Báo cáo khoa học: Residues near the N-terminus of protein B control autocatalytic proteolysis and the activity of soluble methane mono-oxygenase

doi:10.1046/j.1432-1033.2002.02829.x

Eur. J. Biochem. 269, 1835–1843 (2002) (cid:211) FEBS 2002

Residues near the N-terminus of protein B control autocatalytic proteolysis and the activity of soluble methane mono-oxygenase

Anastasia J. Callaghan*, Thomas J. Smith†, Susan E. Slade and Howard Dalton

Department of Biological Sciences, University of Warwick, Coventry, UK

showed that residue(s) essential for the activity of sMMO, and important in determining the stability of protein B, lay in the region Ser4–Tyr7. Protein B was shown to possess intrinsic nucleophilic activity, which we propose initiates the cleavage reaction via a novel mechanism. Proteins B and B¢ were detected in approximately equal amounts in the cell, showing that truncation of protein B is biologically relevant. Increasing the growth-medium copper concentration, which inactivates sMMO, did not alter the extent of in vivo cleav- age, therefore the conditions under which cleavage of protein B may fulfil its proposed role as a regulator of sMMO remain to be identified.

Keywords: autocatalytic inactivation; methane mono-oxy- genase; methanotroph; N-terminal autoprocessing; regula- tory protein.

Soluble methane mono-oxygenase (sMMO) of Methylo- coccus capsulatus (Bath) catalyses the O2-dependent and NAD(P)H-dependent oxygenation of methane and numer- ous other substrates. During purification, the sMMO enzyme complex, which comprises three components and has a molecular mass in excess of 300 kDa, becomes inac- tivated because of cleavage of just 12 amino acids from the N-terminus of protein B, which is the smallest component of sMMO and the only one without prosthetic groups. Here we have shown that cleavage of protein B, to form the inactive truncated protein B¢, continued to occur when intact protein B was repeatedly separated from protein B¢ and all detect- able contaminants, giving compelling evidence that the protein was cleaved autocatalytically. The rate of autocata- lytic cleavage decreased when the residues flanking the cleavage site were mutated, but the position of cleavage was unaltered. Analysis of a series of incremental truncates

Methane mono-oxygenase (MMO) catalyses the oxidation of methane to methanol and is essential for the growth of methanotrophic bacteria using methane as the growth substrate [1]. Methanotrophic bacteria such as Methylococ- cus capsulatus (Bath) possesses two forms of MMO, the copper-requiring particulate form (pMMO) and the iron- containing soluble form (sMMO), the expression of which is regulated by the concentration of available copper in the medium [2]. sMMO, which catalyses the NAD(P)H-depen- dent and O2-dependent oxygenation of methane and numerous adventitious substrates, is an enzyme complex consisting of three components: a multisubunit hydroxylase, a reductase, and a regulatory component known as protein B [3].

The hydroxylase (250.1 kDa) has an (abc)2 quaternary structure [4] in which each a subunit contains a l-(hydr) oxo-bridged di-iron centre that is the presumed site of substrate oxygenation [5,6]. The reductase (38.5 kDa) contains FAD and Fe2S2 centres and supplies electrons from NADH to the hydroxylase [7]. Protein B (16 kDa), which is devoid of prosthetic groups and metal cofactors, is essential for natural, O2-dependent substrate oxygenation by the sMMO complex [3]. Owing to its diverse effects on the catalytic properties of sMMO, protein B is potentially a powerful regulator of sMMO activity. Protein B has been shown to (a) couple electron transfer to substrate oxygen- ation thus converting sMMO from an oxidase into an oxygenase [8]; (b) reduce the redox potentials of the di-iron site [9,10] and hence increase the reactivity of the diferrous di-iron site to oxygen; (c) accelerate formation of the high- valent intermediate Q, which appears to be responsible for oxygenation of methane [11–13]; (d) alter product distri- bution with complex substrates [14,15]; and (e) inhibit oxygenation reactions when the hydroxylase is artificially activated by hydrogen peroxide via the peroxide shunt reaction [14].

Protein B binds to the hydroxylase [16] but not directly to the reductase [17]. There are currently no high-resolution structural data for the complex formed between protein B and the hydroxylase; however, a cross-linking study using the homologous sMMO of Methylosinus trichosporium OB3b showed that protein B bound to the a subunit [18]. A variety of spectroscopic techniques have demonstrated that protein B perturbs the environment of the di-iron site, presumably by altering the conformation of the hydroxylase [19–21]. Consistent with this, small-angle X-ray scattering

Correspondence to H. Dalton, Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, UK. Fax: + 44 24 7652 3568, Tel.: + 44 24 7652 3552, E-mail: hdalton@bio.warwick.ac.uk Abbreviations: ESI, electrospray ionization; GST, glutathione S-transferase; SAXS, small angle X-ray scattering; s/pMMO, soluble/ particulate methane mono-oxygenase. Enzyme: methane monooxygenase (EC 1.14.13.25). *Present address: Department of Biochemistry, University of Cambridge, Old Addenbrookes Site, Cambridge , UK. (cid:160)Present address: Biomedical Research Centre, She(cid:129)eld Hallam University, Howard Street, She(cid:129)eld, UK. Note: a web page is available at http://www.bio.warwick.ac.uk/dalton/ (Received 8 November 2001, revised 6 February 2002, accepted 8 February 2002)

1836 A. J. Callaghan et al. (Eur. J. Biochem. 269)

(cid:211) FEBS 2002

M A T E R I A L S A N D M E T H O D S

Bacterial growth

(SAXS) has given direct, though low-resolution, structural evidence for a large conformational change in the hydrox- ylase that protein B and the reductase together induce [22]. Thus, current evidence suggests that protein B influences sMMO activity through the conformational change that it causes in the hydroxylase, although a direct role in transferring electrons from the reductase to the hydroxylase is also possible.

sMMO-expressing Mc. capsulatus (Bath) cells were grown in nitrate minimal salts medium using methane as the growth substrate, as described previously [7]. The switch from sMMO to pMMO expression was effected in fermen- tor cultures by increasing the CuSO4.5H2O concentration of the medium from 0.1 to 1.0 mgÆL)1. E. coli strains were grown at 37 (cid:176)C in Luria–Bertani broth [28], with ampicillin (100 lgÆmL)1) added for selection of plasmids as required.

Purification of the sMMO components from Mc.capsulatus

the four iron-co-ordinating a helices that

The NMR structure of protein B from Mc. capsulatus (Bath) [23] shows that it has a folded central, two- domain core region, while the N-terminal region until Val31 and the C-terminus (Met130–Ala140) are mobile and largely unstructured. NMR measurements in the presence of the hydroyxlase showed exchange broadening of specific nuclear Overhauser effect cross-peaks that grouped around the so-called (cid:212)northern(cid:213) domain of the core of protein B [23]. These results were interpreted as showing that hydroxylase-bound and unbound protein B were in dynamic equilibrium and that the hydrophobic (cid:212)northern(cid:213) half of the core of protein B interacted with the hydroxylase. Docking studies showed that protein B could bind in the hydrophobic cleft formed by two of lie in a canyon formed between the ab pairs of the hydroxylase [6,23–25].

The hydroxylase, reductase and protein B components of sMMO were purified from Mc. capsulatus (Bath) as described previously [22,29]. As protein B underwent truncation during purification, protein prepared by this method contained a mixture of proteins B and B¢. The relative abundance of proteins B and B¢ was assessed by using SDS/PAGE and electrospray ionization (ESI)-MS. Incubation of the purified protein B/B¢ mix at 20 (cid:176)C for 1–2 days enabled complete conversion of protein B to B¢.

Protein B from Mc. capsulatus (Bath)

Separation of proteins B and B¢ by chromatofocusing chromatography

Chromatofocusing chromatography was achieved using a Mono P FPLC column (HR 5/20) (Amersham Pharmacia). The column was equilibrated with buffer A (25 mM methylpiperizine, pH 5.64 or 5.7) before loading of the protein in the same buffer. Elution using buffer B [1 : 10 dilution of PolyBuffer 74TM (Amersham Pharmacia)] at either pH 3.5 or 4, with a flow rate of 0.3–1.0 mLÆmin)1 over 15 col. vol., separated proteins B and B¢ according to the difference in their isoelectric pH.

Genetic manipulations

is unusually sensitive to inactivation because of truncation reactions. During and after purification, protein B degrades by cleavage, principally between Met12 and Gly13, to give protein B¢, which is completely inactive in the sMMO whole-complex reaction [16,26]. Cleavage is also observed between Gln29 and Val30, giving protein B¢¢, which is also inactive [16]. Mutagenesis studies have shown that the residues around the cleavage site influence the rate of inactivation. Mutation of the Met12–Gly13 cleavage site in protein B of the Mc. capsulatus (Bath) site to Met12–Gln13, equivalent to the site found in Ms. trichosporium OB3b protein B (in which truncation had not been reported), enhanced the stability of the protein [16]. The triple mutant G10A/G13Q/G16A was also resistant to truncation but had diminished activity [27]. Protease inhibitors did not prevent cleavage of protein B, and recombinant protein B expressed in a protease-deficient strain of Escherichia coli was cleaved to protein B¢ [16] despite the absence of Mc. capsulatus- specific proteases and the major intracellular proteases of E. coli.

The construct for expression of the M12A/G13Q double mutant of protein B was made by amplification of mmoB (which encodes protein B) from pGEX-WTB [16] by PCR with primers mmoB-M12A/G13Q-1 (5¢-CGCGGATCC ACGATGAGCGTAAACAGCAACGCATACGACGCC GGCATCGCGCAGCTGAAAGGCAAG-3¢; M12A and G13Q mutations shown in bold, start codon in italics and BamHI site underlined) and primer mmoB-2 (5¢-GGCGAA TTCTAAGCGTGATAGTCTTCGAG-3¢; EcoRI site underlined) and cloning into the glutathione S-transferase (GST)-fusion expression vector pGEX-2T (Amersham- Pharmacia) using BamHI and EcoRI.

It is remarkable that the sMMO complex, the compo- nents of which total (cid:25) 300 kDa, is exquisitely sensitive to inactivation by removal of just 12 amino acids from the unstructured terminus of its smallest component. The fact that those 12 amino acids are lost spontaneously under a range of conditions raises important questions about the mechanism of cleavage and suggests that cleavage may occur in vivo. If it is an in vivo phenomenon, truncation of protein B offers a possible mechanism to control the amount of active protein B within the cell and thus regulate the rates of methane oxidation and NADH consumption by sMMO, e.g. in response to intracellular or extracellular conditions. To address these questions, we conducted a detailed characterization of the mechanism of cleavage, the roles of specific amino acids near to the N-terminus in catalytic activity, and the significance of the cleavage reaction in vivo.

The plasmids for expression of the C-terminally 6-His- tagged G13Q mutant of protein B and N-terminal trunca- tions thereof were constructed by PCR amplification of the appropriate section of mmoB using pGEX-mtB [16] as the template and cloning into pET3a (Novagen) using NdeI and BamHI. The truncated constructs and the proteins they encoded were numbered according to the first amino acid after the start codon. The forward PCR primers for the various constructs were as follows: G13Q-tag (full-length construct), 5¢-GGGAATTCCATATGAGCGTAAACAG

Regulation of sMMO activity (Eur. J. Biochem. 269) 1837

(cid:211) FEBS 2002

reductase and protein B) were performed by the method of Pilkington & Dalton [29]. The effect of protein B derivatives on the propylene oxidation activity of the hydroxylase via the peroxide shunt reaction was measured in the presence of 24 lM hydroxylase and 100 mM hydrogen peroxide as published [14], except that the epoxypropane product was quantified by GC of 0.5-mL gas-phase samples.

Circular dichroism

Protein samples in 25 mM sodium phosphate buffer were scanned 10 times in a Jasco J715 spectropolarimeter in a 1-mm path-length quartz cuvette between 190 nm and 250 nm (for far-UV CD analysis) or in a 1-cm path-length quartz cuvette between 260 nm and 300 nm (for near-UV CD). In all cases the response time was 0.25 s and the scan speed was 100 nmÆmin)1. Scans were blanked against fresh buffer recorded under the same conditions.

CAACGCATAC-3¢; truncate 4, 5¢-GGGAATTCCATAT GAGCAACGCATACGACGCCGGCATC-3¢; truncate 5, 5¢-GGGAATCCATATGAACGCATACGACGCCGGCA TCATGCAGCTGAAA-3¢; truncate 6, 5¢-GGGAATTCC ATATGGCATACGACGCCGGCATCATGCAGCTGAA A-3¢; truncate 7, 5¢-GGGAATTCCATATGTACGACGC CGGCATCATGCAGCTGAAA-3¢; truncate 8, 5¢-GGGA ATTCCATATGGACGCCGGCATCATGCAGCTGAA A-3¢; truncate 9, 5¢-GGGAATTCCATATGGCCGGCAT CATGCAGCTGAAAGGCAAG-3¢; truncate 10, 5¢-GGG AATTCCATATGGGCATCATGCAGCTGAAAGGCA AG-3¢; truncate 13, 5¢-GGGAATTCCATATGCAGCTG AAAGGCAAGGACTTC-3¢ (NdeI sites underlined and start codons italicized). The PCR reverse primer was the same in each case (5¢-TGTATAGGATCCTCAGTGATGG TGATGGTGATGAGCGTGATAGTCTTCGAG-3¢; His6 tag shown in bold, stop codon italicized, and BamHI restriction site underlined). The absence of unwanted mutations from all cloned PCR products was confirmed by DNA sequencing.

Fluorescence

Purification of recombinant protein B derivatives

Protein samples in 25 mM sodium phosphate buffer, pH 7, were placed in a 3-mL quartz cuvette with a 10-mm path length. Fluorescence measurements were made using a PerkinElmer LS-50 fluorimeter at room temperature with a scan speed of 500 nmÆmin)1 and an excitation wavelength of 280 nm, and scanned over the range 300–450 nm. An accumulation of eight scans was taken for each sample, and scans were blanked against buffer data collected under the same conditions.

The GST-tagged wild-type, G13Q and M12A/G13Q deriv- atives of protein B were purified from strains of E. coli AD 202 containing the appropriate plasmids by affinity chromatography [16]. The GST affinity tag was removed by the addition of thrombin [2 ng thrombinÆ(lg fusion protein))1] for 5–10 min at room temperature, after which the recombinant protein B derivative was separated by gel filtration with a Superdex 75 FPLC column (2.6 cm · 61 cm; Amersham Pharmacia), eluted with 25 mM Mops buffer, pH 7.

Other methods

Plasmids for expression of the His6-tagged protein B derivatives were transformed into E. coli BL21(DE3) (Novagen). Cells were grown, induced with isopropyl thio- b-D-galactopyranoside, and soluble extracts were prepared as described previously [16], except that the cells were broken in 20 mM sodium phosphate buffer, pH 7.4–7.6, containing 0.5 M NaCl and 10 mM imidazole. Purification of the His6-tagged protein B derivative was accomplished using the HisTrapTM kit (Amersham Pharmacia) according to the manufacturer’s instructions. The purified fusion protein was then exchanged into 25 mM Mops buffer, pH 7, by gel filtration as described above.

Determination of protein concentration

Protein B-associated nucleophile activity was measured at 20 (cid:176)C by the protein B-dependent conversion of p-nitro- phenylacetate to p-nitrophenol, monitored spectrophoto- metrically at 400 nm [34]. SDS/PAGE [35] was performed using 12% (w/v) polyacrylamide gels. SDS cell extracts of Mc. capsulatus cells were prepared from cells harvested by centrifugation (14 000 g, 5 min, room temperature), which were immediately resuspended in SDS/PAGE loading buffer [65 mM Tris/HCl (pH 8.8), 1 mM EDTA, 1% (w/v) SDS, 5% (v/v) 2-mercaptoethanol, 0.0025% (w/v) brom- ophenol blue, 10% (v/v) glycerol] and boiled (100 (cid:176)C, 5 min) before centrifugation (10 000 g, 10 min) to remove particulate material. Preparation of anti-(protein B) serum, Western blotting, and ESI-MS were as described previously [16].

R E S U L T S

Cleavage of protein B did not require detectable extrinsic proteases

Concentrations of protein B and protein B¢ samples at were determined spectrophotometrically 280 nm )1Æcm)1 and using the absorption coefficients 16 839 M )1Æcm)1, respectively, which were determined 16 032 M experimentally by established methods [30,31]. Concentra- tions of the hydroxylase and reductase were determined by the method of Bradford [32] using BSA as the protein standard and commercially available reagent (Bio-Rad).

Enzyme assays

To determine whether the proteolytic activity responsible for cleavage was intrinsic or extrinsic to protein B, proteins B and B¢ were separated from one another by chomatofo- cusing chromatography on a Mono P column. The protein B used for this separation was a highly purified sample [prepared from Mc. capsulatus (Bath), with a specific activity of 3500 nmolÆmin)1Æmg)1] that had undergone partial cleavage. SDS/PAGE analysis of this sample showed

The semiquantitative naphthalene oxidation test to detect sMMO activity in liquid culture samples was performed as previously described [33]. Quantitative propylene oxidation assays using the whole sMMO complex (hydroxylase,

1838 A. J. Callaghan et al. (Eur. J. Biochem. 269)

(cid:211) FEBS 2002

that it contained proteins B, B¢ and B¢¢ in the proportions 10 : 6 : 1, and MS analysis confirmed the presence of proteins with masses of 15 852, 14 629 and 12 718 Da, which corresponded to the calculated masses of proteins B, B¢ and B¢¢. On chromatofocusing the sample could be readily resolved into proteins B, B¢ and B¢¢. Immediate SDS/ PAGE analysis of the protein B fraction at this stage showed it to be pure by Coomassie Blue staining, and it was active (6380 nmolÆmin)1Æmg)1) by the propene oxidation assay. In contrast, no activity could be detected from the fraction eluted as protein B¢. The active protein B was then subjected to further rounds of chromatofocusing, and on each occasion the protein was resolved into B and B¢. During these operations, the highly purified protein B was observed to degrade by 50% to B¢ over a 3-h period at 20 (cid:176)C. This spontaneous truncation of highly purified samples of protein B upon repeated repurification, despite the absence of detectable contaminating proteins, strongly suggested that truncation was autocatalytic.

Effect of the structure of the cleavage site on protein B activity and the cleavage reaction

B, the inhibitory effect of protein B¢ during the peroxide shunt was markedly lower than that of protein B (Fig. 1). However, the intact G13Q and M12A/G13Q mutant forms of protein B, both of which had wild-type activity in the whole-complex reaction, were significantly poorer inhibitors of the peroxide shunt reaction than wild-type protein B (Fig. 1). Thus the inhibitory effect of protein B was more sensitive to structural changes near to the N-terminus than its better-documented stimulatory effect.

We were interested to investigate the roles of the residues near to the cleavage site in the rate and position of cleavage because it seemed likely that the side chains near to the cleavage site were important in the autocatalytic cleavage process. We had already shown that the G13Q mutation, which changed the amino acid immediately C-terminal to the cleavage site, reduced the rate of truncation of protein B [16], but the precise position of cleavage in this mutant had not been determined. After a preparation of the G13Q mutant protein had been incubated at 20 (cid:176)C for 48 h, ESI- MS analysis revealed the presence of two major molecular ions, of 16 300 Da (corresponding to the mass of the intact G13Q mutant) and 14 700 Da (corresponding to the mass of a truncate beginning at Gln13). This illustrated that replacement of the small Gly13 with the bulkier, hydrophilic Gln did not affect the principal site of cleavage of protein B, which remained immediately N-terminal to residue 13.

To investigate the role of

this position,

As previous SAXS studies had indicated that protein B elongated on truncation [22], we studied the effect of truncation on the overall conformation of protein B so as to assess whether the inactivity of protein B¢ is associated with a conformational change. However, far-UV CD spectra of proteins B and B¢ were identical (data not shown), showing that truncation caused no detectable change in the second- ary-structure content of the protein. Likewise, near-UV CD and fluorescence spectra were scarcely different for proteins B and B¢, showing little difference in the environments of aromatic side chains between the full-length and truncated proteins (data not shown). These data, taken together with the SAXS study, are consistent with a relatively minor change in conformation on truncation of free protein B. Similar structural studies were performed with the two mutant forms of protein B and their respective truncates, and the results were indistinguishable from those obtained with the wild-type protein B/B¢ system (data not shown).

the residue immediately N-terminal to the cleavage site and to see whether the G13Q mutant could be further stabilized by removal of side- the M12A/G13Q chain functionality at mutant was constructed. The activity of this double mutant was indistinguishable from that of the wild-type (data not shown), and ESI-MS analysis of the freshly prepared mutant protein confirmed the predicted molecular mass of 16 240 Da. Analysis of a sample that had been incubated at 20 (cid:176)C for 48 h showed that the major new molecular ion had a mass of 14 701 Da, which corresponded to the mass of the truncate produced by cleavage between amino acids 12 and 13. Thus, despite radically changing the amino acids on both sides of the cleavage site, the position of cleavage was unchanged and the protein remained active.

Incremental truncation of protein B

To investigate more thoroughly the role of the N-terminal region in the truncation reaction and in the activity of protein B, a series of N-terminal truncates was constructed genetically. These all contained the stability-enhancing G13Q mutation to minimize loss of additional amino acids by spontaneous cleavage and had a C-terminal 6-His tag to

A surprising difference between the wild-type and mutant forms of protein B was observed during the peroxide shunt reaction. The peroxide shunt, which allows the hydroxylase to be activated by hydrogen peroxide to perform oxygen- ation reactions in the absence of the reductase and NADH, is inhibited by intact wild-type protein B [14]. Just as the stimulatory effect of protein B¢ in the whole-complex sMMO reaction was much lower than that of intact protein

Fig. 1. Inhibition of the peroxide shunt reaction by protein B and its derivatives. Oxygenation of propylene was measured in the presence of the hydroxylase and hydrogen peroxide as described in Materials and methods at various concentrations of intact wild-type protein B (solid line), intact G13Q (broken line) or M12A/G13Q (dashed line) mutant protein B or protein B¢ derived from wild-type protein B (dotted line). Enzyme activity is shown as a percentage of the activity [9.2 nmolÆmin)1Æ(mg of hydroxylase))1] with no added protein B. The activities presented are the mean of three or four separate experiments. Standard error bars are shown.

Regulation of sMMO activity (Eur. J. Biochem. 269) 1839

(cid:211) FEBS 2002

stable, having completely degraded to truncates within 24 h, whereas the shorter truncates 5, 6 and 7 were still observed in uncleaved form after 6 days. Further truncation beyond this, to truncates 8 and 9, which abolished activity, also enhanced the cleavage reaction, which was complete within 24 h. General destabilization or reorganization of the secondary structure of the truncated forms was unlikely to be the cause of their destabilization of the truncates because the far-UV CD spectra for truncates 7 (stable) and 8 (rapidly cleaving) were indistinguishable and very similar to that of native, intact protein B (data not shown). Truncates 10 and 13, both of which retained the scissile Met12–Gln13 peptide bond (Fig. 2), were as stable for at least 6 days, showing that at least four of the amino acids N-terminal to the cleavage site are required for rapid autocatalytic cleavage.

Mechanism of autocatalytic cleavage

The probable autocatalytic mechanism of cleavage of protein B posed the question of which intrinsic groups on protein B were responsible for the reaction. Recent research has identified autoprocessing reactions in other systems, such as aminohydrolase and aspartate decarboxylase, which rely on the formation and resolution of internal (thio) esters [36,37]. In these examples, a nucleophilic amino acid (cysteine, serine or threonine) rearranges within the protein, thus replacing the amide peptide bond between itself and the preceding amino acid with a more reactive thioester or ester linkage. Such bonds then hydrolyse spontaneously and thus effect cleavage [38–40].

permit affinity purification while allowing free manipulation of the N-terminus. ESI-MS of the full-length and truncated proteins confirmed their integrity and showed whether the initial methionine residue was preserved (Fig. 2). The C-terminal His6 tag had no effect on activity because the activity of the full-length fusion (G13Q–His6) was approx- imately the same as that observed for the original G13Q mutant with no C-terminal tag. Full activity was retained on truncation as far as Asn5 (truncate 5), but truncation beyond this led to progressive loss of activity until truncate Asp8 (truncate 8), when activity was lost completely (Fig. 3).

The cleavage of the truncates was analysed to investigate the role of the N-terminal region in the cleavage process. ESI-MS analysis was performed at 24-h intervals during incubation at 20 (cid:176)C over 6 days. The full-length construct G13Q-tag was detectable for 3 days. Truncate 4 was less

In wild-type protein B, the amino acid on the C-terminal side of the cleavage site is glycine and so nucleophilic attack from this site is impossible. Nevertheless, it was possible that cleavage of protein B occured via a similar chemical mechanism, initiated by attack from a nucleophile elsewhere in the protein. This would transfer the N-terminal region of the protein on to a (thio)ester linkage on the nucleophile, which would then spontaneously hydrolyse to yield the truncated protein (Fig. 4).

To investigate the feasibility of such a mechanism, the protein was tested for the presence of accessible nucleo- phile(s) by reaction with p-nitrophenylacetate, which reacts with nucleophilic groups to form p-nitrophenol [34]. The results (Fig. 5) indicated that a nucleophilic group was indeed present, because an increased reaction rate of p-nitrophenol formation was observed in the presence of increasing concentrations of protein B. Control reactions (Fig. 5) confirmed that the rate of p-nitrophenol production was significantly higher than the background rate that was observed in the absence of protein or when denatured (boiled) protein B or the hydroxylase were used.

Detection of protein B¢ invivo

Fig. 2. Deduced N-terminal sequences of the incremental truncates of protein B, each of which was constructed in the G13Q background and had the C-terminal 6-His tag. The presence of the initial methionine residues (shown in bold) was determined experimentally by ESI-MS. The site of cleavage for formation of protein B¢ is indicated.

To investigate the in vivo significance of truncation of protein B, sMMO-expressing Mc. capsulatus (Bath) whole cells were analysed for the presence of proteins B and B¢. Mc. capsulatus (Bath) was cultivated under low-copper, oxygen-limiting conditions as described in Materials and methods. A positive naphthalene oxidation test confirmed the expression of sMMO because pMMO is inactive with this substrate [33]. The cells were rapidly harvested and

Fig. 3. Effect of incremental truncation on the activity of protein B. Activity was measured as the rate of propene oxygenation in the presence of excess hydroxylase and reductase and is shown as a per- centage of the activity [1956 nmolÆmin)1Æ(mg protein B) )1] observed with the G13Q mutant prepared using the GST-tag system (G13Q). The activities presented are the mean of three or four separate exper- iments. Standard error bars are shown.

1840 A. J. Callaghan et al. (Eur. J. Biochem. 269)

(cid:211) FEBS 2002

immediately boiled in SDS-containing sample-loading buf- fer, thus capturing the cellular proteins with minimal opportunity for degradation before exposure to the dena- turant. SDS/PAGE and Western-blotting analysis, using

anti-(protein B) sera (that cross-reacted with protein B¢), clearly showed that protein B¢ was present in vivo in sMMO-expressing cells of Mc. capsulatus (Bath) (Fig. 6). Control samples from pMMO-expressing cells (grown

Fig. 4. Proposed mechanism for autocatalytic cleavage of protein B. A nucleophilic side chain, probably on the surface of the folded core region of protein B, is proposed to attack the carbonyl group of the scissile peptide bond. Cleavage then follows via cyclic zwitte- rion and ester intermediates as indicated.

Fig. 6. Detection of protein B in vivo. Western blot probed with anti- (protein B) sera showing SDS cell extracts of Mc. capsulatus (Bath) from fermentor cultures expressing (lane 1) sMMO and (lane 2) pMMO (negative control containing no protein B or B¢). Molecular masses of standards are indicated in kDa. Fig. 5. Nucleophilic activity of protein B. Formation of p-nitrophenol from p-nitrophenyl acetate was monitored spectrophotometrically as described in Materials and Methods. The reaction mixtures contained protein B at 1 mgÆmL)1 (dotted line), protein B at 0.5 mgÆmL)1 (broken line), boiled protein B at 1 mgÆmL)1 (dashed line), hydroxy- lase at 1 mgÆmL)1 (broken/dotted line) and no protein (solid line).

Regulation of sMMO activity (Eur. J. Biochem. 269) 1841

(cid:211) FEBS 2002

the presence of

under high-copper conditions), which did not exhibit sMMO activity, confirmed that the proteins that reacted with the antisera corresponded to proteins B and B¢.

prevented the N-terminal region from approaching the nucleophilic group (e.g. by the nucleophile being occluded by binding to the hydroxylase) the hydroxylase may also serve to stabilize protein B.

Role of the N-terminus in catalysis

These results strongly suggested that protein B degraded to B¢ in vivo and were consistent with the hypothesis that the cleavage reaction may serve to control the in vivo activity of sMMO. One possibility was that conversion of protein B to B¢ may account, at least in part, for the observed inactiva- tion of sMMO when the growth-medium copper concen- tration was increased, which also causes cessation of sMMO expression and induces the copper-dependent pMMO, via the so-called copper switch [2,41]. Experiments were there- fore conducted to determine whether addition of copper to a Mc. capsulatus (Bath) culture altered the cellular levels of proteins B and B¢ during the switch from sMMO to pMMO expression. The abundances of proteins B and B¢ remained constant throughout the time course, even until the cells began to express pMMO, and so formation of protein B¢ did not appear to control the activity of sMMO during the copper switch.

D I S C U S S I O N

By constructing a series of incremental truncates, we have shown that the amino acids from the N-terminus to Ser4 are not required for catalysis. As truncation beyond Ser4 led to progressive loss of activity until the truncate that began with Asp8 (truncate 8), which was inactive, the critically impor- tant N-terminal region appears to correspond to Ser4-Asn5- Ala6-Tyr7. We presume therefore that the presence of these residues is essential for protein B to induce the conforma- tional change in the hydroxylase whereby it exerts its effect on catalysis. It is also possible that one or more of these residues is directly involved in the pathway for electron transfer between the reductase and the hydroxylase. Precise assignment of the essential N-terminal residues is problem- atic because not all the truncates retained the initiating methionine. For instance, it is difficult to assess the role of Tyr7 because truncate 7 had the initial methionine but truncate 8 did not.

Mechanism of truncation

Previous observations that protein B underwent cleavage during purification regardless of whether it had been expressed in Mc. capsulatus or E. coli, even when the protein had been purified to apparent homogeneity [16], had shown that either truncation was autocatalytic or the peptide bond between amino acids 12 and 13 was unusually susceptible to digestion by very small amounts of extrinsic proteases. Here, by demonstrating that repeatedly repurified protein B continued to undergo cleavage, we have provided strong evidence that the cleavage reaction is independent of the presence of contaminating proteins and so is almost certainly autocatalytic.

The insensitivity of the position of cleavage to the amino- acid sequence around the cleavage site implies the involve- ment of other parts of the structure in determining the sensitivity of the scissile peptide bond to cleavage. Intrinsic nucleophilic activity within protein B is consistent with a cleavage mechanism that proceeds via an intramolecular rearrangement beginning with attack on the scissile peptide bond by a nucleophilic amino-acid side chain elsewhere in the protein (Fig. 4). Thus we are able to propose the first credible mechanism for autocatalytic cleavage of protein B. This could explain both the occurrence of cleavage and its position, determined by distance constraints when the flexible N-terminal region approaches the nucleophile, which we suspect resides on the core of the protein. The core of protein B [23] has 12 exposed potential nucleophiles (serines 34, 44, 92, 109, 110, 126; threonines 36, 49, 57, 68, 111, 117, 123, 125; cysteine 88), all of which are exposed to the solvent, and so the precise residue(s) involved cannot currently be assigned. The residues flanking the cleavage site do affect the rate of cleavage, perhaps by altering the steric accessibility of the scissile peptide linkage to the nucleophile. It was also interesting to note that, as the protein was progressively shortened from the N-terminus, a marked decrease in stability was observed concomitant with loss of activity, but stability was restored after removal of a further two amino acids. If binding of protein B to the hydroxylase

NMR analysis of protein B from Mc. capsulatus (Bath) in the presence of the hydroxylase indicated that the structured core region of protein B interacted with the hydroxylase but gave no indication of the involvement of the N-terminus [23]. This was difficult to reconcile with the observed critical importance of the N-terminal region in the functional [26] and physical [16] interaction of protein B with the hydroxylase. One possibility was that the structure of the core region was different in proteins B and B¢. The available structural data, however, lend little weight to this theory. SAXS data suggested elongation of the overall structure of protein B on truncation [22], but CD and fluorescence spectroscopy showed that any change in conformation on truncation must be extremely slight. Recent NMR results with the sMMO system from Ms. trichosporium OB3b [42], however, have shown that the N-terminal region of protein B does indeed interact with the hydroxylase. In the presence of the hydroxylase, NMR signals due to His4 (equivalent to Ser4 in the Mc. capsulatus system) and Tyr7 (which is conserved in both Ms. trichos- porium and Mc. capsulatus) broadened, indicating interac- tion with the hydroxylase. These assignments are consistent with our incremental truncation studies, which showed that the functionally important residues lay in the region Ser4– Tyr7. Signals due to His32, which is toward the inner end of the flexible N-terminal region, were also perturbed by the presence of the hydroxylase, again indicative of binding [42], although analysis of the function of this residue is not accessible via the incremental truncation method used here. The NMR study indicated that the isolated 29 N-terminal residues of protein B bound to the hydroxylase in a manner that was competitive with the full-length protein B [42]. Conversely, an artificially synthesized dodecapeptide corresponding to amino acids 1–12 of protein B (SVNSNAYDAGIM, which was purified to homogeneity and confirmed by ESI-MS to have a molecular mass of 1241.3 Da), did not restore function to protein B¢ [43]. Thus it is possible that the N-terminus and core of protein B can bind independently to the hydroxylase, but the covalent

1842 A. J. Callaghan et al. (Eur. J. Biochem. 269)

(cid:211) FEBS 2002

by other factors, such as starvation and other metabolic stresses, is effected in vivo via truncation of protein B.

connection between them is needed to induce the required conformational change in the hydroxylase.

A C K N O W L E D G E M E N T

This work was funded through a Biotechnology and Biological Sciences Research Council (BBSRC) Studentship to A. J. C.

R E F E R E N C E S

It is also intriguing that the capacity of protein B to activate the hydroxylase during the whole-complex sMMO reaction was not affected by changes to the amino acids flanking the site of cleavage for protein B¢ formation, but the inhibitory effect of intact protein B in the peroxide shunt reaction was diminished by such mutations. This suggests a fundamental difference in the nature of the interactions required for the stimulatory and inhibitory effects of protein B. Either the two types of effect result from binding at different sites on the hydroxylase, or the conformational change that the mutant forms elicit in the hydroxylase is different from that elicited by the wild-type such that the inhibitory effect alone is diminished.

Biological significance of truncation

1. Hanson, R.S. & Hanson, T.E. (1996) Methanotrophic bacteria. Microbiol. Rev. 60, 439–471.

2. Stanley, S.H., Prior, S.D., Leak, D.J. & Dalton, H. (1983) Copper stress underlies the fundamental change in intracellular location of methane monooxygenase in methane-oxidizing organisms: studies in batch and continuous cultures. Biotechnol. Lett. 5, 487–492. 3. Green, J. & Dalton, H. (1985) Protein B of soluble methane monooxygenase from Methylococcus capsulatus (Bath): a novel regulatory protein of enzyme activity. J. Biol. Chem. 260, 15795– 15801.

4. Dalton, H., Smith, D.D.S. & Pilkington, S.J. (1990) Towards a unified mechanism of biological methane oxidation. FEMS Microbiol. Rev. 87, 201–208.

5. Woodland, M.P., Patil, D.S., Cammack, R. & Dalton, H. (1986) Electron-spin-resonance studies of protein A of the soluble methane monooxygenase from Methylococcus capsulatus (Bath). Biochim. Biophys. Acta 873, 237–242.

All known sMMOs require a protein B component for full activity, and other homologous binuclear iron active-centre mono-oxygenases also have an essential regulatory protein that is, like protein B of sMMO, a small protein without prosthetic groups [44]. The susceptibility of protein B and other regulatory proteins (such as the regulatory protein of alkene monooxygenase from Rhodococcus rhodochrous B-276 (S. C. Gallagher & H. Dalton, unpublished observa- tions) to inactivation by proteolytic degradation offers a mechanism by which their activity, and hence the activity of the whole enzyme complex, could be controlled. It also offers an explanation for the persistence of the regulatory components during evolution.

6. Rosenzweig, A.C., Frederick, C.A., Lippard, S.J. & Nordlund, P. (1993) Crystal structure of a bacterial nonheme iron hydroxylase that catalyzes the biological oxidation of methane. Nature 366, 537–543.

7. Colby, J. & Dalton, H. (1978) Resolution of the methane mono- oxygenase of Methylococcus capsulatus (Bath) into three compo- nents. Biochem. J. 171, 461–468.

levels with minimal

8. Lund, J., Woodland, M.P. & Dalton, H. (1985) Electron-transfer reactions in the soluble methane monooxygenase of Methylo- coccus capsulatus (Bath). Eur. J. Biochem. 147, 297–305.

9. Liu, K.E. & Lippard, S.J. (1991) Redox properties of the hydro- xylase component of methane monooxygenase from Methylo- coccus capsulatus (Bath): effects of protein B, reductase, and substrate. J. Biol. Chem. 266, 12836–12839.

10. Kazlauskaite, H., Hill, H.A.O., Wilkins, P.C. & Dalton, H. (1996) Direct electrochemistry of the hydroxylase of soluble methane monooxygenase from Methylococcus capsulatus (Bath). Eur. J. Biochem. 241, 552–556.

In the case of sMMO, autocatalytic cleavage may ensure that the half-life of active protein B is short, and so the activity of protein B could be controlled at the transcrip- lag time. tional or translational Alternatively, other factors in the cell may control the rate of autoproteolysis of protein B, in response to environ- mental factors or the metabolic state of the cell. It is interesting to note that the protein B of Ms. trichosporium OB3b is much less susceptible to cleavage than that of Mc. capsulatus (Bath) and that the truncated form of the Ms. trichosporium protein is not observed in vivo during growth using sMMO (A. J. Callaghan, S. E. Slade & H. Dalton, unpublished observations). Also, although protein B from Methylocystis sp. strain M does undergo N-terminal truncation, this is prevented by protease inhibitors [45]. Thus, it may be that the importance of truncation of protein B in determining sMMO activity differs among the sMMO- expressing methanotrophs.

11. Liu, Y., Nesheim, J.C., Lee, S.-K. & Lipscomb, J.D. (1995) Gating effects of component B on oxygen activation by the methane monooxygenase hydroxylase component. J. Biol. Chem. 270, 24662–24665.

12. Liu, K.E., Valentine, A.M., Wang, D.L., Huynh, B.H., Edmondson, D.E., Salifoglou, A. & Lippard, S.J. (1995) Kinetic and spectroscopic characterization of intermediates and compo- nent interactions in reactions of methane monooxygenase from Methylococcus capsulatus (Bath). J. Am. Chem. Soc. 117, 10174– 10185.

13. Valentine, A.M., Stahl, S.S. & Lippard, S.J. (1999) Mechanistic studies of the reaction of reduced methane monooxygenase hydroxylase with dioxygen and substrates. J. Am. Chem. Soc. 121, 3876–3887.

As proteins B and B¢ were observed in vivo at comparable levels during steady-state growth of Mc. capsulatus (Bath), truncation of protein B is evidently a significant factor in determining the amount of active protein B in the cell. It was suspected that truncation of protein B played a role in the observed rapid inactivation of sMMO when the copper concentration of the medium was increased, in advance of the induction of the copper-dependent pMMO via the copper switch. However, the abundance of proteins B and B¢ was unchanged even after detectable sMMO activity had been lost and pMMO induced (data not shown), so it appears that truncation of protein B does not play a role in controlling sMMO activity during the copper switch. It remains to be demonstrated whether regulation of sMMO

14. Jiang, Y., Wilkins, P.C. & Dalton, H. (1993) Activation of the hydroxylase of sMMO from Methylococcus capsulatus (Bath) by hydrogen peroxide. Biochim. Biophys. Acta 1163, 105–112. 15. Froland, W.A., Andersson, K.K., Lee, S.-K., Liu, Y. & Lipscomb, J.D. (1992) Methane monooxygenase component B and reductase alter the regioselectivity of the hydroxylase component-catalyzed reactions: a novel role for protein–protein interactions in an oxygenase mechanism. J. Biol. Chem. 267, 17588–17597.

Regulation of sMMO activity (Eur. J. Biochem. 269) 1843

(cid:211) FEBS 2002

29. Pilkington, S.J. & Dalton, H. (1990) Soluble methane mono- capsulatus Bath. Methods from Methylococcus oxygenase Enzymol. 188, 181–190.

16. Lloyd, J.S., Bhambra, A., Murrell, J.C. & Dalton, H. (1997) Inactivation of the regulatory protein B of soluble methane monooxygenase from Methylococcus capsulatus (Bath) by pro- teolysis can be overcome by a Gly to Gin modification. Eur. J. Biochem. 248, 72–79. 30. Whittaker, J.R. & Granum, P.E. (1980) An absolute method for protein determination based on differences of absorbance at 235 and 280nm. Anal. Biochem. 109, 156–159. 31. Scopes, R.K. (1974) Measurement of protein by spectrophotom- etry at 205 nm. Anal. Biochem. 59, 277–282. 17. Gassner, G.T. & Lippard, S.J. (1999) Component interactions in the soluble methane monooxygenase system from Methylococcus capsulatus (Bath). Biochemistry 38, 12768–12785. 18. Fox, B.G., Liu, Y., Dege, J.E. & Lipscomb, J.D.

32. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of dye binding. Anal. Biochem. 72, 248–254.

(1991) Complex formation between the protein components of methane monooxygenase from Methylosinus trichosporium OB3b: identifi- cation of sites of component interaction. J. Biol. Chem. 266, 540– 550.

33. Bodrossy, L., Murrell, J.C., Dalton, H., Kalman, M., Puskas, L.G. & Kovacs, K.L. (1995) Heat-tolerant methanotrophic bac- teria from the hot-water e(cid:130)uent of a natural-gas field. Appl. Environ. Microbiol. 61, 3549–3555. 34. Balls, A.K. & Wood, H.N. (1956) Acetyl chymotrypsin and its reaction with ethanol. J. Biol. Chem. 219, 245–256. 19. Davydov, A., Davydov, R., Gra¨ slund, A., Lipscomb, J.D. & Andersson, K.K. (1997) Radiolytic reduction of methane mono- oxygenase dinuclear iron cluster at 77 K: EPR evidence for con- formational change upon reduction or binding of component B to the diferric state. J. Biol. Chem. 272, 7022–7026.

35. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680– 685. 36. Perler, F.B. (1998) Breaking up is easy with esters. Nat. Struct. Biol. 5, 249–252. 37. Stoddard, B.L. & Pietrokovski, S. (1998) Breaking up is hard to do. Nat. Struct. Biol. 5, 3–5. 20. Davydov, R., Valentine, A.M., Konar-Panicucci, S., Hoffman, B.M. & Lippard, S.J. (1999) An EPR study of the dinuclear iron site in the soluble methane monooxygenase from Methylococcus capsulatus (Bath) reduced by one electron at 77 K: the effects of component interactions and the binding of small molecules to the diiron (III) center. Biochemistry 38, 4188–4197.

38. Duggleby, H.J., Tolley, S.P., Hill, C.P., Dodson, E.J., Dodson, G. & Moody, P.C. (1995) Penicillin acylase has a single-amino-acid catalytic center. Nature 373, 264–268.

21. Coates-Pulver, S., Froland, W.A., Lipscomb, J.D. & Solomon, E.I. (1997) Ligand field circular dichroism and magnetic circular dichroism studies of component B and substrate binding to the hydroxylase component of methane monooxygenase. J. Am. Chem. Soc. 119, 387–395.

39. Guan, C.D., Cui, T., Rao, V., Liao, W., Benner, J., Line, C.L. & Comb, D. (1996) Activation of glycosylasparaginase: formation of active N-terminal threonine by intramolecular autoproteolysis. J. Biol. Chem. 271, 1732–1737. 22. Gallagher, S.C., Callaghan, A.J., Zhao, J., Dalton, H. & Trewhella, J. (1999) Global conformational changes control the reactivity of methane monooxygenase. Biochemistry 38, 6752–6760.

23. Walters, K.J., Gassner, G.T., Lippard, S.J. & Wagner, G. (1999) Structure of the soluble methane monooxygenase regulatory protein B. Proc. Natl Acad. Sci. USA 96, 7877–7882. 40. Ramjee, M.K., Genschel, U., Abell, C. & Smith, A.G. (1997) Escherichia coli L-aspartate-a-decarboxylase: preprotein process- ing and observation of reaction intermediates by electrospray mass spectrometry. Biochem. J. 323, 661–669.

24. Rosenzweig, A.C., Brandstetter, H., Whittington, D.A., Nordlund, P., Lippard, S.J. & Frederick, C.A. (1997) Crystal structures of the methane monooxygenase hydroxylase from Methylococcus capsulatus (Bath): implications for substrate gating and component interactions. Proteins 29, 141–152. 41. Nielsen, A.K., Gerdes, K., Dega, H. & Murrell, J.C. (1996) Regulation of bacterial methane oxidation: transcription of the soluble methane monooxygenase operon of Methylococcus capsulatus (Bath) is repressed by copper ions. Microbiology 142, 1289–1296.

25. Elango, N., Radhakrishnan, R., Froland, W.A., Wallar, B.J., Earhart, C.A., Lipscomb, J.D. & Ohlendorf, D.H. (1997) Crystal structure of the hydroxylase component of methane mono- oxygenase from Methylosinus trichosporium OB3b. Prot. Sci. 6, 556–568. 42. Chang, S.-L., Wallar, B.L., Lipscomb, J.D. & Mayo, K.H. (2001) Residues in Methylosinus trichosporium OB3b methane mono- oxygenase component B involved in molecular interactions with reduced- and oxidized-hydroxylase component: a role for the N-terminus. Biochemistry 40, 9539–9551. 43. Bhambra, A. (1996) The regulatory protein of methane mono- oxygenase. PhD Thesis, University of Warwick.

26. Pilkington, S.J., Salmond, G.P.C., Murrell, J.C. & Dalton, H. (1990) Identification of the gene encoding the regulatory protein B of soluble methane monooxygenase. FEMS Microbiol. Lett. 72, 345–348.

44. Zhou, N.Y., Jenkins, A., Chion, C.K.N.C.K. & Leak, D.J. (1999) The alkene monooxygenase from Xanthobacter strain Py2 is closely related to aromatic monooxygenases and catalyzes aromatic monohydroxylation of benzene, toluene, and phenol. Appl. Environ. Microbiol. 65, 1589–1595. 27. Brandstetter, H., Whittington, D.A., Lippard, S.J. & Frederick, C.A. (1999) Mutational and structural analyses of the regulatory protein B of soluble methane monooxygenase from Methylococcus capsulatus (Bath). Chem. Biol. 6, 441–449.

28. Maniatis, T., Fritsch, E.F. & Sambrook, J. (1982) Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. 45. Shinohara, Y., Uchiyama, H., Yagi, O. & Kusakabe, I. (1998) Purification and characterization of component B of a soluble methane monooxygenase from Methylocystis sp. M. J. Ferment. Bioeng. 85, 37–42.