The Pdx1 family is structurally and functionally conserved between Arabidopsis thaliana and Ginkgo biloba Jan E. Leuendorf1, Andreas Genau2, Agnieszka Szewczyk3, Sutton Mooney4, Christel Drewke2, Eckhard Leistner2 and Hanjo Hellmann1,4
1 Angewandte Genetik, Freie Universita¨ t, Berlin, Germany 2 Istitut fu¨ r Pharmazeutische Biologie, Rheinische Friedrich-Wilhelms-Universita¨ t, Bonn, Germany 3 Pharmaceutical Faculty of the Collegium Medicum, Jagiellonian University, Krakow, Poland 4 School of Biological Sciences, Washington State University, Pullman, USA
Keywords Ginkgo biloba; ginkgotoxin; PDX1; PDX2; vitamin B6
Correspondence H. Hellmann, School of Biological Sciences, Washington State University, Pullman, WA 99164-4236, USA Fax: +1 509 335 3184 Tel: +1 509 335 2762 E-mail: hellmann@wsu.edu
Vitamin B6 is one of the most important compounds in living organisms, and its biosynthesis has only recently been understood. Because it is required for more than 100 biochemical reactions, lack of the vitamin is fatal. This is of special importance to mammals and humans, which cannot biosynthesize the vitamin and thus depend on its external uptake. Here we describe the cloning of a vitamin B6 biosynthetic gene GbPDX1 from Ginkgo biloba. The gene is expressed in seeds, leaf and trunk tissue. Using yeast 2-hybrid and pull-down assays, we show that the protein can interact with itself and with members of Arabidopsis thaliana AtPDX1 and At- PDX2 families. Furthermore, we prove the function of GbPDX1 in vita- min B6 biosynthesis by complementation of an Arabidopsis AtPDX1.3 mutant rsr4-1, at the phenotypical level and increasing vitamin B6 levels caused by ectopic GbPDX1 expression in the mutant background. Overall, this study provides a first description of Ginkgo vitamin B6 metabolism, and demonstrates a high degree of conservation between Ginkgo and Ara- bidopsis.
Database Sequences from this article have been submitted to the GenBank database ⁄ DDBJ ⁄ EMBL data libraries under the accession numbers: AtPDX1.1 (NP_181358), AtPDX1.2 (NP_188226), AtPDX1.3 (NP_195761), and AtPDX2 (NP_568922). GgPDX1 (AAK18310)
(Received 15 October 2007, revised 4 December 2007, accepted 21 December 2007)
doi:10.1111/j.1742-4658.2008.06275.x
The maidenhair tree Ginkgo biloba is known to have existed since the late Triassic period [1], and is there- fore often taken to be a living fossil. For a gymno- sperm, it possesses unique developmental features like its dichotomously branching veins in the leaf vascular tissue and its motile spermatozoids; the latter shared only with the Cycadaceae family. The tree has long been recognized for its therapeutic value, and there are a variety of medications currently on the market containing ginkgolides and bilobalide which are unique
to Ginkgo. The tree also synthesizes ginkgotoxin, (4¢-O-methylpyridoxine), a derivative of vitamin B6 that is found in Ginkgo seeds, leafs and medications [2,3]. Poisoning from this neurotoxin can cause epileptic seizures, leg paralysis, loss of consciousness and even death. It has been observed that because of its struc- tural similarity to B6 vitamers, ginkgotoxin functions as an antivitamin, interfering with vitamin B6 metabo- lism [3,4]. The apparently unique and yet unknown pathway of 4¢-O-methylpyridoxine biosynthesis makes
Abbreviations DXP, deoxyxylulose 5-phosphate; PL, pyridoxal; PLP, pyridoxal-5¢-phosphate; PM, pyridoxamine; PMP, pyridoxamine-5¢-phosphate; PN, pyridoxol.
FEBS Journal 275 (2008) 960–969 ª 2008 The Authors Journal compilation ª 2008 FEBS
960
J. E. Leuendorf et al.
Characterization of Ginkgo PDX1
not
[26].
assemble with AtPDX2
Ginkgo an especially attractive plant in which to study vitamin B6 metabolism.
[17,26,27,32]. Double mutants
for abiotic stress
The term vitamin B6 (further denoted as vitB6) comprises a group of three different vitamers that vary at their 4¢ position in either a hydroxyl (pyridoxol; PN), an aldehyde (pyridoxal; PL), or an amino (pyri- doxamine; PM) group. The phosphorylated forms of PL and PM, pyridoxal-5¢-phosphate (PLP) or pyridox- respectively, are highly amine-5¢-phosphate (PMP), important for amino acid metabolism. Here, they serve as cofactors in transamination, decarboxylation, and elimination reactions [5].
regulated
various
abiotic
by
Single does AtPDX1.1 and AtPDX1.3 loss-of-function mutants show severe developmental changes such as shorter root growth, reduced chlorophyll content and retarded for flowering time AtPDX1.1 and AtPDX1.3, as well as AtPDX2 null mutants, develop embryo lethal phenotypes [17,27]. Interestingly, it appears that, in Arabidopsis, PDX1 is tolerance because loss of vital AtPDX1.1 and AtPDX1.3 proteins leads to multiple hypersensitivities such as salt, oxidative and UV stress [27,32]. Furthermore, expression of all PDX1 genes is stressors strongly [27,29,32]. Currently, it is not known whether the work on Arabidopsis is representative of the plant kingdom or whether alternative pathways are present.
In this study, we show original cloning of
and
glyceraldehyde-3-phosphate to
phosphate)
the GbPDX1 gene from G. biloba. Using yeast 2-hybrid and pull-down analysis, we show that the protein can interact with all the Arabidopsis PDX proteins, as well as with itself, and these are important criteria for its function in a PLP synthase complex. In planta func- tionality is demonstrated by complementation of an Arabidopsis thaliana pdx1.3G54S ⁄ rsr4-1 mutant. North- ern blot analysis shows that GbPDX1 is expressed in G. biloba leaf, trunk and seeds. Overall, this study provides first information on vitamin B6 biosynthetic proteins from gymnosperms.
Results
Cloning and sequence analysis of GbPDX1
is noteworthy that
recent
it
Since the discovery of vitB6 in 1934 [6], three bio- synthetic pathways have been described: first, a de novo deoxyxylulose 5-phosphate (DXP)-dependent pathway present in eubacteria, such as Escherichia coli [7–11], second, the salvage pathway, which has been described in bacteria, fungi and plants [5,12–16], and third a de novo DXP-independent pathway, present in some bacteria, archaea and eukarya [17–20]. The DXP-inde- pendent pathway is based on the concerted interaction of two enzymes: a glutaminase, PDX2 (for pyridoxine biosynthesis protein), that provides NH3 by deamina- tion of l-glutamine, and PDX1, which utilizes the NH3 together with ribose-5-phosphate (or ribulose- (or 5-phosphate) dihydroxyacetone synthesize PLP [11,17,20,21]. PDX1 and PDX2 proteins assemble into a PLP synthase complex and its composition and structure have been resolved for Thermotoga maritima and Bacillus subtilis synthase [22,23]. Here, the PLP complex forms a dodecameric, cogwheel-like structure of 12 PDX1 proteins to which 12 additional PDX2 proteins attach [23]. Previous studies on PDX1 and PDX2 indicated that the glutaminase activity of PDX2 requires complex formation with PDX1 [24,25]. In this context, studies also showed that l-glutamine strengthens the association of PDX2 proteins with the PDX1 cogwheel [21].
In an effort to understand vitB6 metabolism in the tree G. biloba, and whether the biosynthetic pathways of vitB6 are conserved between G. biloba and higher an- giosperms, we decided to clone a PDX1 homolog from this species. Because the Ginkgo genome has not yet been sequenced, it was decided to identify conserved stretches of DNA that would allow for a high proba- bility to amplify a GbPDX1 fragment. DNA sequences of four different PDX1 genes from plants (A. thaliana, Hevea brasiliensis, Nicotiana tabacum and Phaseolus vulgaris) were aligned. Two conserved locations were identified which, based on the Arabidopsis AtPDX1 sequence, were located around 270 bp from the start codon and 180 bp from the stop codon, respectively (Fig. 1A).
These two sites were used to design degenerated primers for a PCR-based cloning strategy of the corre- sponding GbPDX1 DNA. It is noteworthy that none of the PDX1 genes described to date from plants and non-plant organisms contain introns in their coding
In plants, current knowledge on vitB6 biosynthesis and PDX protein activity originates mainly from the Brassicaceae Arabidopsis thaliana [17,26–29], but work has also been done in Nicotianae tabacum and Phaseo- lus vulgaris [30,31]. The Arabidopsis genome encodes for three AtPDX1 proteins, AtPDX1.1, 1.2 and 1.3, but only one AtPDX2 protein [17,26]. Although the three AtPDX1 proteins are highly related to each other, not all of them participate in PLP biosynthesis [17]. Such activities have been demonstrated for AtPDX1.1 and AtPDX1.3 only, whereas the precise biological role of AtPDX1.2 remains open. Consistent with this finding, a recent study has shown that At- in contrast to AtPDX1.1. and AtPDX1.3, PDX1.2,
FEBS Journal 275 (2008) 960–969 ª 2008 The Authors Journal compilation ª 2008 FEBS
961
J. E. Leuendorf et al.
Characterization of Ginkgo PDX1
0.030
TaPDX1
E
A
0.022
0.060
OsPDX1.3
0.032
0.023
OsPDX1.1
0.021
7
0.028
OsPDX1.2
0.300
AtPDX1.2
0.030
AtPDX1.3
6
B
0.025
HbPDX1
0.019
GmPDX1
5
500 bp-
4
0.020
PvPDX1
3
0.041
MtPDX1
0.027
2 0.076
LcPDX1
C
1
0.034
NtPDX1
0.066
AtPDX1.1
0.005 0.009 0.007 0.009 0.007 0.006 0.011
1 2 3 4 5 6 7
0.05 changes
GbPDX1
500 bp
D
500 bp
(japonica
sativa
Fig. 1. Cloning of GbPDX1. (A) Alignment of PDX1 sequences from four different organisms showing sites (gray shaded) that were used to design a forward degenerated primer PDX1-FW (upper) and a reverse degenerated primer PDX1-RW (lower) to identify conserved regions within the PDX1 coding sequences. Bold printed residues represent identical residues. (B) Right: schematic drawing of full-length GbPDX1 (gray bar) and location and orientation of degenerated primers (gray arrows). Left: a central 500 bp fragment was cloned based on degener- ated primers which allowed (C) 5¢-RACE and (D) 3¢-RACE resulting in two 550 bp fragments marked by asterisks, respectively. (E) Phylo- genetic tree of PDX1 in plant species. The tree was generated using CLUSTAL W [51] for sequence alignment (Gonnet series was used as weight matrix, with a gap open penalty of 10.00 and a gap extension penalty of 0.1), and the PAUP* program (the neighbour-joining method was used, random seed number was 111, numbers represent mean amino acid changes ⁄ sites) to generate a tree with GbPDX1 as root. At, Arabidopsis thaliana ecotype Columbia, AtPDX1.1 (accession number NP_181358); AtPDX1.2 (accession number NP_188226); AtPDX1.3 (accession number NP_195761); Gb, Ginkgo biloba, GbPDX1 (accession number AAK18310); Gm, Glycine max, GmPDX1 (AAZ67142); Hb, Hevea brasiliensis, HbPDX1 (accession number Q39963); Lc, Lotus corniculatus var. Japonicus, LcPDX1 (accession number AAZ67141); Mt, Medicago truncutula, MtPDX1 (accession number AAZ67140); Nt, Nicotiana tabacum (Burley 21 cultivar), NtPDX1 (accession number cultivar-group), OsPDX1.1 (accession number NP_001058669); OsPDX1.2 (accession AY532656); Os, Oryza number NP_001064010); OsPDX1.3 (accession number NP_001068563); Pv, Phaseolus vulgaris (Taylor’s horticultural), PvPDX1 (accession number Q9FT25); Ta, Triticum aestivum (cultivar = ‘Jing 411’), TaPDX1 (accession number AAZ94411).
regions [33]. We expected a similar situation to be present in Ginkgo and decided to use the degenerated primers directly on genomic DNA. As shown in Fig. 1B, a distinct PCR product of (cid:2) 500 bp was obtained. Sequencing of the fragment and alignment with other PDX1 sequences confirmed that the ampli- fied DNA encoded for a partial GbPDX1 gene. Based
on the new sequence information, upstream and downstream sequences were recovered using 5¢- and 3¢-RACE approaches [34]. In both cases, fragments of (cid:2) 550 bp were amplified (Fig. 1C,D) which allowed determination of start and stop codon sites to generate primers for amplification of a full-length GbPDX1 gene from Ginkgo genomic DNA. The full-length sequence
FEBS Journal 275 (2008) 960–969 ª 2008 The Authors Journal compilation ª 2008 FEBS
962
J. E. Leuendorf et al.
Characterization of Ginkgo PDX1
A
pBTM:GbPDX1
Bait
Prey
SDII
SDIV
/
Tru n k
3-w e e k-old le af 6-w e e k-old le af m ergin g le af S e e d
E
AtPDX1.1
/
GbPDX1
AtPDX1.2
/
Total RNA loaded
AtPDX1.3
/
AtPDX2
/
Fig. 2. Northern blot analysis of GbPDX1 expression. Transcript was weakly expressed in the trunk, moderately expressed in three stages of leaf development and strongly expressed in seeds of the Ginkgo tree.
GbPDX1
/
information has been annotated previously in NCBI (http://www.ncbi.nlm.nih.gov/) as AAK18310.
pACT
/
X 1
D
C
S T: G b P
S T
G
G
B In p ut
Input
AtPDX1.1:myc
GST:GbPDX1
AtPDX1.2:myc
72 55 40
34
Evolutionary comparison of the sequence with other known plant PDX1 proteins shows that Ginkgo groups more closely with other dicots, such as tobacco and beans, than monocots, such as rice and wheat (Fig. 1E). Among the dicots, Ginkgo GbPDX1 is most closely related to Arabidopsis AtPDX1.1, followed by rubber tree, HbPDX1, and a second Arabidopsis protein, AtPDX1.3. Both AtPDX1.1 and AtPDX1.3 have been shown to participate in vitamin B6 biosynthesis [17].
AtPDX1.3:myc
GST
26
AtPDX2:myc
Expression of GbPDX1
Fig. 3. Yeast 2-hybrid and pull-down analysis of GbPDX1 interac- tions. (A) GbPDX1 can self-assemble in the yeast system but also with all AtPDX1 members and with AtPDX2. SDII, selection med- ium for transformation with bait (pBTM112-D9) and prey (pACT2) plasmids supplemented with uracil and histidine; SDIV, selection medium for interaction without uracil and histidine supplementa- tion. SDIV colony dilution series of 1 : 200, 1 : 2000, 1 : 20 000. (B) Pull-down analysis with GST:GbPDX1 and in planta expressed AtPDX proteins demonstrates assembly of GbPDX1 with all AtPDX1 family members and AtPDX2. Input represents 30 lg of total plant protein extract. (C) Coomassie Brilliant Blue-stained gel showing purified GST and GST:GbPDX1 proteins used for pull-down of in planta expressed AtPDX proteins shown in (B). Numbers on the left-hand site indicate size in kDa.
Northern blot analysis was performed to identify tis- sue-specific expression of the GbPDX1 transcript in the Ginkgo tree (Fig. 2). Ginkgotoxin accumulates mainly in the seeds, but is also found in the leaves, whose extracts are used as herbal remedies [3,35]. The pres- ence of GbPDX1 in the sampled tissues reflected the levels of this vitB6 derivative. Weak expression was detected in the trunk of 2-year-old Ginkgo and moder- ate expression was detected in 6-week-old, 3-week-old and emerging leaves (Fig. 2). Strong expression was seen in the inner nut of 6-month-old seeds (Fig. 2). Neither tissue yielded sufficient root nor flower amounts of RNA to allow detection.
GbPDX1 assembles with Arabidopsis PDX proteins
this,
AtPDX1.3 also with AtPDX2 [26]. To investigate whether GbPDX1 is likewise able to assemble with other PDX1 and PDX2 proteins a Y2H approach was followed. As shown in Fig. 3, GbPDX1 shows strong self-assembly capabilities (Fig. 3). In addition the pro- tein can also interact with all three AtPDX1 proteins and AtPDX2 (Fig. 3). Y2H data were further corrobo- the different rated by pulldown assays. For AtPDX proteins were fused with myc-epitopes and overexpressed in Arabidopsis. Pulldown assays with
Previous work on bacterial PDX proteins has shown their assembly into higher order complexes [23]. For plant PDX proteins it was demonstrated that the Arabidopsis AtPDX1 family members AtPDX1.1, AtPDX1.2, and AtPDX1.3 homo- and heteroassemble among themselves, and in the case of AtPDX1.1 and
FEBS Journal 275 (2008) 960–969 ª 2008 The Authors Journal compilation ª 2008 FEBS
963
J. E. Leuendorf et al.
Characterization of Ginkgo PDX1
expressed
purified GST
and and bacterially GST:GbPDX1 proteins showed that in planta expres- sed AtPDX proteins co-precipitate with GST:GbPDX1 but not with GST alone. These findings provide strong evidence that GbPDX1 can assemble to a functional PLP synthase in planta.
Functional complementation of rsr4-1 by ectopic expression of GbPDX1
showed
the Arabidopsis
that
family members
We previously described an rsr4-1 Arabidopsis mutant that is mutated in AtPDX1.3 [26]. Analysis of the thaliana mutation pdx1.3G54S ⁄ rsr4-1 mutant is incapable of assembling with other AtPDX1 and with AtPDX2 [26]. As a result of this mutation, rsr4-1 plants develop only short primary roots and yellowish
leaves that contain (cid:2) 25% less chlorophyll in compari- son with wild-type [26]. Supplementation of the growth medium with vitB6 fully restored the aberrant develop- ment of rsr4-1, and this need for an external supply of the vitamin was reflected by strongly a reduced pyri- doxine content in the mutant [26]. In an attempt to demonstrate that GbPDX1 is fully functional we introduced the gene under the control of a 35S pro- moter (further referred to as 35S:GbPDX1) into rsr4-1. Although around 50 single rsr4-1 plants were inde- pendently transformed with the construct, only 15 transformants were generated in total. Of these, four showed normalization of growth similar to wild-type, indicating complementation of the rsr4-1 mutation by GbPDX1. Two of the four plants, 35S:GbPDX1#6 and 35S:GbPDX1#7 were examined in more detail (Fig. 4). RT-PCR showed expression of GbPDX1 in
35
A
B
)
30
m m
GbPDX1
25
20
AtPDX1.3
15
( n i h t g n e l t o o R
10
actin2
5
0
C 2 4
C 2 4
D
D
rsr4-1
D
D
b P
b P
X 1 # 7 /rsr4-1
b P
b P
X 1 # 6 /rsr4-1
X 1 # 7 /rsr4-1
X 1 # 6 /rsr4-1 3 5 S: G
rsr4-1 3 5 S: G
3 5 S: G
3 5 S: G
C
D
3
E rsr4-1
#7
2.5
– pyr
2
1.5
1
) g ( n i t h g i e w h s e r F
+ pyr
0.5
#6
C24
0
C 2 4
C 2 4
rsr4-1
D
D
b P
b P
X 1 # 7 /rsr4-1
X 1 # 7 /rsr4-1
3 5 S: G
rsr4-1 3 5 S: G
Fig. 4. Complementation of rsr4-1 by GbPDX1. (A) RT-PCR confirms expression of 35S:GbPDX1 in the rsr4-1 Arabidopsis mutant back- ground. (B,C) Root elongation in the absence of pyridoxine is restored in the rsr4-1 mutant seedling by ectopic GbPDX1 expression. (D) Fresh weight of 3-week-old rosettes demonstrated complementation of the rsr4-1 mutant by GbPDX1 to wild-type levels. (E) Leaves regain wild-type size and pigment when the transgene is expressed in the rsr4-1 mutant.
FEBS Journal 275 (2008) 960–969 ª 2008 The Authors Journal compilation ª 2008 FEBS
964
J. E. Leuendorf et al.
Characterization of Ginkgo PDX1
Discussion
the rsr4-1 background comparable with levels of the Arabidopsis homolog AtPDX1.3 (Fig. 4A). Primary root elongation of the transformed seedlings was restored to wild-type length in the absence of supple- mented pyridoxine (Fig. 4B,C). As shown in Fig. 4E, GbPDX1 restored rosette leaves to wild-type appear- ance in terms of both size and pigmentation. Quantifi- cation of fresh weight from 3-week-old rosettes also showed restoration of the mutant by the transgene to wild-type (Fig. 4D).
Based on its special ability to produce 4¢-O-methylpyri- doxine, G. biloba is probably one of the most interest- ing plant species in which to study vitB6 metabolism and biochemistry. In this first study on a GbPDX1 pro- tein, we have shown in planta functional conservation of this protein with Arabidopsis by complementation of the AtPDX1.3 mutant rsr4-1 with the respective gene, evidenced by normalization of growth and an increase in vitB6 content. Here, the yeast 2-hybrid data also clearly demonstrate the same assembly characteristics as described previously for Arabidopsis proteins [26], and one may expect that GbPDX1 complex assembly is comparable with that found for Arabidopsis.
It
(supplementary Fig. S1),
Measurements of pyridoxine levels in 35S:GbPDX1 yielded further evidence of the functionality of the GbPDX1 protein in Arabidopsis. The B6 vitamer PL has previously been shown to be reduced by 37% in the rsr4-1 mutant [26]. Although measurements varied from those in previous studies, possibly due to differ- ent growth conditions and the use of a different HPLC machine, comparison of wild-type, rsr4-1 and rsr4-1 expressing 35S:GbPDX1 showed that PL content was strongly reduced, this time even to 27% of wild-type levels (Table 1). For PM, a reduction of 50% was measured in rsr4-1, whereas PN was hardly detectable in the mutant. Expression of the GbPDX1 transgene restored PL and PM content in the mutant to (cid:2) 50% and (cid:2) 80%, respectively, compared with the wild-type, whereas no increase was detectable for PN (Table 1). The data prove that GbPDX1 is functional in planta and that the protein can mediate vitB6 biosynthesis in Arabidopsis.
is curious to note that ectopic expression of GbPDX1 in rsr4-1 did not result in full recovery of vitB6, but recovery to only (cid:2) 50 and 77% of the mainly occurring vitB6 derivatives PL and PM, respec- tively. Although this increase was sufficient to permit normal plant growth, it might indicate different bio- chemical properties of GbPDX1 and AtPDX1.3. This notion was further supported by the finding that GbPDX1 does not complement an E. coli pdxJ19 mutant an experimental approach that was possible with Arabidopsis and Cer- cospora nicotianae proteins [26,36]. However, our data clearly show that PDX1 proteins remained remarkably conserved within the two different species, thus, overall underscoring the functional relevance of vitB6 biosyn- thesis for plant metabolism.
contents
in
C24 wild-type,
rsr4-1
and
Table 1. VitB6 35S:GbPDX1 ⁄ rsr4-1. FW, fresh weight.
Genotype
Experiment
PN lgÆg)1 FW
PM lgÆg)1 FW
PL lgÆg)1 FW
C24
1 2 3 Mean value SE
1.817 1.380 1.747 1.648 0.235
24.193 17.916 26.844 22.984 4.585
82.993 66.434 77.407 75.611 8.424
rsr4-1
1 2 3 Mean value SE
0.018 0.012 0.010 0.013 0.004
11.834 10.534 7.737 10.035 2.100
25.422 22.038 14.818 20.759 5.416
35S:GbPDX1 ⁄ rsr4-1
1 2 3 Mean value SE
0.013 0.009 0.009 0.010 0.002
19.106 16.558 18.024 17.896 1.279
49.980 31.999 38.148 40.042 9.139
Differences between C24, rsr4-1 and 35S:PbPDX1 ⁄ rsr4-1 were all significant with P < 0.05.
It remains unknown whether Ginkgo encodes for more than the one GbPDX1 gene described here. The degenerated primers we used only resulted in amplifi- cation of one GbPDX1 fragment and we found no indication of additional GbPDX1 genes. However, other plant species like Arabidopsis and rice encode for small PDX1 gene families, and it is likely that Ginkgo expresses more than one PDX1 gene. Clearly, it would also be interesting to gain some information on GbPDX2 proteins. For example, it would be interest- ing to test whether a GbPDX2 is as capable of com- plementing an atpdx2 mutant as GbPDX1 did for rsr4-1. We started to clone GbPDX2 using an approach similar to that used for GbPDX1, but to date we have not been not successful in amplifying a corresponding gene from genomic DNA or RNA (JE Leuendorf, personal communication). However, this is not surprising because, first, PDX2 genes contain introns and have thus a more complex architecture than PDX1, and second, in our sequence comparison, PDX2 appeared to be less conserved on the DNA level than what we observed for PDX1 genes.
FEBS Journal 275 (2008) 960–969 ª 2008 The Authors Journal compilation ª 2008 FEBS
965
J. E. Leuendorf et al.
Characterization of Ginkgo PDX1
Based on the northern blot analysis of the tested tis- sues, expression of GbPDX1 is highest in seeds. This is consistent with previous work on the ginkgotoxin, which was found to be in the highest concentration in seeds [35,37], and one might expect a correlating biosynthetic activity of vitB6 as the precursor of ginkgotoxin [2].
Cloning of the GbPDX1 central fragment and 5¢- and 3¢-RACE
regeneration [43],
cell
the medium was exchanged. For northern blot analysis, seeds around 6 months old were used without any pretreat- ment. Shells were broken using a clean nutcracker and the inner nut was used directly for RNA extraction. Leaf and stem tissue was harvested in spring and early summer from a male tree grown on open ground.
In future, it will be interesting to also clone PDX2 from Ginkgo and to identify methylases responsible for vitB6 modification leading to ginkgotoxin biosynthesis. The understanding and identification of this particular regulatory pathway is of particular importance because the Ginkgo tree is of commercial interest in connection with Alzheimer’s disease [38,39] and heart disease [40]. The tree is rich in flavonoids which reduce free radicals [41]. Terpenoids, like ginkgolides and bilobalides, have been shown to inhibit platelet-activating factor and thereby diminish inflammation [42], and protect nerve cells, as well as being involved in the promotion of motoric nerve respectively. However, it is noteworthy that ginkgotoxin is present in various plant organs including leaf, the main tissue used in the extraction of beneficial and toxic Ginkgo compounds, and that because of the high ginkgotoxin content, consumption of Ginkgo seeds leads to ‘gin- nan sitotoxism’, a syndrome characterized by severe symptoms such as epileptic convulsion and loss of con- sciousness [3,37,44]. Hence, understanding the biosyn- thesis of ginkgotoxin can help to prevent accumulation of the toxin in specific tissues and thereby provide easier access to therapeutic means in the future.
Experimental procedures
Plant material, tissue culture and transformation
and
Northern blot analysis
To clone the central GbPDX1 fragment, genomic DNA was isolated as described previously [48], and used for PCR with the degenerated primers PDX1-1-FW (GCHGTIA CDATYCCIGTIATG; with Y = T ⁄ C, S = C ⁄ G, R = A ⁄ G, D = T ⁄ A ⁄ G, H = A ⁄ C ⁄ T, N = A ⁄ T ⁄ C ⁄ G, I (Ino- sin)), and PDX1-1-RW (HCCITCICAICCSARYTGCAT). For RACE a switching mechanism at the 5-end of RNA [34] PCR cDNA synthesis kit transcriptions (SMART) (Clontech, Mountain View, CA) was used. Poly(A+)RNA was isolated from G. biloba cell suspension (100 mg) using a QuickPrepMicro mRNA purification kit (Amersham Pharmacia Biotech, Vienna, Austria). We used 0.5 lg poly(A+) RNA for cDNA biosynthesis. First- and second- strand biosynthesis was carried out using the primers QT2 (GACCACGCGTATCGATGTCGACTTTTTTTTTTTTT TTTV) and SMART II-5¢ (AAGCAGTGGTAACAACG CAGAGTACGCGGG), respectively. Subsequent 5¢-RACE was performed with the primers SMARTnested (AAG PDX1-2-Race CAGTGGTAACAACGCAGAGT) (CGGCAATTCCGACATCCACACAC). 3¢-RACE was followed using the primers PDX1-3-Race (GAGGCAGT GAGGCATGTGGAAGC) and Q1 (GACCACGCGTAT CGATGTCGAC). PCR products were verified by nested PCR using the primers PDX1-1-Race (GTGCATATC ATCTGCAGGAGTGAG) ⁄ SMARTnested (5¢-RACE) and PDX1-4-Race (CAGATTGCTGCTCCCTATGAGCTTG) ⁄ Q1 (3¢-RACE). In general, all products were subcloned into the vector pCR2.1 (Invitrogen, Carlsbad, CA) and sequenced before further use. PCR-based cloning of full- length GbPDX1 was achieved with the primers GbPDX1- Start (GGGATCCATGGCCAGCGACGGAGTTGTGAC) and GbPDX1-Stop (TGCGTCGACCTACTCTGACCTCT CTGCATATCG).
FEBS Journal 275 (2008) 960–969 ª 2008 The Authors Journal compilation ª 2008 FEBS
966
RNA isolation was adapted from Wang et al. [49]. Plant material ((cid:2) 5 g of tissue) was harvested and directly shock- frozen in liquid nitrogen. After grinding the tissue, extrac- tion buffer was added (2% CTAB, 100 mm Tris ⁄ HCl pH 7.4, 2 m NaCl, 25 mm EDTA pH 8.0, 2% polyvinyl- polyvinylpyrrolidone, 4% 2-mercaptoethanol; all chemicals from SIGMA-Aldrich, St Louis, MO). Extracts were incuba- ted for 10 min at 65 (cid:2)C before chloroform ⁄ isoamylalcohol Arabidopsis thaliana ecotypes C24 and mutant plants were grown in a greenhouse under standard conditions and in tissue culture on solid MS medium [45]. Root elongation growth assays were performed as described previously [26]. Plants were transformed using an Agrobacterium tumefac- iens-mediated transfer protocol as described elsewhere [46]. Ginkgo biloba callus and suspension cultures for cloning PDX1 were generated from seeds and leaves. For surface sterilization, material was incubated for 5 min in a 0.1% (w ⁄ v) mercury dichloride solution. The material was given three 5 min washes in sterile H2O. Treated material was cut into pieces (1 cm in diameter). The pieces were transferred to a solid plant culture medium [47] and cultured (20 (cid:2)C, 24 h light) until callus developed. To generate cell-suspen- sion cultures, 8–10 g of callus was transferred into 100 mL liquid plant culture medium [47], and cultured for of 10 days with shaking (20 (cid:2)C, 24 h light, 60 r.p.m.) before
J. E. Leuendorf et al.
Characterization of Ginkgo PDX1
(25 : 24 : 1 v ⁄ v ⁄ v)
Acknowledgements
We would like to thank the gardeners for excellent work, and Quimin Tan for providing advice on gener- ating the phylogenetic tree. Funding for this project was provided by the DFG (DFG grant proposal num- ber HE3224 ⁄ 6-1).
References
(New England Biolabs, Frankfurt, pMal-c2 vector complementation analysis, an E. coli Germany). For pdxJ19 mutant [http://cgsc.biology.yale.edu:80/cgi-bin/ sybgw/cgsc/Strain/11585] was transformed with either the recombinant plasmid carrying the gene coding for GbPDX1 or with empty vector. The different strains were grown in Luria–Bertani medium supplemented with penicillin G (100 lgÆmL)1) until an attenuance (D600) of (cid:2) 0.3 was reached. After being washed twice with minimal medium supplemented with thiamine (1 lgÆmL)1) and isopropyl thio-b-d-galactoside (0.03 mm) cells were transferred to 100 mL of the same medium and grown for a further 70 h. (25 : 24 : 1 v ⁄ v ⁄ v),
Yeast 2-hybrid and pull-down assays
(24 : 1 v ⁄ v) was added and carefully mixed. Phases were separated by centrifugation (1 h, 4000 g, 4 (cid:2)C), and extrac- tion was repeated by incubation of the upper phase in phe- nol ⁄ chloroform ⁄ isoamylalcohol and centrifugation. RNA was precipitated by incubating the resulting upper phase with 1 vol of sodium acetate (pH 5.2, 3 m) and 2 vol of ethanol (95%; v ⁄ v) overnight at )20 (cid:2)C. This was followed by 1 h centrifugation at 2800 g. For RNA, precipitates were taken up in 5 mL sodium acetate (pH 5.6, 3 m), followed by a centrifugation step (15 min, 2800 g). Pellets were again dissolved in 500 lL autoclaved H2O, before incubation with an equal volume of phe- nol ⁄ chloroform ⁄ isoamylalcohol and centrifugation (30 min, 16 100 g). Supernatants were trans- ferred to a fresh tube, mixed with 50 lL sodium acetate (pH 5.6, 3 m), and 2 vol of ethanol (95% v ⁄ v), and incu- bated for 1 h at )70 (cid:2)C, followed by centrifugation (4 (cid:2)C, 30 min, 14 000 g). Pellets were dissolved in 500 lL auto- claved H2O and 200 lL LiCl (10 m), incubated for 30 min at 4 (cid:2)C. After centrifugation (4 (cid:2)C, 16 100 g), pellets were washed twice with 70% ethanol, air dried, and taken up in 30 lL autoclaved H2O. Northern blot analysis and hybrid- ization were followed using standard procedures, 20 lg of total RNA, and a full-length GbPDX1 cDNA as probe. 1 Chen LQ, Li CS, Chaloner WG, Beerling DJ, Sun QG,
Collinson ME & Mitchell PL (2001) Assessing the potential for the stomatal characters of extant and fossil Ginkgo leaves to signal atmospheric CO(2) change. Am J Bot 88, 1309–1315.
2 Fiehe K, Arenz A, Drewke C, Hemscheidt T, William- son RT & Leistner E (2000) Biosynthesis of 4¢-O-meth- ylpyridoxine (Ginkgotoxin) from primary precursors. J Nat Prod 63, 185–189.
3 Ka¨ stner U, Hallmen C, Wiese M, Leistner E & Drewke C (2007) The human pyridoxal kinase, a plausible target for ginkgotoxin from Ginkgo biloba. FEBS J 274, 1036– 1045.
A lexA-based yeast 2-hybrid system was used as described previously [50]. GbPDX1 was cloned into pDONR221 (Invi- trogen) and subsequently introduced into yeast 2-hybrid vectors pBTM116-D9 and pACT2. Yeast 2-hybrid assays were performed as described previously [26]. Photographs of single drops from diluted colonies were taken 3 days after transfer. For pull-down assays, GbPDX1 was cloned into pDEST15, expressed in and purified from E. coli, and incubated with in planta expressed myc:AtPDX1.1, :At- PDX1.2, :AtPDX1.3, and :AtPDX2 proteins, respectively. Myc-tagged AtPDX-proteins were under the control of a 35S promoter in the binary vector pGWB18.
Metabolic analysis
4 Mizuno N, Kawakami K & Morita E (1980) Competi- tive inhibition between 4¢-substituted pyridoxine ana- logues and pyridoxal for pyridoxal kinase from mouse brain. J Nutr Sci Vitaminol (Tokyo) 26, 535–543. 5 Drewke C & Leistner E (2001) Biosynthesis of vita-
min B6 and structurally related derivatives. Vitam Horm 61, 121–155. that 6 Gyorgy P (1956) The history of vitamin B6. Am J Clin Nutr 4, 313–317. from Hitachi excitation (L-2485;
E. coli growth complementation assay
Vitamin B6 measurements were carried out as described for detection on HPLC, a previously [26], except Merck–Hitachi machine was used with a fluorescence 330 nm; detector emission 400 nm) and a Purospher RP-18e column (250 · 4 mm ⁄ 5 lm) for analysis. 7 Drewke C, Klein M, Clade D, Arenz A, Muller R & Leistner E (1996) 4-O-phosphoryl-l-threonine, a substrate of the pdxC(serC) gene product involved in vitamin B6 biosynthesis. FEBS Lett 390, 179–182. 8 Drewke C, Notheis C, Hansen U, Leistner E,
FEBS Journal 275 (2008) 960–969 ª 2008 The Authors Journal compilation ª 2008 FEBS
967
Complementation assays were carried out as described pre- viously [26]. In brief, the ORF of GbPDX1 was cloned into the BamHI and SalI restriction sites of E. coli expression Hemscheidt T, Hill RE & Spenser ID (1993) Growth response to 4-hydroxy-l-threonine of Escherichia coli mutants blocked in vitamin B6 biosynthesis. FEBS Lett 318, 125–128.
J. E. Leuendorf et al.
Characterization of Ginkgo PDX1
of the protein–protein interaction in the heteromeric Bacillus subtilis pyridoxalphosphate synthase. Biochem- istry 46, 5131–5139. 22 Zein F, Zhang Y, Kang YN, Burns K, Begley TP &
9 Hill RE & Spenser ID (1996) Biosynthesis of vitamin B6. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology, 2nd edn (Neidhardt FC, Curtiss III R, Ingraham JL, Lin ECC, Low KB, Magasanik B, Reznikoff WS, Riley M, Schaechter M & Umbarger HE, eds), pp. 695–703. American Society of Microbiology, Washington, DC. Ealick SE (2006) Structural insights into the mechanism of the PLP synthase holoenzyme from Thermotoga maritima. Biochemistry 45, 14609–14620. 23 Strohmeier M, Raschle T, Mazurkiewicz J, Rippe K, 10 Laber B, Maurer W, Hanke C, Grafe S, Ehlert S,
Sinning I, Fitzpatrick TB & Tews I (2006) Structure of a bacterial pyridoxal 5¢-phosphate synthase complex. Proc Natl Acad Sci USA 103, 19284–19289. Messerschmidt A & Clausen T (1999) Characterization of recombinant Arabidopsis thaliana threonine synthase. Eur J Biochem 263, 212–221.
24 Belitsky BR (2004) Physical and enzymological interac- tion of Bacillus subtilis proteins required for de novo pyridoxal 5¢-phosphate biosynthesis. J Bacteriol 186, 1191–1196. 11 Burns KE, Xiang Y, Kinsland CL, McLafferty FW & Begley TP (2005) Reconstitution and biochemical char- acterization of a new pyridoxal-5¢-phosphate biosynthet- ic pathway. J Am Chem Soc 127, 3682–3683.
25 Raschle T, Amrhein N & Fitzpatrick TB (2005) On the two components of pyridoxal 5¢-phosphate synthase from Bacillus subtilis. J Biol Chem 280, 32291–32300. 12 Yang Y, Zhao G & Winkler ME (1996) Identification of the pdxK gene that encodes pyridoxine (vitamin B6) kinase in Escherichia coli K-12. FEMS Microbiol Lett 141, 89–95. 26 Wagner S, Bernhardt A, Leuendorf JE, Drewke C,
13 Notheis C, Drewke C & Leistner E (1995) Purification and characterization of the pyridoxol-5¢-phosphate:oxy- gen oxidoreductase (deaminating) from Escherichia coli. Biochim Biophys Acta 1247, 265–271. 14 Mittenhuber G (2001) Phylogenetic analyses and
Lytovchenko A, Mujahed N, Gurgui C, Frommer WB, Leistner E, Fernie AR et al. (2006) Analysis of the Arabidopsis rsr4-1 ⁄ pdx1-3 mutant reveals the critical function of the PDX1 protein family in metabolism, development, and vitamin B6 biosynthesis. Plant Cell 18, 1722–1735. comparative genomics of vitamin B6 (pyridoxine) and pyridoxal phosphate biosynthesis pathways. J Mol Microbiol Biotechnol 3, 1–20. 15 Shi H, Xiong L, Stevenson B, Lu T & Zhu JK (2002)
27 Titiz O, Tambasco-Studart M, Warzych E, Apel K, Amrhein N, Laloi C & Fitzpatrick TB (2006) PDX1 is essential for vitamin B6 biosynthesis, development and stress tolerance in Arabidopsis. Plant J 48, 933– 946. The Arabidopsis salt overly sensitive 4 mutants uncover a critical role for vitamin B6 in plant salt tolerance. Plant Cell 14, 575–588. 28 Tambasco-Studart M, Tews I, Amrhein N & 16 Gonzalez E, Danehower D & Daub ME (2007)
Fitzpatrick TB (2007) Functional analysis of PDX2 from Arabidopsis, a glutaminase involved in vitamin B6 biosynthesis. Plant Physiol 144, 915–925.
Vitamer levels, stress response, enzyme activity, and gene regulation of Arabidopsis lines mutant in the pyridoxine ⁄ pyridoxamine 5¢-phosphate oxidase (PDX3) and the pyridoxal kinase (SOS4) genes involved in the vitamin B6 salvage pathway. Plant Physiol 145, 985–996. 29 Denslow SA, Rueschhoff EE & Daub ME (2007) Regu- lation of the Arabidopsis thaliana vitamin B6 biosynthe- sis genes by abiotic stress. Plant Physiol Biochem 45, 152–161. 17 Tambasco-Studart M, Titiz O, Raschle T, Forster G,
Amrhein N & Fitzpatrick TB (2005) vitamin B6 biosyn- thesis in higher plants. Proc Natl Acad Sci USA 102, 13687–13692. 18 Ehrenshaft M, Bilski P, Li MY, Chignell CF & 30 Denslow SA, Walls AA & Daub ME (2005) Regulation of biosynthetic genes and antioxidant properties of vita- min B6 vitamers during plant defense responses. Physiol Mol Plant P 66, 244–255.
Daub ME (1999) A highly conserved sequence is a novel gene involved in de novo vitamin B6 biosynthesis. Proc Natl Acad Sci USA 96, 9374–9378. 31 Graham CM, Ehrenshaft M, Hausner G & Reid DM (2004) A highly conserved gene for vitamin B biosyn- thesis may have consequences for stress and hormone responses in plants. Physiol Plant 121, 8–14.
19 Ehrenshaft M & Daub ME (2001) Isolation of PDX2, a second novel gene in the pyridoxine biosynthesis path- way of eukaryotes, archaebacteria, and a subset of eubacteria. J Bacteriol 183, 3383–3390.
FEBS Journal 275 (2008) 960–969 ª 2008 The Authors Journal compilation ª 2008 FEBS
968
32 Chen H & Xiong L (2005) Pyridoxine is required for post-embryonic root development and tolerance to osmotic and oxidative stresses. Plant J 44, 396–408. 33 Tanaka T, Tateno Y & Gojobori T (2005) Evolution of vitamin B6 (pyridoxine) metabolism by gain and loss of genes. Mol Biol Evol 22, 243–250. 20 Zeidler J, Gupta RN, Sayer BG & Spenser ID (2003) Biosynthesis of vitamin B(6) in yeast. Incorporation pattern of trioses. J Org Chem 68, 3486–3493. 21 Neuwirth M, Flicker K, Strohmeier M, Tews I & 34 Chenchik A, Zhu Y, Diatchenko L, Li R, Hill J & Siebert P (1998) Generation and use of high-quality cDNA from Macheroux P (2007) Thermodynamic characterization
J. E. Leuendorf et al.
Characterization of Ginkgo PDX1
45 Murashige T & Skoog F (1962) A revised medium for
rapid growth and bioassays with tobacco tissue culture. Physiol Plantarum 15, 473–497. small amounts of total RNA by SMART PCR. In Gene Cloning and Analysis by RT-PCR (Siebert P & Larrick J, eds), pp. 305–319. BioTechniques Books, MA. 35 Arenz A, Klein M, Fiehe K, Gross J, Drewke C, 46 Clough SJ & Bent AF (1998) Floral dip: a simplified
method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16, 735–743. 47 Zenk MH, El-Shagi H & Schulte U (1975) Anthraqui- Hemscheidt T & Leistner E (1996) Occurrence of neuro- toxic 4¢-O-methylpyridoxine in Ginkgo biloba leaves, ginkgo medications and japanese ginkgo food. Planta Med 62, 548–551. 36 Wetzel DK, Ehrenshaft M, Denslow SA & Daub ME none production by cell suspension cultures of Morinda citrifolia. Plant Med 28, 79–101. 48 Blin N & Stafford DW (1976) A general method for
isolation of high molecular weight DNA from eukary- otes. Nucleic Acids Res 3, 2303–2308. 49 Wang T, Zhang N & Du L (2005) Isolation of RNA of (2004) Functional complementation between the PDX1 vitamin B6 biosynthetic gene of Cercospora nicotianae and pdxJ of Escherichia coli. FEBS Lett 564, 143–146. 37 Wada K, Ishigaki S, Ueda K, Sakata M & Haga M high quality and yield from Ginkgo biloba leaves. Biotechnol Lett 27, 629–633.
(1985) An antivitamin B6, 4¢-methoxypyridoxine, from the seed of Ginkgo biloba L. Chem Pharm Bull (Tokyo) 33, 3555–3557.
50 Weber H, Bernhardt A, Dieterle M, Hano P, Mutlu A, Estelle M, Genschik P & Hellmann H (2005) Arabidop- sis AtCUL3a and AtCUL3b form complexes with mem- bers of the BTB ⁄ POZ-MATH protein family. Plant Physiol 137, 83–93. 51 Thompson JD, Higgins DG & Gibson TJ (1994) 38 Maurer K, Ihl R, Dierks T & Frolich L (1997) Clinical efficacy of Ginkgo biloba special extract EGb 761 in dementia of the Alzheimer type. J Psychiatr Res 31, 645–655. 39 Stoll S, Scheuer K, Pohl O & Muller WE (1996) Ginkgo
Supplementary material
is available
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weight- ing, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673–4680. biloba extract (EGb 761) independently improves changes in passive avoidance learning and brain mem- brane fluidity in the aging mouse. Pharmacopsychiatry 29, 144.
in complementation of an
40 Yoshikawa T, Naito Y & Kondo M (1999) Ginkgo biloba leaf extract: review of biological actions and clinical applications. Antioxid Redox Sig 1, 469–480. 41 DeFeudis FV & Drieu K (2000) Ginkgo biloba extract
The following supplementary material online: Fig. S1. GbPDX1 fails E. coli pdxJ19 mutant.
This material is available as part of the online article
from http://www.blackwell-synergy.com
(EGb 761) and CNS functions: basic studies and clinical applications. Curr Drug Targets 1, 25–58. 42 Martin T, Losa JE, Garcia-Salgado MJ & Perez-
Please note: Blackwell Publishing are not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the corre- sponding author.
FEBS Journal 275 (2008) 960–969 ª 2008 The Authors Journal compilation ª 2008 FEBS
969
Arellano JL (1994) The role of platelet-activating factor (PAF) in interstitial pulmonary disease. J Invest Allerg Clin Immunol 4, 149–157. 43 Defeudis FV (2002) Bilobalide and neuroprotection. Pharmacol Res 46, 565–568. 44 Wada K (2005) Ginkgo seed food poisoning. Chudoku Kenkyu 18, 11–16.
