredient: A review. Journal of the Saudi Society of Agricultural Sciences, 17(4), 351–358. https://doi.org/10.1016/j.jssas.2016.07.006

Rojewska, A., Karewicz, A., Boczkaja, K., Wolski, K., Kępczyński, M., Zapotoczny, S., Nowakowska, M., (2017), Modified bionanocellulose for bioactive wound-healing dressing, Macromolecular Nanotechnology. https://doi.org/10.1016/j.eurpolymj.2017.09.010 Saichana, N., Matsushita, K., Adachi, O., Frébort, I., Frébortová, J., (2014). Acetic Acid Bacteria: A Group of Bacteria with Versatile Biotechnological Applications. Journal of Biotechnology Advances, volume 33, https:// doi.org/10.1016/j.biotechadv.2014.12.001

Saiko, T., Zonn, I., (2000). Irrigation expansion and dynamics of desertification in the Circum-Aral region of Central Asia. Appl. Geogr. 20, 349–367. https://doi.org/10.1016/S0143-6228(00)00014-X Römling, U., Galperin, M., (2015). "Bacterial cellulose biosynthesis: diversity of operons, subunits, products, and functions". Trends in Microbiology. 23 (9): 545–557. https:// doi.org/10.1016/j.tim.2015.05.005

Salleh, A., (2007). Bugs make dresses smell like old wine. (Retrieved 19 March, 2019), ABC. https://www.abc.net.au/science/ articles/2007/03/15/1872191.htm

Roos, S., (Doctoral thesis, 2016). Advancing life cycle assessment of textile products to include textile chemicals Inventory data and toxicity impact assessment, Department of Energy and Environment, Chalmers University Of Technology.

Sandin, G., Peters, G., (2018). Environmental impact of textile reuse and recycling – A review, Journal of Cleaner Production, Volume 184, Pages 353-365 https://doi.org/10.1016/j.jclepro.2018.02.266

Rose, C.; Parker, A.; Jefferson, B.; Cartmell, E., (2015). "The Characterization of Feces and Urine: A Review of the Literature to Inform Advanced Treatment Technology". Critical Reviews in Environmental Science and Technology. 45 (17): 1827–1879. https:// doi.org/10.1080/10643389.2014.1000761

Santos, S., Carbajo, J., Villar, J., (2013). The effect of carbon and nitrogen sources on bacterial cellulose production and properties from Gluconacetobacter sucrofermentans CECT 7291 focused on its use in degraded paper restoration, NC State University, Bio Resources 8(3), 3630-3645.

Rose, I., K., Stevels, A., (2002). Influencing design to improve product end-of-life stage. Research in Engineering Design, 13(2), 83–93.

https://doi.org/10.1007/s001630100006

Ross, JK., English, C., Perlmutter, CA., (1985), Dietary fibre constituents of selected fruits and vegetables, J Am Diet Assoc; 85(9):1111-6. Saravanakumar, T., Park, H-S., Mo, A-Y., Choi,M-S., Kim, D-H., Park, S-M., (2016). Detoxification of furanic and phenolic lignocellulose derived inhibitors of yeast using laccase immobilized on bacterial cellulosic nanofibers, Journal of Molecular Catalysis B: Enzymatic, Elsevier. https://doi.org/10.1016/j.molcatb.2016.11.006

Ross, R., (2019). Bacillus Cereus: The Bacterium That Causes 'Fried Rice Syndrome’. https://www.livescience.com/65374-bacillus- cereus-fried-rice-syndrome.html Saxena, I., Brown, R., (2005). Cellulose biosynthesis: current views and evolving concepts. Ann Bot 96:9–21. https:// doi.org/10.1093/aob/ mci155

Schipper, M., (2019). Bio textiles: Meet six designers changing the future of fashion Feb 8, 2019) https://www. nextnature.net/story/2019/bio-textiles Roth, G., Harris, G., Gillies, M., Montgomery, J., Wigginton, D., (2013). Water-use efficiency and productivity trends in Australian irrigated cotton: a review, Crop and Pasture Science 64, 1033-1048. https://doi.org/10.1071/CP13315

Rotkop, N., (2008) Victimless Leather, The Future of Things. https://thefutureofthings. com/5910-victimless-leather/ Schindler, W., Hauser, P., (2004). Chemical Finishing of Textiles: Flame-retardant finishes, Woodhead Publishing Series in Textiles, Pages 98-116 https://doi.org/10.1533/9781845690373.98

Rukam, D., Simon, G., Dean, K., (2012). Altering the growth conditions of Gluconacetobacter xylinus to maximize the yield of bacterial cellulose. Carbohyd. Polym.;89:613–622. https:// doi.org/10.1016/j.carbpol.2012.03.059 Schulze-Makuch, D., (2018). Turn Up the Heat: Bacterial Spores Can Take Temperatures in the Hundreds of Degrees. https://www.airspacemag. com/daily-planet/turn-heat-bacterial-spores-can- take-temperatures-hundreds-degrees-180970425/

Scroggie, A. . (1950). The Definition of Rayon: Viewpoint of the American Textile Industry. Textile Research Journal, 20(3), 194–198. https:// doi.org/10.1177/004051755002000308

143

Ryngajłło, M., Kubiak, K., Jędrzejczak- Krzepkowska, M., Jacek, P., & Bielecki, S. (2019). Comparative genomics of the Komagataeibacter strains-Efficient bionanocellulose producers. Microbiology Open, 8(5), e00731. https://doi.org/10.1002/mbo3.731

SEPA (Swedish Environmental Protection Agency), (2019). Swedish Pollutant Release and Transfer Register, Hydrogen cyanide (HCN) http://utslappisiffror.naturvardsverket.se/en/ Substances/Other-gases/Hydrogen-cyanide/

da Silva, C. J. G., de Medeiros, A. D. M., de Amorim, J. D. P., do Nascimento, H. A., Converti, A., Costa, A. F. S., & Sarubbo, L. A. (2021). Bacterial cellulose biotextiles for the future of sustainable fashion: a review. Environmental Chemistry Letters. https:// doi.org/10.1007/s10311-021-01214-x

Schroeter, S., (2017). Blue Gold: What Is Indigo Dye And Why Is It Good For The Environment? https://www.mochni.com/blue-gold-what-is-indigo- dye-and-why-is-it-good-for-the-environment/

Siddiquee, S., (2017). The Basic Concept of Microbiology. In: Practical Handbook of the Biology and Molecular Diversity of Trichoderma Species from Tropical Regions. Fungal Biology. Springer, Cham. https://doi.org/10.1007/978-3-319-64946-7_1 Schmidt, H., (2004). Indigo – 100 Jahre industrielle Synthese https://doi.org/10.1002/ciuz.19970310304

Schuch, A.B., (2016). The Chemical Recycling of Cotton, Berlin International University of Art for Fashion.

Silva, S., Fernandes, E., Pina, S., Silva-Correia, J., Vieira, S., Oliveira, J., Reis, R., (2017). Chapter: 2.11 Polymers of Biological Origin, Comprehensive Biomaterials II, Elsevier. https:// doi.org/10.1016/B978-0-12-803581-8.10134-1

Seralini, G.E. (2015). Why glyphosate is not the issue with Roundup: A short overview of 30 years of our research, Journal of Biological Physics and Chemistry, Vol. 15, Issue 3, pp.111- 119. https://www.gmoseralini.org/wp-content/ uploads/2015/11/Seralini-career-JBPC_2015.pdf Simmons, G., McKemey, A., Morrison, N., O'Connell, S., Tabashnik,B., Claus, J.,(2011). Field Performance of a Genetically Engineered Strain of Pink Bollworm. PLoS ONE 6(9): e24110. https://doi.org/10.1371/journal.pone.0024110

Seymour, V. (2016). The human-nature relationship and its impact on health: A critical review. Frontiers in Public Health, 4, 260–260. https://doi.org/10.3389/FPUBH.2016.00260 Singh, S., Mukherjee, A., (2010). Kinetics of Mild Steel Corrosion in Aqueous Acetic Acid Solutions. Journal of Material Science and Technology, 2010, 26(3), 264-269.

Singh, Z., Chadha, P., (2016). Textile industry and occupational cancer. J Occup Med Toxicol 11, 39. https://doi.org/10.1186/s12995-016-0128-3 Shahbandeh, M., (2019). Global genetically modified crops by countries 2018, based on acreage. https://www.statista.com/ statistics/271897/leading-countries-by- acreage-of-genetically-modified-crops/

Shahbandeh, M., (2020).Global cotton production 2019/2020, by country. (Retrieved June 29, 2021). https://www.statista.com/statistics/263055/ cotton-production-worldwide-by-top-countries/ Son, H., Heo, M., Kim, Y., Lee, S., (2001). Optimization of fermentation conditions for the production of bacterial cellulose by a newly isolated Acetobacter sp. A9 in shaking cultures. Biotechnology and Applied Biochemistry. 33(1):1‐5. https://doi.org/10.1042/ba20000065

Specter, M., (2014). Seeds of Doubt, An activist’s controversial crusade against genetically modified crops. https://www.newyorker.com/ magazine/2014/08/25/seeds-of-doubt Shen, F., Xiao, W., Lin, L., Yang, G., Zhang, Y., Deng, S., (2013), Enzymatic saccharification coupling with polyester recovery from cotton- based waste textiles by phosphoric acid pretreatment, Bioresource. Technol., 130, pp. 248- 255, https://doi.org/10.1016/j.biortech.2012.12.025

Stal, L., (2011) Biopolymer. In: Gargaud M. et al. (eds) Encyclopedia of Astrobiology. Springer, Berlin, Heidelberg.

Sherer, D., (2020). Exercises in Root System Domestication, (Retrieved Nov 24, 2021). http://dianascherer.nl/photography/ exercises-in-root-system-domestication/

Stanes, E., Gibson, C., (2017). Materials that linger: An embodied geography of polyester clothes. Geoforum, 85 27-36. http://ro.uow.edu.au/sspapers/3092

Shi, W., Li, S., Jia, J., Zhao, Y., (2013). Highly Efficient Conversion of Cellulose to Bio-Oil in Hot-Compressed Water with Ultrasonic PretreatmentIndustrial & Engineering, Chemistry Research, 52 (2), 586- 593. https://doi.org/10.1021/ie3024966 Stanisławska, A., (2016), Bacterial Nanocellulose as a Microbiological Derived Nanomaterial, Research Gate. https:// doi.org/10.1515/adms-2016-0022

144

Shiva, V., (1989). The Violence of the Green Revolution: Third World Agriculture, Ecology and Politics, Zed Books.

Swicofil AG Textile Services, (2011). Viscose rayon. (Retrieved June 19, 2021). https://www.swicofil. com/commerce/products/viscose/278/introduction

Steels, H., James, S., Bond, C., Roberts, I., Stratford, M., (2002). Zygosaccharomyces kombuchaensis: the physiology of a new species related to the spoilage yeasts Zygosaccharomyces lentus and Zygosaccharomyces bailii, FEMS Yeast Research, Volume 2, Issue 2, Pages 113–121, https://doi.org/10.1111/j.1567-1364.2002.tb00076.x Swift, R., (2007). Death by Cotton, Suicide Village. (Retrieved Aug 19, 2021). https:// newint.org/features/2007/04/01/farmersuicide

Stenborg, E., (2013). Making sense of risk. An analysis of framings in media of the chemical risks of textiles, toys and paint. Research Policy Institute, Lund University.

Szymańska-Chargot, M., Cybulska, J., & Zdunek, A. (2011). Sensing the structural differences in cellulose from apple and bacterial cell wall materials by Raman and FTIR spectroscopy. Sensors, 11(6), 5543–5560. https://doi.org/10.3390/s110605543

Tajima, K., Fujiwara, M., Takai, M., Hayashi, J., (1995). Synthesis of bacterial cellulose composite by Acetobacter xylinum. Its mechanical strength and biodegradability. Mokuzai, Gakkaishi 41:749–757 Anicuta, S-G., Dobre, L., Stroescu, M., Jipa, L., (2010), Fourier-Transform Infrared (FTIR) Spectroscopy For Characterization Of Antimicrobial Films Containing Chitosan, Analele Universită, Ńii din Oradea Fascicula: Ecotoxicologie, Zootehnie şi Tehnologii de Industrie Alimentară. http:// protmed.uoradea.ro/facultate/anale/ecotox_ zooteh_ind_alim/2010/ipa/120%20Stoica.pdf

Tamura, K., Nei, M., (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10:512-526.

Stringer, L., (2019). The textile sector must be more transparent about chemical use, NGO says, Chemical Watch: Global Risk and Regulation News. https://chemicalwatch. com/80692/textiles-sector-must-be-more- transparent-about-chemical-use-ngo-says

Tan, Z., (2016). What Happens When Fashion Becomes Fast, Disposable And Cheap? https:// www.npr.org/2016/04/08/473513620/what-happens- when-fashion-becomes-fast-disposable-and-cheap

Sülar, V., Devrim, G., (2019), Biodegradation Behaviour of Different Textile Fibres: Visual, Morphological, Structural Properties and Soil Analyses, FIBRES & TEXTILES in Eastern Europe,; 27, 1(133). https://doi.org/10.5604/01.3001.0012.7751

Tang, W., Jia, S., Jia, Y., Yang, H., (2010). The influence of fermentation conditions and post‐treatment methods on porosity of bacterial cellulose membranes. World Journal of Microbiology & Biotechnology, 26, 125–131. https://doi.org/10.1007/s11274-009-0151-y

Šutý, S., Petriláková, K., Katuščák, S., Kirschnerová, S., Jablonský, M., Vizárová, K., Vrška, M., (2012), Change In The Capability Of Cellulose Fibres To Retain Water During Thermally Accelerated Ageing Of Paper, Cellulose Chemistry And Technology Cellulose Chemistry and Technology, 46 (9-10), 631- 635. http://www.cellulosechemtechnol. ro/pdf/CCT46,9-10(2012)/p.631-635.pdf Tehranchian, P., Adair, R., Van, T., Morrison, P., Williams, H., Lawrie, A., (2020). Biological control of the noxious weed angled onion (Allium triquetrum) was thwarted by endophytic bacteria in Victoria, Australia. Australasian Plant Pathology 49: 373-392.

The Designers Studio, (2020). https:// tdsblog.com/dye-off-natural-vs-synthetic/

Sugave, D., (2014). Characterization of garlic skin and its evaluation as biomaterial. Department Of Biotechnology and Medical Engineering National Institute Of Technology Rourkela, India. (Bachelor of biotechnology thesis).

Tabashnik, B., Brévault, T. & Carrière, Y., (2013). Insect resistance to Bt crops: lessons from the first billion acres. Nat Biotechnol 31, 510–521. https://doi.org/10.1038/nbt.2597

Sun, J., Han, B., Ekwaro-Osire, S., Zhang, H-C., (2003), Design For Environment: Methodologies, Tools, And Implementation, Journal of Integrated Design and Process Science, vol. 7 No 1, pg. 59-75

The European Commission, (2013). Sustainability of Textiles, Issue Paper N° 11 https://ec.europa.eu/environment/industry/ retail/pdf/issue_paper_textiles.pdf

The Fiber Year, (2014). The Fiber Year 2014. World Survey on Textile & Nonwovens. Speicher. Swedish Chemical Agency (SCA), KEMI, (2014). Chemicals in Textiles – Risks to human health and the environment, report 6/14, Arkitektkopia. https://www.kemi.se/ files/8040fb7a4f2547b7bad522c399c0b649/ report6-14-chemicals-in-textiles.pdf

145

The Fiber Year Consulting, (2015). The Fiber Year 2015, World Survey on

Textiles and Nonwovens, Issue 15.

Virginia Department of Health, (2020). Acetic Acid. https://www.vdh.virginia.gov/epidemiology/ epidemiology-fact-sheets/acetic-acid/

The World Counts, (2020). Environmental Impact of Cotton. https://www.theworldcounts. com/challenges/consumption/clothing/ environmental-impact-of-cotton-production

Virk, A. S., Hall, W., & Summerscales, J. (2010). Failure strain as the key design criterion for fracture of natural fibre composites. Composites Science and Technology, 70(6), 995–999. https:// doi.org/10.1016/j.compscitech.2010.02.018

Thomas, B., Fishwick, M., Joyce, J., Van Santen, A., (2012). A Carbon Footprint for UK Clothing and Opportunities for Savings, Final Report. Environmental Resources Management Limited, UK.

Tomlin, C., (2006). The Pesticide Manual, A World Compendium, 14th ed., British Crop Protection Council: Alton, Hampshire, UK, pp 642-643. Volova, T., Prudnikova, S., Sukovatyi, A., Shishatskaya, V., (2018). Production and properties of bacterial cellulose by the strain Komagataeibacter xylinus B-12068. Applied Microbiology and Biotechnology, 102, 7417–7428. https://doi-org.ezproxy.lib. rmit.edu.au/10.1007/s00253-018-9198-8

Treesuppharat, W., Rojanapanthu, P., Siangsanoh, C., Manuspiya, H., Ummartyotin, S., (2017). Synthesis and characterization of bacterial cellulose and gelatin-based hydrogel composites for drug-delivery systems, Biotechnology Reports, Elsevier. https://doi.org/10.1016/j.btre.2017.07.002

Wang, J., Guo, Y., Long, G., Tang, Y., Tang, Q., Zu, X., Ma, J., Du, B., Torun, H., Fu, Y., (2020). Integrated sensing layer of bacterial cellulose and polyethyleneimine to achieve high sensitivity of ST-cut quartz surface acoustic wave formaldehyde gas sensor, Journal of Hazardous Materials, Elsevier. https:// doi.org/10.1016/j.jhazmat.2019.121743 Tucker, E., (2016). Leather alternative Piñatex is made from pineapple leaves Dezeen.com

United States Department of Agriculture (USDA), Economic Research Service (2019). Adoption of Genetically Engineered Crops in the U.S: Recent Trends in GE Adoption. https://www.ers.usda.gov/ data-products/adoption-of-genetically-engineered- crops-in-the-us/recent-trends-in-ge-adoption/

Wang, C., Cogswell, M., Loria, C., Chen, T-C., Pfeiffer, C., Swanson, C., Caldwell, K., Perrine, C., Carriquiry, A., Liu, K., Sempos, C., Gillespie, C., Burt, V., (2013). Urinary Excretion of Sodium, Potassium, and Chloride, but Not Iodine, Varies by Timing of Collection in a 24-Hour Calibration Study, The Journal of Nutrition, Volume 143, Issue 8, Pages 1276– 1282, https://doi.org/10.3945/jn.113.175927

University of Western Australia (2008). Fermented Fashion. (Retrieved Aug 1, 2020). https://www.news.uwa.edu.au/ archive/oct-2008/fermented-fashion-0/

Watanabe, K., Tabuchi, M., Morinaga, Y., Yoshinaga, F., (1998). Structural features and properties of bacterial cellulose produced in agitated culture. Cellulose, 5(3), 187-200. https://doi.org/10.1023/A:1009272904582

Vielreicher, M., Kralisch, D., Völkl, S., (2018). Bacterial nanocellulose stimulates mesenchymal stem cell expansion and formation of stable collagen-I networks as a novel biomaterial in tissue engineering. Sci Rep 8, 9401 https:// doi.org/10.1038/s41598-018-27760-z

Watnick, P., Kolter, R., ( 2000). Biofilm, city of microbes. Journal of Bacteriology. 182 (10): 2675–2679. https://doi. org/10.1128/jb.182.10.2675-2679.2000

Williams, W., Cannon, R., (1989). Alternative Environmental Roles for Cellulose Produced by Acetobacter xylinum. Applied and Environmental Microbiology. 55 (10), 2448– 52. https://doi. org/10.1128/aem.55.10.2448-2452.1989 Vigentini, I., Fabrizio, V., Dellacà, F., Rossi,S., Azario, I., Mondin, C., Benaglia, M., Foschino, R., (2019). Set-Up of Bacterial Cellulose Production From the Genus Komagataeibacter and Its Use in a Gluten-Free Bakery Product as a Case Study. Frontiers in Microbiology. Volume 10. https://doi.org/10.3389/fmicb.2019.01953

Wan, P., Huang, Y., Wu, H., Huang, M., Cong, S., Tabashnik, B., (2012). Increased frequency of pink bollworm resistance to Bt toxin Cry1Ac in China. PLOS One. 7(1): e29975. https:// doi.org/10.1371/journal.pone.0029975 Vinodkumar, S., Nakkeeran, S., Malathi, V. G., Karthikeyan, G., Amala Balu, P., Mohankumar, S., & Renukadevi, P. (2017). Tobacco streak virus: an emerging threat to cotton cultivation in India. Phytoparasitica, 45(5), 729–743. https://doi.org/10.1007/s12600-017-0621-y

Ward, C., (2014). Genetically modified cotton varieties. https://csiropedia.csiro.au/ genetically-modified-cotton-varieties/

Vitas, M., & Dobovišek, A. (2019). Towards a General Definition of Life. Origins of Life and Evolution of Biospheres, 49(1), 77–88. https://doi.org/10.1007/s11084-019-09578-5

146

Wenger, E., McDermott, R., Snyder, W., (2002) Cultivating Communities of Practice. Boston, MA. Harvard Business School Press.

Whiting, B., (2016). Industrial Textile Products, Introduction to Textiles & the Textile Industry. https://study.com/academy/ lesson/industrial-textile-products.html

Yoshinaga, F., Tonouchi, N., Watanabe, K., (1997). Research Progress in Production of Bacterial Cellulose by Aeration and Agitation Culture and Its Application as a New Industrial Material; Bioscience, Biotechnology, and Biochemistry, 61:2, 219-224. https://doi.org/10.1271/bbb.61.219

Wicker, A., (2016). Fast fashion is creating an environmental crisis, Newsweek, https:// www.newsweek.com/2016/09/09/old-clothes- fashion-waste-crisis-494824.html Yousef, S., Tatariants, M., Tichonovas, M., Kliucininkas, L., Lukošiūtė, S., Yanef, L., (2020). Journal of Cleaner Production.

Williams, N., & Collet, C. (2020). Biodesign and the Allure of “Grow-made” Textiles: An Interview with Carole Collet. GeoHumanities, 1–13. https:// doi.org/10.1080/2373566X.2020.1816141

Yudianti, R., Indrarti, L. (2008). Effect of water soluble polymer on structure and mechanical properties of bacterial cellulose composites. Journal of Applied Science, 8, 177- 180. https://doi.org/10.3923/jas.2008.177.180

Wilson, C., (2013). Father of the Green Revolution - He Helped Feed the World! Science Heroes. (Retrieved July 1, 2021). http://www. scienceheroes.com/index.php?option=com_ content&view=article&id=68&Itemid=116

Yueping, W., Ge, W., Haitao, C., Genlin, T., Zheng, L., Qun, X., Xushan, G., (2010). Structures of Bamboo Fiber for Textiles. Textile Research Journal, 80(4), 334–343. https://doi.org/10.1177/0040517509337633

World Health Organization & United Nations Environment Programme, (1990). Public health impact of pesticides used in agriculture. World Health Organization. https:// apps.who.int/iris/handle/10665/39772

Zaets, I., Podolich, O., Kukharenko, O., Reshetnyak, G., Shpylova, S., Sosnin, M., Khirunenko, L., Kozyrovska, N., de Vera, J., (2014). Bacterial cellulose may provide the microbial-life biosignature in the rock records, Advances in Space Research. http:// dx.doi.org/10.1016/j.asr.2014.01.002

Xiaobo Zeng, Jing Liu, Jing Chen, Qingjiang Wang, Zongtao Li, Haiying Wang (2011), Screening of the common culture conditions affecting crystallinity of bacterial cellulose, J Ind Microbiol Biotechnol, 38:1993–1999. https://doi.org/10.1007/s10295-011-0989-5

Zhang, L., Rana, I., Shaffer, R., Taioli, E., Sheppard, L., (2019). Exposure to glyphosate- based herbicides and risk for non-Hodgkin lymphoma: A meta-analysis and supporting evidence, Mutation Research/Reviews in Mutation Research, Volume 781, July–September 2019, Pages 186-206 https://doi.org/10.1016/j.mrrev.2019.02.001

Yamada, Y., Yukphan, P., Vu, H. T. L., Muramatsu, Y., Ochaikul, D., Nakagawa, Y. (2012). Description of Komagataeibacter gen. nov., with proposals of new combinations (Acetobacteraceae), The Journal of General and Applied Microbiology, Volume 58, Issue 5 Pages 397-404. https://doi.org/10.2323/jgam.58.397 Zhenhua, W., Mingxiu, L., Daming, W., (2001). Technique For Regenerating Keratin Fibres, Description CN1293266.

Yamanaka, S., Watanabe, K., Kitamuram, N., Iguchi, M., Mitsuhashi, S., Nishi, Y., Uryu, M., (1989). The structure and mechanical properties of sheets prepared from bacterial cellulose. J Mater Sci 24:3141– 3145. https://doi.org/10.1007/BF01139032 Zhong, C., Zhang, G., Liu, M., Zheng, X., Han, P., Jia, S., (2013). Metabolic flux analysis of Gluconacetobacter xylinus for bacterial cellulose production, Applied Microbiology and Biotechnology. 97(14):6189-99. https:// doi.org/10.1007/s00253-013-4908-8

Yao, J., Chen, S., Chen, Y., Wang, B., Pei, Q., Huaping, W., (2017). Microfibers with High Mechanical Performance Based on Aligned Bacterial Cellulose Nanofibers, ACS, Applied Material Interfaces, 9, 20330−20339. https://doi.org/10.1021/acsami.6b14650 Zhu K, Hölzel CS, Cui Y, Mayer R, Wang Y, Dietrich R, Didier A, Bassitta R, Märtlbauer E, Ding S (2016) Probiotic Bacillus cereus strains, a potential risk for public health in China. Frontiers in Microbiology 7: 718. doi: 10.3389/fmicb.2016.00718.

Zierler, D., (2011). Invention of Ecocide. Athens, Georgia: University of Georgia Press. ISBN 9786613110404 Yetisen, A., Davis, J., Coskun, A., Church, G., Hyun Yun, S., (2015). Bioart, Trends in Biotechnology, Volume 33, Issue 12, Pages 724- 734. https://doi.org/10.1016/j.tibtech.2015.09.011.

147

Yin, R., Xiang, Y. ., Zhang, Z. ., Tao, X. ., Gluck, J. ., Chiu, K., & Lam, W. (2021). Cleaner production of mulberry spun silk yarns via a shortened and gassing-free production route. Journal of Cleaner Production, 278, 123690–. https://doi.org/10.1016/j.jclepro.2020.123690

APPENDICES

148

Glossary

Definitions and, in some cases, explanations and historical context of terms that may be unfamiliar to design literature.

Acetic acid Assay

A scientific procedure for measuring biochemical activity

Autoclave

Also known as ethanoic acid, is the acid that gives vinegar its characteristic taste. Pure acid is a colourless viscous liquid or glassy solid. Also, a non-greenhouse gas emitted by cellulose- forming bacteria during the cultivation phase

Actin

A strong heated container used for chemical reactions and other processes using high pressure and temperature. e.g. steam sterilization, to sterilise materials

Atom A fibrous protein that forms (together with myosin) the contractile filaments of muscle cells and is also involved in motion in other types of cells

Air-Liquid Interface The smallest part of a chemical element that can exist

Bacteria

The point at which a biofabricated pellicle floats, facilitating simultaneous access to both oxygen and nitrogen in the air, and dissolved nutrients in the liquid below Microscopic, single-celled organisms that thrive in diverse environments (plural of bacterium)

Anaerobic Bacterial Cellulose (BC)

Relating to or requiring an absence of free oxygen

Anaerobic digestion

Also known as microbial cellulose, is a biodegradable, natural cellulose that is synthesized by bacteria. Also known as; microbial cellulose, nanocellulose, bio cellulose, nanobiocellulose, microcellulose, vegan leather, animal-free leather, tree-free fabric

Bio A method of capturing methane emissions from landfill to transform into high-value materials including liquified natural gas (LNG) or biopolymers applicable to textile production (Mango Materials, 2021)

Angstrom

A unit of length used to measure very small distances. One angstrom is equal to 10−10m (one ten-billionth of a metre or 0.1 nanometres)

Anthropocene (anthropocentric, anthropocentrism) The term bio stems from the Greek root word ‘bios’ meaning human life, which has evolved into a prefix commonly used in life science fields, most notably biology. Vitas and Dobovišek combine to author the paper Towards a General Definition of Life in which they refer to NASA’s definition of life as a “self- sustaining chemical system capable of Darwinian evolution” (Vitas and Dobovišek, 2019, p.78).

Bioaccumulate

Nobel Prize-winning climatologist Paul Crutzen proposes that the planet has entered a new geologic epoch, the ‘era of man’, characterised by mass extinction Synthetic chemicals accumulate in the fat tissues of mammals Aseptic

149

Free from contamination caused by bacteria, viruses, or other microorganisms; surgically sterile

Bioart Bioengineering

The use of genetically altered artificial tissues, organs, or organ components to replace damaged or absent body parts. Also used for the engineering of organisms or biological processes

Biofabrication Art practice where humans work with live tissues, bacteria, living organisms, and life processes. Using scientific processes such as biotechnology (including technologies such as genetic engineering, tissue culture, and cloning) the artworks are produced in laboratories, galleries, or artists' studios

Biology

Production of complex biologic products from raw materials such as living cells, matrices, biomaterials, and molecules

Biofilm

A thin but robust layer of mucilage adhering to a solid surface and containing a community of bacteria and other microorganisms

Biomaterial

The natural science that studies life and living organisms, including their physical structure, chemical processes, molecular interactions, physiological mechanisms, development and evolution. Biology is further defined as “the study of living organisms, divided into many specialised fields that cover their morphology, physiology, anatomy, behaviour, origin and distribution” (Oxford Dictionary, 2021).

Biological Living Systems (BLS)

Are open self-organizing life forms that interact with their environment. These systems are maintained by flows of information, energy and matter Originally a term used to define a biological or synthetic substance that can be introduced into body tissue as part of an implanted medical device or used to replace an organ or bodily function that is now used more broadly in the fields of textile design and material science

Biochemistry Biopolymers

Polymers produced by living organisms; in other words, they are polymeric biomolecules. Biopolymers contain monomeric units that are covalently bonded to form larger structures such as cellulose or chitin

Bioregionalism The branch of science that explores the chemical processes within and related to living organisms. It is a laboratory-based science that brings together biology and chemistry. By using chemical knowledge and techniques, biochemists can understand and solve biological problems

Biodesign

Advocacy of the belief that human activity should be largely constrained by ecological or geographical boundaries rather than political ones. The term was coined by Allen Van Newkirk, founder of the Institute for Bioregional Research, in 1975, given currency by Peter Berg and Raymond Dasmann in the early 1970s, and has been advocated by writers such as David Haenke and Kirkpatrick Sale. The bioregionalism perspective opposes a homogeneous economy and consumer culture with its lack of stewardship towards the environment

Carbohydrate

Encompassing interrelated terminologies such as biophilic design, bio-integrated design, biomimetic design and bio-informed design. “A means to incorporate the inherent life-conducive principles of biological living systems into design processes – To transition into a more holistic, sustainable future.” (William Meyers, Biodesign, 2012, p.1). There are many variant definitions for biology, design and consequently for the interdisciplinary field of biodesign which this thesis explores and critiques. It is unclear precisely when the term Biodesign first came into use to describe this emergent interdisciplinary field, with nomenclature variants including bio-design, BioDesign and Bio Design

150

Carbo (carbon) + hydrate (a crystalline compound bound to another compound or element) - any large group of organic compounds - (commonly called ‘carbs’ when referring to food) is a synonym of saccharide, a group that includes sugars, starches and cellulose

Carbon Chthulucene

The chemical element of atomic number 6, a non-metal which has two main forms (diamond and graphite) and which also occurs in compound form in charcoal, soot, and coal.

Carbon credits

Describes our epoch as one in which the human and nonhuman are inextricably linked in tentacular practices. The Chthulucene, Donna Haraway explains, requires sym-poiesis, or making-with, rather than autopoiesis, or self-making. Learning to stay with the trouble of living and dying together on a damaged earth will prove more conducive to the kind of thinking that would provide the means to building more livable futures A permit that allows a country or organization to produce a certain amount of carbon emissions and which can be traded if the full allowance is not used

Climate Anxiety Carbon Dioxide (CO2)

Anxiety arising from the looming threat of climate change

Climate Depression A colourless, odourless gas produced by burning carbon and organic compounds and by respiration. Naturally present in the air (about 0.03%) and absorbed by plants in photosynthesis

Carbon footprint Depression arising from the looming threat of climate change

Coagulant

The amount of carbon dioxide released into the atmosphere as a result of the activities of a particular individual, organization, or community A substance that causes blood or another liquid to coagulate Carbon mining Collaboration

Technology engineered to capture CO2 directly from the atmosphere to transform CO2 into graphene products “Working jointly with others or together especially in an intellectual endeavour” (Merriam-Webster Dictionary, 2021, p.1) Carbon neutral Collagen

Making or resulting in no net release of carbon dioxide into the atmosphere, especially as a result of carbon offsetting The main structural protein found in skin and other connective tissues, widely used in purified form for cosmetic surgical treatments Cellulase Compound

An enzyme that converts cellulose into glucose or a disaccharide A substance formed from two or more elements chemically united in fixed proportions Cellulose Composite

A constructional material made up of several parts or elements

Cotton An insoluble substance that is the main constituent of plant cell walls and vegetable fibres such as cotton. It is a polysaccharide consisting of chains of glucose monomers, Earth’s most abundant biopolymer

Chitin

A soft-white fibrous substance that surrounds the seeds of the cotton plant and is made into textile fibre and thread for sewing. Widely known as the more prevalent cultivated plant for plant-based cellulose A fibrous substance consisting of polysaccharides, which is the major constituent of the exoskeleton of arthropods and the cell walls of fungi. Earth’s second most abundant biopolymer (after cellulose)

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Chromosome

151

A genetic engineering tool that uses a CRISPR sequence of DNA and its associated protein to edit the base pairs of a gene A thread-like structure of nucleic acids and protein found in the nucleus of most living cells, carrying genetic information in the form of genes

Cross-linked ≈ (double tilde symbol)

A chemical bond between chains of atoms in a polymer or other complex molecule This symbol is used to mean ‘approximately’ in this thesis.

Dichloro-diphenyl-trichloroethane (DDT) Dry jet wet spinning

A synthetic organic compound used as an insecticide. Like other chlorinated aromatic hydrocarbons, DDT tends to persist in the environment and become concentrated in animals at the head of the food chain. Its use is now banned in many countries. Deborah Cadbury refers to DDT as a ‘synthetic oestrogen’ (Cadbury, 1998)

Desiccation

To dry out thoroughly

Dextrose A combination of both wet and dry spinning techniques for fibre formation utilising a spinneret located above the spin bath vertically extruding the filament into the fluid. The advantages include the independent spin dope temperature and lesser stretching stress during fibre attenuation in comparison to the wet- spinning process. Applied stretching in the air gap orients the filament before getting into the spin bath. The dry jet wet spinning facility is under development and integrable with the existing wet spinning line for post-spinning operation

Electrospinning

The dextrorotatory form of glucose (and the predominant naturally occurring form). An old name for glucose A spinning method used for extracting nano length fibres from a dissolved solution Dimethyl Sulphoxide (DMSO) Elongation

A colourless liquid used as a solvent and reagent. It is readily able to penetrate the skin and is used in medicinal preparations for skin application

Disaccharide

The deformation in the direction of the load caused by a tensile force measured in units of length or calculated as a percentage of the original specimen length it may be measured at any specified load or the breaking load Any of a class of sugars whose molecules contain two monosaccharide residues End of Life (EOL) Design

A product at the end of its lifecycle that can no longer be updated or repaired and is thus ready for disposal or recycling.

Environmental Design

Creativity engineered to explicitly convey its utilitarian function. Design is further defined as “the art of action of conceiving of and producing a plan or drawing produced to show the look and function or workings of a building, garment or other object before it is made” (Oxford Dictionary, 2021). A design process addressing surrounding environmental parameters when devising plans, programs, policies, buildings, services or products. Dioxin Fibre

A thread or filament from which a vegetable tissue, mineral substance or textile is formed Compound released during combustion processes, pesticide manufacturing, and chlorine bleaching of wood pulp. Consumption of animal fats is thought to be the primary pathway for human exposure Filament Deoxyribonucleic acid (DNA)

A slender threadlike object or fibre, especially one found in animal or plant structures

Fungicide Self-replicating material that is present in nearly all living organisms as the main constituent of chromosomes. It is the carrier of genetic information A chemical that destroys fungus Double Helix Ganoderma australe (Ga)

152

A pair of parallel helices intertwined about a common axis, especially that in the structure of DNA molecule A fungus used for medicinal teas/ preparations in South East Asia/China

Genome Inoculate

Introduce (cells or organisms) into a culture medium

Inoculum

The haploid set of chromosomes in a gamete or microorganism, or each cell of a multicellular organism. The complete set of genes or genetic material present in a cell or organism A substance used for inoculation

Gl Interdisciplinary

G. lucidum is a fungus used for medicinal teas/ preparations in South East Asia/China “Involving two or more academic, scientific, or artistic disciplines” (Merriam- webster Dictionary, 2021, p.1) Gluconacetobacter xylinus Interspecies collaboration

A species of microorganism known to secrete nanofibrillar filaments of cellulose. Current name is Komagataeibacter xylinus

Gram stain

“denotes that the active members of a collaboration are human and nonhuman organisms — this could include bacteria, flora, or animal partners, for example. Interspecies collaborative practices, for art or design, go beyond biomimicry to question the notion of anthropocentrism by inviting nonhuman actors into the making process. This term has been used to describe a methodology for artistic practice.” (Moha jer va Pesaran, 2017, p.86)

In vitro

Laboratory-based cellular research A staining technique for the preliminary staining of bacteria, in which a violet dye is applied, followed by a decolourising agent, and then a red dye. The cell walls of certain bacteria (denoted Gram-positive) retain the first dye and appear violet, while those that lose (denoted Gram- negative) appear red. Named after Hans C. J. Gram the Danish physician who devised the method

In vivo Greenwash Inside a living organism

Ionic Disinformation disseminated by an organisation to present an environmentally responsible public image unsupported by sustainable practices

(of a chemical bond) formed by the electrostatic attraction of oppositely charged ions Graphene

Ionic liquids

Utilised by green chemistry to dissolve cellulose at room temperature Amphiphilic chemical suitable for creating hydrophobicity and conductive materials. Not suitable for decomposition at the end of life. Current solutions include storing in concrete for 100 years

Je ne sais quoi Hemicellulose

Something (such as an appealing quality) that cannot be adequately described or expressed

Any of a class of substances that occur as constituents of the cell walls of plants and are polysaccharides of simpler structure than cellulose Jersey

Hydrolysis

The chemical breakdown of substances by water

Hygroscopic

Ability (of a substance) to absorb moisture from the atmosphere. All fibres have this property in varying degrees A single-knit fabric that is widely known for its stretch and softness. Jersey fabric is thus named because it was first produced on the Isle of Jersey during the medieval era. In the twentieth century, it was primarily associated with underwear before Chanel recontextualised jersey as a multi- purpose textile. Jersey has since become widely used for a plethora of textile applications

Hypha Potato dextrose agar (JPDA)

153

Growth medium from jars of dehydrated ingredients Each of the branching filaments that make up the mycelium of a fungus (plural: hyphae)

Komagataeibacter xylinus (K.xylinus) Material ecology

A known species of cellulose-forming bacteria

Kombucha

A nascent term coined by Neri Oxman describing her multi-modal approach combining the intersection of material science, synthetic biology, bioengineering, computational design Beverage formed by fermenting sweetened tea with a culture of yeast and bacteria Materials science Lab leather

Branch of science that interrogates the value of materials with quantitative apparatus

Methanol (also known as methyl alcohol - CH3OH) Textile produced by bioengineered yeast fed saccharides to produce collagen in vitro (patented by Modern Meadow)

Laminar Flow Cabinet A toxic, colourless, volatile, flammable liquid alcohol, made chiefly by oxidising methane

Microaerophilic Cabinet in which sterile air is blown over manipulations to protect from aerial contamination

Land Management

(Of a microorganism) requiring little free oxygen, or oxygen at a lower partial pressure than that of atmospheric oxygen

Microfibril The way that land is cared for and the transition away from deforestation, heavy water and pesticide use

Life Cycle Analysis (LCA) Very fine fibril, or fibre-like strand, consisting of glycoproteins and cellulose

Microtrends

Start up trends still in the research and development stage

Megatrends

A powerful analytical tool utilised to establish the carbon footprint of design materials and products. A method used to evaluate the environmental impact of a product through its life cycle encompassing extraction and processing of the raw materials, manufacturing, distribution, use, recycling, and final disposal Trends that have become globally important and may be disruptive Leather Microbiology

Collagen flayed from the body of animals for the development of leather for the textile industry A branch of life sciences exploring micro-sized biological systems Large Glucagon Immunoreactivity medium (LGI) Microfibres

Micro-sized fibres that are dislodged from design materials, typically during their use phase

Microorganism Nitrogen-free medium (essential carbon source and salts only) used to trap and grow bacteria that fix atmospheric nitrogen from the air into nitrogen-containing compounds such as proteins that every living organism requires

Lignin A microscopic organism, especially a bacterium, virus or fungus

Microplastics

Micro-sized plastics that are dislodged from design materials, typically during the use phase

Micron A class of complex organic polymers that form key structural materials in the support tissues of vascular plants and some algae. Lignins are particularly important in the formation of cell walls, especially in wood and bark, because they lend rigidity and do not rot easily Unit of measure for fibres (see nanofibrillar) Ionic liquid Micropipette

154

Green chemistry salt-based solvent used to dissolve cellulose to extract fibres with wet-spinning A very fine pipette for measuring, transferring or injecting very small quantities of liquid

Molecule Nitrogen (N2)

A group of atoms bonded together, representing the smallest fundamental unit of a chemical compound that can take part in a chemical reaction A colourless, odourless, tasteless gas that is the most plentiful element in Earth’s atmosphere and is a constituent of all living matter

Mucilage Nitrogen-fixing

Organisms with the capacity to sequester nitrogen from the air

Nitrogenous A viscous secretion or bodily fluid. A polysaccharide substance extracted as a viscous or gelatinous solution from plant roots, seeds, etc., and used in medicines and adhesives Containing nitrogen

Multimodal (interdisciplinary, cross- disciplinary, transdisciplinary) NMNO Practice across previously siloed fields of knowledge Organic compound/Solvent for dissolving cellulose at 115 degrees celsius Mycelium Oestrogen The filamentous hyphae of mushrooms utilised for the biofabrication of biomaterials

Mycology - Branch of life science exploring fungus and yeasts

Mycophobia

Any of a group of steroid hormones that promote the development and maintenance of female characteristics of the body. This hormone is synthesised by many manufactured chemicals including DDT, pesticides, dioxins (from polycarbonate plastics) that are reportedly bioaccumulating in the fat tissues of higher animals (including humans)

Order of Magnitude

A class in a system of classification determined by size, typically in powers of ten (from Latin myco, "fungus") The fear of mushrooms (fungi). The most common cause is that some mushrooms can be poisonous if consumed. People who fear mushrooms may avoid eating mushrooms as well as avoiding touching mushrooms, which may have implications for the emerging biodesign industry Organic chemistry Mycorrhiza

The branch of chemistry that deals with carbon compounds (rather than inorganic salts such as halides, oxides and carbides) A fungus that grows in association with the roots of a plant in a symbiotic or mildly pathogenic relationship Parameters Myosin

A numerical or other measurable factor forming one of a set that defines a system or sets the conditions of its operation A fibrous protein that forms (together with actin) the contractile filaments of muscle cells and is also involved in motion in other types of cells Paris Agreement Nanofibrillar Carbon neutrality by 2030 Nano-length fibre under 100 microns in length Pathogen Nanocellulose

A bacterium, virus or other microorganisms that can cause disease Cellulose fabricated with a matrix of nanolength fibres Polyporus brumalis (Pb) Net Zero Emissions (carbon neutrality)

Fungus used for medicinal teas/ preparations in South East Asia/China

155

'Net zero' means that any emissions are balanced by absorbing an equivalent amount from the atmosphere

Polybrominated biphenyls (PBB) Recycling

Converting (waste) into useable material

Regenerative design

Used in computer monitors, televisions, textiles, and plastics foams to make them more difficult to burn. Production stopped in the mid-1970s, but due to the very slow degradation, PBBs can still be detected in moderate concentrations in the environment Focuses on bringing old or discarded materials back into the design cycle

Petri dish Resource recovery

A shallow, circular, transparent dish with a flat lid, used for the culture of microorganisms. Named after German bacteriologist Julius R Petri Intercepting waste materials destined for landfill that may be utilised as feedstock for the production of new design materials

pH Saccharide

Any of the class of soluble crystalline, typically sweet-tasting carbohydrates found in living tissues and exemplified by glucose and sucrose

Schizophyllum commune (Sc) A figure expressing the acidity or alkalinity of a solution on a logarithmic scale on which 7 is neutral, lower levels are more acidic, higher levels are more alkaline. Each number in the scale represents an order of magnitude

Pipette Edible fungus grown commercially for mushroom production

Secretion

A slender tube attached to or incorporating a bulb, for transferring or measuring out small quantities of liquid in a laboratory

Pleurotus cornucopiae Process by which substances are accumulated or discharged from a cell, gland or organ for a particular function in the organism or ejection

Sequester An edible fungus grown commercially for ‘mushroom’ production

± (plus-minus symbol)

Form a chelate or other stable compound with (an ion, atom or molecule) so that it is no longer available for reactions

Slow Fashion

This symbol has multiple meanings that are field specific. In biology, and other fields of life science, ‘±’ is used to mean “more or less”, which is the meaning used in this thesis.

Polymers

A substance that has a molecular structure built up chiefly or completely from a large number of similar units bonded together It means a radical change in the economic logic and business models of the fashion status quo. ‘Slow’ is an invitation to think about a range of speeds, consumption practices, people, and garments. It is a shift from a monological view of fashion tied up closely with consumerism to a pluralistic, pixelated view of fashion activity and the fashion economy Protein Solastalgia

The feeling of distress associated with environmental change close to your home. Coined by philosopher Glenn Albrecht

Spheres

Hydrosphere, lithosphere, atmosphere, biosphere Animal fibres are made from protein. The protein of wool is keratin, whereas the protein of silk is fibroin. Basic elements in a protein molecule are carbon, hydrogen, oxygen, and nitrogen. Protein fibres have common properties due to similar chemical compositions. Properties of animal fibres are highly resilient, hygroscopic, flame resistant, weak when wet, and do not conduct heat. STM Reagent Solid Test Medium

156

A substance or mixture for use in chemical analysis or other reactions

Sulphuric acid Viscous

Having a thick, sticky consistency between solid and liquid

Viscose (H2SO4) is A strong acid made by oxidising solutions of sulphuric dioxide and used in large quantities as an industrial and laboratory reagent. The concentrated form is an oily, dense, corrosive liquid

Synthetic fibres

Manufactured fibres fabricated from petrochemical and or mineral sources such as oil and coal Fabric made from a viscous orange-brown solution obtained by treating cellulose with sodium hydroxide and carbon disulphide, used as the based of manufacturing regenerated fibres such as rayon and transparent cellulose film Symbiotic Viscosity

Involving interactions between two different organisms living in close physical association. Denotes a mutually beneficial relationship between two different groups. A quantity expressing the magnitude of internal friction in a fluid, as measured by the force per unit area resisting uniform flow

Tendril Wet-spinning

A slender thread-like appendage of a climbing plant, often growing in a spiral form, which stretches out and twines around any available support

Tensile Strength

Specifically, the maximum tensile stress expressed in force per unit cross-sectional area of the unstrained specimen, e.g., kilograms per square millimetre

Textile A form of spinning where polymer powder is dissolved in a suitable solvent and the polymer solution is extruded through a spinneret into a solvent-non solvent mixture (coagulant). Due to mutual diffusion of solvent and non-solvent, polymer solution coagulates to form fibres. The coagulated fibres are washed at several stages to remove the trapped solvent and then stretched under wet and dry conditions to achieve desired fibre denier. The fibre is also coated through a spin finish solution to improve its handleability A knitted, woven or non-woven material Yarn Trametes versicolor (Tv) Spun thread used for knitting, weaving or sewing

Fungus used for medicinal teas/ preparations in South East Asia/China

Upcycling

Reuse (discarded objects or materials) in such a way as to create a product of higher quality or value than the original

Urine

Mammals excrete excess water, salt, nitrogen compounds such as urea, hormones such as oestrogen. There is a history of recovering horse urine to dye textiles yellow.

Viscometer

157

An instrument for measuring the viscosity of liquids

Food Waste Experiment Recipes

Quanitity of:

Figure reference

Feedstock recovered from waste

Waste

Water

K. xylinus

1 metric cup

1 litre

1 teaspoon

3.11

Garlic peels

1 metric cup

1 litre

1 teaspoon

3.12

Banana skin

1 metric cup

1 litre

1 teaspoon

3.13

Blueberries

1 metric cup

1 litre

1 teaspoon

3.15

Grapefruit peel

1 metric cup

1 litre

1 teaspoon

3.16

Human urine

1 metric cup

1 litre

1 teaspoon

3.17

Wine lees

Table 5.1

158

Master's thesis of Design: Between studio and lab: explorations with bacterial cellulose

BETWEEN STUDIO AND LAB: EXPLORATIONS WITH BACTERIAL CELLULOSE

ALEXANDER ‘ALEXI’ FREEMAN

DECLARATION

ACKNOWLEDGMENTS

TABLE OF CONTENTS

INTRODUCTION

SECTION 1: Frameworks

CHAPTER 1

Bacterial Cellulose: Fibres Secreted By Microorganisms

CHAPTER 2 Community Of Practice: Situating Within Biodesign

SECTION 2: Practice-Based Experimentation And Reflections

CHAPTER 3

Studio-Based Experimentation

CHAPTER 4

Laboratory-Based Experimentation

Introduction ............................................................................................................................................... 90 PART 1

PART 2

PART 3

CHAPTER 5

Reflections

CONCLUSION

.................................................................................................................................... 126

LIST OF DIAGRAMS, TABLES AND FIGURES

ABBREVIATIONS

BC

Na

NA

CCO

CEO

NCBI

CRISPR Clustered Regularly Interspaced

NFb

CH3OH Methanol or methyl alcohol

NMMO

CSO

PBB

CTO

Pb

CTM

pH

DDT

PPM

DNA

PPB

DP

PPT

DFD

Q&Q

EOL

SEM

FFP

Sc

FTIR

SCOBY

Ga

STM

Gl

H2SO4 Sulphuric acid

HS

TFA

IP

Tv

JPDA

VPO

LCA

LGI

MALDI-TOF MS Matrix-Assisted Laser Desorption Infrared-Time of Flight Mass Spectrometry

ABSTRACT

INTRODUCTION Thesis Structure

SECTION 1: Frameworks

BACKGROUND AND MOTIVATIONS

ENVIRONMENTAL IMPACTS OF FIBRE, FASHION AND TEXTILES

FIBRE TYPES

TEXTILE WASTE & EMISSIONS MANAGEMENT

OVERVIEW OF DESIGN AND SCIENCE METHODOLOGIES

CHAPTER 1 Bacterial Cellulose: Fibres Secreted By Microorganisms

CELLULOSE

ETYMOLOGY

CULTURE AND PHYSIOLOGY