Báo cáo khoa học: Regulation of the human leukocyte-derived arginine aminopeptidase/endoplasmic reticulum-aminopeptidase 2 gene by interferon-c

Regulation of the human leukocyte-derived arginine aminopeptidase/endoplasmic reticulum-aminopeptidase 2 gene by interferon-c Toshihiro Tanioka1,*, Akira Hattori1, Shigehiko Mizutani2 and Masafumi Tsujimoto1

1 Laboratory of Cellular Biochemistry, RIKEN, Wako, Saitama, Japan 2 Department of Obstetrics and Gynecology, Nagoya University School of Medicine, Showa, Nagoya, Japan

Keywords aminopeptidase; antigen-presentation; interferon regulatory factor; interferon-c; PU.1

Correspondence M. Tsujimoto, Laboratory of Cellular Biochemistry RIKEN (The Institute of Physical and Chemical Research), 2-1 Hirosawa, Wako-shi, Saitama 351-0198 Japan Fax: +81 48 462 4670 Tel: +81 48 467 9370 E-mail: tsujimot@riken.jp

*Present address Laboratory of Medical Information, Showa University School of Pharmaceutical Sciences, Shinagawa, Tokyo 142-8555, Japan

The leukocyte-derived arginine aminopeptidase (L-RAP) is the second ami- nopeptidase localized in the endoplasmic reticulum (ER) processing anti- genic peptides presented to major histocompatibility complex (MHC) class I molecules. In this study, the genomic organization of the gene encoding human L-RAP was determined and the regulatory mechanism of its expres- sion was elucidated. The entire genomic structure of the L-RAP gene is similar to both placental leucine aminopeptidase (P-LAP) and adipocyte- derived leucine aminopeptidase (A-LAP) genes, confirming the close relation- ship of these three enzymes. Interferon (IFN)-c up-regulates the expression of the L-RAP gene. Deletion and site-directed mutagenic analyses of the 5¢-flanking region of the L-RAP gene and electrophoretic mobility shift assay indicated that while interferon regulatory factor (IRF)-2 is important in the basal condition, IRF-1 is the primary regulator of IFN-c-mediated augmentation of the gene expression. In addition, PU.1, a member of the E26 transformation-specific family of transcription factors, also plays a role in the regulation of gene expression. The maximum expression of the gene was achieved by coexpression of IRF-1 and PU.1 in HEK293 cells and IRF-2 suppressed the IRF-1-mediated enhancement of gene expression, suggesting that IFN-c-induced L-RAP gene expression is cooperatively regulated by IRFs and PU.1 transcription factors.

Note The nucleotide sequence of human L-RAP(s)1 and L-RAP(s)2 reported in this paper have been submitted to the GenBankTM ⁄ EMBL ⁄ DDBJ Data Bank with accession numbers AY028805 and AB163917, respectively.

(Received 12 October 2004, revised 26 November 2004, accepted 8 December 2004)

doi:10.1111/j.1742-4658.2004.04521.x

Abbreviations A-LAP, adipocyte-derived leucine aminopeptidase; BAC, bacterial artificial chromosome; CHX, cycloheximide; DTT, dithiothreitol; EMSA, electrophoretic mobility shift assay; ER, endoplasmic reticulum; ERAP, endoplasmic reticulum aminopeptidase; Ets, E26 transformation- specific; IFN, interferon; IL, interleukin; IRF, interferon regulatory factor; L-RAP, leukocyte-derived arginine aminopeptidase; MHC, major histocompatibility complex; P-LAP, placental leucine aminopeptidase; PMSF, phenylmethanesulfonyl fluoride; TAP, transporter associated with antigen processing.

FEBS Journal 272 (2005) 916–928 ª 2005 FEBS

916

T. Tanioka et al.

Regulation of L-RAP ⁄ ERAP2 gene expression

Aminopeptidases hydrolyze N-terminal amino acids of proteins or peptide substrates. They are distributed widely in animal and plant tissues as well as in bacteria and fungi, suggesting that they play important roles in various biological processes [1]. Among them, M1 zinc-metallopeptidases (gluzincins) share the consensus GAMEN and HEXXH(X)18E zinc-binding motifs essential for enzymatic activity [2,3]. So far, nine enzymes belonging to the family were identified and laeverin was recently reported as the tenth member although its enzymatic activity was not reported [4,5].

the

Precursors of MHC class I-presented peptides with extra N-terminal residues are trimmed to mature epi- topes in the ER [24,25]. The peptides are first cleaved from endogenously synthesized proteins by proteasome or tripeptidyl peptidase II in the cytoplasm, transpor- ted into ER-lumen and then trimmed by certain aminopeptidases. Until now, only two aminopeptid- ases (A-LAP ⁄ ERAP1 and L-RAP ⁄ ERAP2) have been identified in the ER-lumen and have shown their ability to trim antigenic peptides [4,9,17]. Characteris- tically, as in the case of other components included in the presentation of MHC class I ligands such as MHC class I molecules, transporter associated with antigen inter- processing (TAP) and proteasome b-subunits, feron (IFN)-c enhances these expression of enzymes [24]. Although IFN-c-inducible aminopeptid- ases including lens LAP, A-LAP, and L-RAP play roles in the processing or degradation of antigenic peptides [4,9,17,26], the mechanisms of IFN-c-medi- ated regulation of aminopeptidase gene expression have never been examined.

In our previous work, we cloned a cDNA for the pla- cental leucine aminopeptidase (P-LAP) ⁄ oxytocinase, a type II membrane-spanning protein which belongs to the M1 family of aminopeptidases [6]. Subsequently we cloned cDNAs encoding adipocyte-derived leucine aminopeptidase (A-LAP) [7], which is also designated as puromycin-insensitive leucine-specific aminopeptidase (PILS-AP) or ER-aminopeptidase (ERAP)-1 [8,9], and leukocyte-derived arginine aminopeptidase (L-RAP) ⁄ ERAP2 [4] as highly homologous proteins to P-LAP. Structural and phylogenetic analyses indicated the close relationship between these three enzymes. Therefore we proposed that they should be classified into the oxyto- cinase subfamily of M1 aminopeptidases [10].

In the current study, we have elucidated the genomic structure of human L-RAP gene for the first time. Characterization of the promoter region of the gene indicates that while interferon regulatory factor (IRF)- 2 is important in the basal condition, IRF-1 is the primary regulator of IFN-c-mediated augmentation of the gene expression. It is also shown that PU.1, a member of the E26 transformation-specific (Ets) family of transcription factors, plays a role in the regulation of gene expression. Our data provide the molecular basis of regulatory mechanisms of enzymatic activity of L-RAP, which may play an important role in the processing of antigenic peptides presented to MHC class I molecules in the ER.

Results

Genomic organization of human L-RAP gene

[21–23]. As

receptors

these

of

Recent evidence facilitates new insights into the biological significance of the oxytocinase subfamily of aminopeptidases. P-LAP ⁄ oxytocinase, which is also designated as insulin-regulated aminopeptidase (IRAP), was shown to translocate from the intracellu- lar compartment to the plasma membrane in a stimu- lus-dependent manner and may regulate concentration of substrate peptide hormones on the cell surface [11–14]. This enzyme was recently shown to be the angiotensin IV receptor and may play a role in memory retention and retrieval [15,16]. On the other hand, we and others reported that A-LAP ⁄ ERAP1 is a final processing enzyme of the precursors of the major histocompatibility complex (MHC) class I-presented antigenic peptides [9,17]. A-LAP ⁄ ERAP1 was also shown to play roles in blood pressure regulation and angiogenesis [18–20]. Moreover, the enzyme was shown to bind to cytokine receptors such as tumour necrosis factor type I receptor, interleukin (IL)-6 a-receptor and IL-1 type II receptor, and facilitate ectodomain shedding for L-RAP ⁄ ERAP2, we have shown that the enzyme is retained in the endoplasmic reticulum (ER) and can trim some precursor peptides to MHC class I ligands [4]. These results indicate that the mammalian amino- peptidases belonging to the oxytocinase subfamily play important roles in the regulation of several biological processes.

To elucidate the genomic organization of the L-RAP gene, we screened a human genome database prepared in a bacterial artificial chromosome (BAC). This led to the identification of BAC clone RPCI-11-496M2 (accession number AC009126), which contains all exons of the L-RAP gene. All exons and intron–exon junctions were determined from the database. The sequences of splice junctions obey the GT-AG rule [27]. As shown in Fig. 1, the gene spans 45 kb and contains 19 exons ranging in size from 28 bp (exon 1) to 697 bp (exon 2) and the overall structure of the gene is quite similar to both P-LAP and A-LAP genes. The first exon includes only the 5¢-untranslated region.

FEBS Journal 272 (2005) 916–928 ª 2005 FEBS

917

T. Tanioka et al.

Regulation of L-RAP ⁄ ERAP2 gene expression

Fig. 1. Genomic structure of the human L-RAP gene. Schematic exon–intron structure of the gene is shown at the center. Exons are numbered and depicted as boxes. Asterisks indicate the sites used for the generation of different mRNAs described in the text. Generation scheme of L-RAP and L-RAP(s) proteins is also shown in the figure. Numbers shown in each protein molecule are number of amino acids derived from the respective exons.

Exon 2 includes the remaining 5¢-untranslated region and coding sequence for the first 192 amino acids. The GAMEN and HEXXH motifs are encoded in exon 6 and an essential glutamic acid residue located 19 amino acids downstream from the HEXXH motif is encoded in exon 7. Exon 19 contains the coding sequence for the last 47 amino acids, stop codon (TAA) and the 3¢-untranslated region.

length L-RAP transcript

is generated.

If

Fig. 2. Nucleotide sequence of the 5¢-flanking region of the human L-RAP gene. The 5¢-flanking region was searched for transcription factor binding sites by TF-SEARCH. The exon sequence is shown in uppercase letters, while that of the untranscribed region is given in lowercase letters. The transcriptional initiation site shown as +1 was determined by 5¢-RACE. For the measurement of promoter activity, the start point of each construct is indicated by an arrowhead.

sequence revealed no canonical TATA- or CCAAT- box, suggesting a housekeeping nature for the gene. On the other hand, several potential transcription factor binding motifs, such as IRF, GATA-1, Sp-1 and AP-1 were identified in the promoter region of the gene [30].

In our previous work, we obtained a cDNA enco- ding the truncated form of L-RAP [4]. Exon 10 that is deleted in the P-LAP gene encodes a sequence that may function as a hinge region [28]. As shown in termed L- Fig. 1, a transcript encoding this form, RAP(s)1 (accession number AY028805), is generated by differential usage of exon 10. When an intermediate nucleotide sequence (AACATGgtaag) matching the GT-AG rule in the exon functions as a splicing donor, full the sequence does not act as a splicing donor, the stop codon (TGA) in the exon causes the generation of transcript, a truncated form. Thereafter, another L-RAP(s)2 (accession number AB163917), encoding the same truncated form was also cloned. Differential usage of exon 15 causes the generation of two trun- cated forms of the transcripts. These results indicate that at least three mRNAs encoding either the full length or truncated form of L-RAP protein are gener- ated from a single gene.

Isolation and characterization of human L-RAP gene promoter

consensus

Figure 2 shows the nucleotide sequence of the 5¢-flank- ing region of the human L-RAP gene. The transcrip- tional initiation site of the gene was determined by 5¢ RACE and is shown as nucleotide position +1 in the figure. The site (TCAGTC) matches well with sequence, the pyrimidine-rich initiator in which Py represents a PyPy(A+1)N(T ⁄ A)PyPy, the pyrimidine residue [29]. Computer analysis of

To characterize the regions regulating transcriptional activity of the L-RAP gene, chimeric reporter plasmids encoding the luciferase gene and different lengths of L-RAP gene were constructed. The resultant chimeric constructs were then transfected into HEK293 cells to analyze the promoter activity. As a negative control, the promoter-less pGL3 basic plasmid was transfected into the cells. As shown in Fig. 3A, substantial promo- ter activity was detected when chimeric constructs con- taining the 5¢-flanking sequence upstream from the A at position )10 were transfected, confirming that the 5¢-flanking sequence of the L-RAP gene is indeed able initiation. The maximum to support

transcriptional

FEBS Journal 272 (2005) 916–928 ª 2005 FEBS

918

T. Tanioka et al.

Regulation of L-RAP ⁄ ERAP2 gene expression

Fig. 3. Role of the IRF-E site in IFN-c-induced enhancement of L-RAP gene expression in HEK293 cells. (A) Luciferase expression plasmids (1 lg) containing sequentially deleted fragments of the L-RAP chimera were transfected into HEK293 cells. Luciferase activity was measured as described in Experimental procedures and normalized to the b-galactosidase activity of a cotransfected internal control plasmid. The luci- ferase activity obtained in the basal condition from cells transfected with phLP1 was taken as 100%. (B) Enhancing effect of IFN-c is shown by fold increase in the figure. (C) Functional analysis of the IRF-E site of the L-RAP gene promoter in HEK293 cells. The phLP5 plasmid hav- ing either an intact or mutated IRF-E site was transfected into HEK293 cells and the luciferase activity was measured as described above. Open bars indicate luciferase activity in the basal condition and closed bars in the IFN-c-stimulated condition.

activity by

promoter activity was obtained with the constructs containing the sequence from )33 to +5. Deletion of the sequence from )33 to )17 caused a decrease in the promoter activity by nearly 50%. Further deletion to T at position )9 caused almost complete loss of activ- ity. Employing Jurkat-T cells, we obtained nearly the same results.

The promoter sequence from )33 to )17 contains a sequence (AGAAAGTGAAAGC) with resemblance to the IRF-E consensus sequence [G(A)AAASYGAA ASY]. We next examined the role of this site on the constructing mutant basal promoter plasmid [phLP5(MuI)] from phLP5 plasmid. We describe this sequence as the IRF-E site hereafter [31].

FEBS Journal 272 (2005) 916–928 ª 2005 FEBS

919

T. Tanioka et al.

Regulation of L-RAP ⁄ ERAP2 gene expression

A

Although substantial activity was retained, mutation of the IRF-E site caused a significant decrease in the promoter activity (Fig. 3C). These results suggest that the IRF-E site is crucial for the maximum promoter activity of the L-RAP gene in the basal condition.

Mechanism of IFN-c-mediated regulation of L-RAP gene expression

B

Because L-RAP gene expression is enhanced by IFN-c, we next examined its regulatory mechanism. As an ini- tial experiment, decay rates of L-RAP mRNAs pre- pared from Jurkat-T cells treated with or without IFN-c were compared in the presence of actinomycin D. As shown in Fig. 4A, there was little difference between decay rates of L-RAP mRNAs in the cells indicating that the treated with or without IFN-c, cytokine-induced enhancement of mRNA accumula- tion could not be attributed to the change of stability of L-RAP mRNA. In addition, it was found that the increase in mRNA accumulation was not observed in the presence of cycloheximide (CHX), indicating that de novo protein synthesis was required for the action of IFN-c (Fig. 4B).

To elucidate the role of IFN-c in the regulation of L-RAP gene expression, the luciferase-reporter assay was conducted to identify cytokine responsive elements in the gene. As shown in Fig. 3A,B, IFN-c induced about a fourfold increase in the expression of luci- ferase activity in HEK293 cells transfected with con- structs containing the sequence from )33 to )17. After deletion of this sequence, IFN-c had no enhancing activity. These results indicate that the sequence is essential for the cytokine-induced increase in L-RAP gene expression.

cycloheximide (CHX)

and further

Fig. 4. Requirement of de novo protein synthesis for IFN-c-medi- ated enhancement of L-RAP gene expression. (A) Effect of IFN-c on the stability of L-RAP mRNA. Jurkat-T cells were treated with or without 30 ngÆmL)1 IFN-c for 12 h at 37 (cid:1)C and further incubated in the presence of 1 lM actinomycin D (ActD) for indicated times. After incubation, expression levels of L-RAP mRNAs were meas- ured by Northern blot analysis. Densitometric data showing the decay rates of mRNAs are also shown. (B) Effect of CHX on the IFN-c-induced enhancement of L-RAP gene expression. Jurkat-T cells were preincubated for 3 h in the presence or absence of 1 lgÆmL)1 incubated with 30 ngÆmL)1 IFN-c for 12 h at 37 (cid:1)C. L-RAP mRNAs were detected by Northern blot analysis.

to

13-

(about

Because the sequence from )33 to )17 contains the IRF-E site, we next examined the role of this site in L-RAP gene regulation. As shown in Fig. 3C, muta- tion in this site caused complete loss of IFN-c-induced increase in the luciferase activity, confirming the role of the IRF-E site in the cytokine-mediated L-RAP gene regulation. These results indicate that the IRF-E site plays an important role both in the basal and IFN-c-mediated L-RAP gene expression.

of

the

15-fold) was either

On the other hand, it was found that in addition to the IRF-E site, the Ets site in the promoter also plays a role in gene expression in Jurkat-T cells. As in the case of HEK293 cells, the IRF-E site was required for the maximum expression of the gene. IFN-c induced an eightfold increase in the gene expression in cells transfectied with phLP5 plasmid. When Jurkat-T cells were transfected with plasmids containing the sequence from )67 to )33 that contains the Ets site, a further

observed increase (Fig. 5A,B). Mutation IRF-E [phLP4(MuI)] or Ets site [phLP4(MuE)] caused a substantial decrease IFN-c-mediated gene in the expression. Plasmid having mutations in both sites [phLP4(MuE ⁄ MuI)] had little activity, indicating that in Jurkat-T cells both the IRF and Ets sites are required for maximum enhancement of IFN-c-induced it was found gene expression (Fig. 5C). In contrast, that the Ets site had no effect on the promoter activity in HEK293 (data not shown). We found by RT-PCR

FEBS Journal 272 (2005) 916–928 ª 2005 FEBS

920

T. Tanioka et al.

Regulation of L-RAP ⁄ ERAP2 gene expression

Fig. 5. Role of the IRF-E and Ets sites in IFN-c-induced enhancement of L-RAP gene expression in Jurkat-T cells. (A) Luciferase expression plasmids (10 lg) containing sequentially deleted fragments of the L-RAP chimera were transfected into Jurkat-T cells. Cells were then trea- ted with or without 30 ngÆmL)1 IFN-c for 15 h at 37 (cid:1)C. Luciferase activity was measured as described in Experimental procedures and nor- malized to the b-galactosidase activity of a cotransfected internal control plasmid. The luciferase activity obtained in the basal condition from cells transfected with phLP1 was taken as 100%. (B) Enhancing effect of IFN-c is shown by fold increase in the figure. (C) Mutational analy- sis of the IRF-E and Ets sites of the L-RAP gene promoter in Jurkat-T cells. The phLP4 plasmid having either intact or mutated sites shown in the left panel of the figure was transfected into Jurkat-T cells and luciferase activity was measured. Open bars indicate luciferase activity in the basal condition and closed bars in the IFN-c-stimulated condition.

that expression of PU.1 was detectable in Jurkat-T cells but not in HEK293 cells (data not shown).

Role of IRFs in the regulation of L-RAP gene expression

Although the Oct-1 site is located proximal to the Ets site, mutational analysis indicated that this site had little effect on the gene expression (data not shown).

Transcription factors, IRF-1 and -2 are known to bind to the IRF-E site and regulate IFN-c action [31]. To examine whether IFN-c affects the expression levels of

FEBS Journal 272 (2005) 916–928 ª 2005 FEBS

921

T. Tanioka et al.

Regulation of L-RAP ⁄ ERAP2 gene expression

IRF-1 and -2 proteins, HEK293 cells were cultured in the presence or absence of the cytokine (Fig. 6A). When compared with untreated cells, an increase in the expression level of IRF-1 was observed in cells treated with IFN-c, indicating that IRF-1 is a candidate for the mediator of IFN-c action. In contrast, no effect was observed on the expression of IRF-2 protein.

To determine whether IRF-1 and -2 bind to the IRF-E site in the L-RAP promoter sequence, we per- formed an electrophoretic mobility shift assay (EMSA) using nuclear extracts from HEK293 cells treated with

or without IFN-c (Fig. 6B). An oligonucleotide probe corresponding to the IRF-E site bound to nuclear extracts prepared from both IFN-c-treated and untreated cells. In spite of the presence of an unex- pected nonspecific large band, bands shown as IRF-1 and -2 in Fig. 6 were replaced by unlabeled oligo- nucleotide competitor, indicating their specificity. The specificity of these bands was also confirmed by oligo- nucleotide with mutations at the IRF-E site. Although repeated trials were made, we could not remove the nonspecific bands.

A

B

To identify transcription factors bound to the IRF- E site, supershift assay was performed using antibodies raised against IRF-1 and IRF-2. When anti-(IRF-1) IgG was employed, supershift was observed only in the IFN-c-treated cells. On the other hand, anti-(IRF-2) IgG caused supershift in both treated and untreated cells. Moreover, appearance of two supershift bands and complete disappearance of the oligonucleotide spe- cific bands was observed in the presence of both anti- bodies. These results suggest that while in untreated cells IRF-2 but not IRF-1 was bound to the IRF-E site, IRF-1 and IRF-2 co-occupied the site after treat- ment with IFN-c. We obtained the same results in Jur- kat-T cells. However, it should be noted here that an IFN-c-inducible band other than IRF-1 and -2 was also observed in this experiment, suggesting that tran- scription factors other than IRF-1 and -2 also partici- pate in the regulation of L-RAP gene expression.

C

D

Fig. 6. Role of IRF-1 and PU.1 in the expression of the L-RAP gene. (A) IFN-c-induced increase in the expression of IRF-1 protein in HEK293 cells. HEK293 cells were treated with or without 30 ngÆmL)1 IFN-c for 5 h at 37 (cid:1)C. IRF-1 and IRF-2 in the nuclear extracts were measured by Western blot analysis. (B) Binding of IRF-1 and IRF-2 to the IRF-E site of the L-RAP gene. HEK293 cells were treated with or without 30 ngÆmL)1 IFN-c for 5 h at 37 (cid:1)C. EMSAs were then performed in nuclear extracts using a probe con- taining the IRF-E site from the L-RAP gene promoter. Supershifts were conducted using antibodies against indicated factors. Arrow- heads indicate the positions of IRF-1 and IRF-2. Arrow indicates the position of unidentified IFN-c-inducible IRF-E binding protein. Lanes shown as probe are loaded only with labeled probe. (C) Enhance- ment of promoter activity of the L-RAP gene by transcription fac- tors. HEK293 cells were cotransfected with phLP4 (0.5 lg) and various expression plasmids (0.5 lg) shown in the figure. After 24 h, luciferase activity was measured as described in Experimental the transcription factors are procedures. Enhancing effects of shown by fold increase using cells transfected only with phLP4 or as a control. (D) Induction of endogenous L-RAP gene expression by transcription factors. HEK293 cells were transfected with expression plasmids (0.5 lg) shown in the figure. For RT-PCR ana- total RNA was extracted after 24 h-incubation. Relative lysis, expression level is shown by fold increase in the figure using mock-transfected cell as a control.

FEBS Journal 272 (2005) 916–928 ª 2005 FEBS

922

T. Tanioka et al.

Regulation of L-RAP ⁄ ERAP2 gene expression

plasmid

into HEK293

activity,

the

peptides that the enzyme plays an important role in the processing of antigenic peptides presented to MHC class I molecules in the ER. In this study, we deter- mined the genomic structure of the human L-RAP gene and characterized the regulatory mechanisms of the gene expression. It was found that two forms of the L-RAP proteins are generated by alternative spli- cing. While the full length form exerts distinct amino- truncated form has no peptidase enzymatic activity [4]. It is necessary to elucidate the relationship between these two forms.

The entire genomic structure of the L-RAP gene is quite similar to the P-LAP and A-LAP genes [28,33]. The GAMEN and HEXXH(X)18E motifs essential for the enzymatic activity are encoded by exons 6 and 7 of the respective genes. Becasue these three genes are located contiguously around human chromosome 5q15, between versican and calpastatin [28], these data further confirm the latest divergence of the genes from a common ancestral gene.

experiments were

performed

using

To further elucidate the role of IRF-1 and -2 in the regulation of L-RAP gene expression, phLP4 plasmid was cotransfected either with pTARGET-IRF-1 or pTARGET-IRF-2 cells IRF-1 overexpressed in HEK293 cells (Fig. 6C). induced 8.6-fold increase in the luciferase activity, indi- cating that IRF-1 is indeed able to augment L-RAP gene expression. IRF-2 and PU.1, a transcription fac- tor which is known to bind to the Ets site [32], also had enhancing effects on the luciferase activity, and a 4.7- and 2.1-fold increase in the gene expression was observed, respectively. Furthermore, maximum gene expression (18.3-fold increase) was achieved in a syner- gistic manner when IRF-1 and PU.1 were coexpressed. On the other hand, coexpression of IRF-1 and IRF-2 caused lower expression of luciferase activity than expected, suggesting that IRF-2 suppressed IRF-1- mediated augmentation of the gene expression. We also examined other Ets site-binding factors such as Ets-1 and Ets-2 and found that they had little effect on the gene expression (data not shown). When the either same phLP4(MuE), phLP4(MuI) or phLP4(MuE ⁄ MuI), no synergistic effect between IRF-1 and PU.1 was observed (data not shown), confirming that native sites of both IRF-E and PU.1 are required for the synergis- tic action. Taken together these results indicate that while IRF-2 plays a role in the basal condition, IRF-1 can mediate IFN-c-stimulated L-RAP gene expression synergistically with PU.1.

To determine whether

is

the

IRF-E site

required for

IRF-E site

IRF-1 indeed mediates L-RAP gene expression in vivo, we next examined the effect of transcription factors on the expression of endogenous L-RAP gene. Several combinations of plasmids were transfected into HEK293 cells and their ability to enhance gene expression was examined by RT-PCR (Fig. 6D). In mock-transfected cells, L-RAP mRNA was barely detectable. Among trancription fac- tors tested, the highest expression was achieved when IRF-1 was overexpressed. Further increase in the gene expression was observed when IRF-1 and PU.1 were coexpressed. In contrast, IRF-2 suppressed IRF-1- mediated increase in the gene expression, although IRF-2 alone had some enhancing activity. These results further confirm the roles of transcription factors in the expression of the L-RAP gene.

Discussion

L-RAP ⁄ ERAP2 is a newly identified ER aminopepti- dase and the third member of the oxytocinase sub- family of M1 family of aminopeptidases [4]. It was suggested by its ability to generate certain antigenic

Expression of L-RAP is up-regulated by IFN-c [4]. IFN-c also stimulates the induction of components included in the processing of MHC class-I ligands [24]. Considering the evidence that suggest a role of L-RAP as an antigen-trimming enzyme in the ER, it is import- ant to elucidate the mechanism of the IFN-c-induced increase in L-RAP gene expression. The transient expression of the 5¢-flanking region of the L-RAP gene fused to the luciferase gene in either HEK293 or Jurkat-T cells allowed the analysis of basal and IFN-c- mediated regulation of promoter activity. We demon- strated by deletion analysis that the sequence ranging from )16 to )10 carries the minimum promoter activ- ity of the gene. In addition, mutational analysis sug- gested that the maximum enhancement of gene expression in the basal condition. Because EMSA indicated that IRF-2 is in unstimulated associated with the HEK293 cells, our data suggest that IRF-2 can aug- ment the transcription of the L-RAP gene in the basal condition. In fact, IRF-2 had some enhancing effect on the gene expression when overexpressed in HEK293 cells. Although it is generally considered that IRF-2 is a negative regulator of gene expression [31], it has also been shown to up-regulate the expression of several genes such as histone 4 and VCAM-1 [34,35]. However, we could not completely rule out the possible contribu- tion of other IRF-E site-binding proteins [31], because an IFN-c-inducible IRF-E binding protein other than IRF-1 and IRF-2 was detectable by EMSA, even in the basal condition. Identification and elucidation of the role of this protein in L-RAP gene expression is required.

FEBS Journal 272 (2005) 916–928 ª 2005 FEBS

923

T. Tanioka et al.

Regulation of L-RAP ⁄ ERAP2 gene expression

It is worthy of noting here that both P-LAP and A-LAP promoters also contain IRF-E sites [28,33]. It was reported that IFN-c had no enhancing effect on P-LAP gene expression [33]. In our preliminary results, the IRF-E site in the A-LAP promoter had little effect on IFN-c-induced gene expression, raising the possib- lity that IFN-c affects the expression of the A-LAP gene differently from that of the L-RAP gene.

transfection of

it was reported that IRFs and PU.1 For instance, synergistically mediate the transcriptional enhancement of human interleukin-1 (IL-1)b gene expression. It was suggested by physical interaction analysis that the fac- tors might function together as an enhanceosome [38]. As shown in other genes [39,40], it is plausible that IRF-1 mediates the IFN-c-stimulated L-RAP gene expression through interaction with PU.1. On the other hand, it is possible that IRF-2 acts independently from PU.1 to enhance the gene expression in the basal con- dition. Because binding of IRF-2 to the IRF-E site was still observed after IFN-c treatment, it is possible to speculate that IRF-2 modulates the gene expression by interacting with IRF-1 in the IRF-E site of the L-RAP gene. As with the L-RAP gene, Gobin et al. reported that binding of IRF-2 to the MHC class I molecule promoter was observed after IFN-c treatment [41]. It was also reported that IRF-2 co-occupies the IRF-E site of the class II transactivator type IV promoter with IRF-1 and synergistically activates the promoter [42].

IFN-c-induced increase in L-RAP gene expression required de novo protein synthesis and it was found that IRF-1 was induced by IFN-c. Deletion and muta- tional analyses indicated that the IRF-E site is res- ponsible for the cytokine-mediated increase in gene expression in HEK293 cells. Mutation of the site caused loss of the cytokine action. EMSA indicated that while IRF-2 but not IRF-1 bound to the IRF-E site in the basal condition, binding of both IRF-1 and -2 were detectable after treatment with IFN-c. More- over, the IRF-1 expression plasmid into HEK293 cells caused an increase in the gene expression. These results strongly suggest that IRF-1 is a primary mediator of IFN-c-mediated enhancement of L-RAP gene expression in HEK293 cells. Because coexpression of IRF-1 and IRF-2 caused a decrease in L-RAP gene expression, it is plausible that IRF-2 acts as a negative regulator of IRF-1-mediated enhance- ment of gene expression, by co-occupation of the IRF-E site with IRF-1 in IFN-c-treated cells.

L-RAP ⁄ ERAP2 is the second ER-lumenal amino- peptidase to be determined, and can trim certain pre- cursors of antigenic peptides presented to MHC class I molecules [4], suggesting the potential significance of this enzyme in antigen processing. In this study, we characterized the L-RAP gene for the first time. We have shown that the IRF-E site located in the proximal region of the transcription initiation site plays a pivotal role in the regulation of human L-RAP gene expres- sion both in the basal and IFN-c-stimulated condi- tions. As shown in several genes [43–45], it was found that while IRF-2 plays a role in the basal condition, IRF-1 is the primary regulator of the gene expression transcription factor(s) induced by IFN-c. However, other than IRF-1 and -2 may also regulate L-RAP gene expression. Further works are required to exam- ine the involvement of other transcription factors that bind to the IRF-E site. Considering the significance of the processing of antigen presented to MHC class I molecules in several pathophysiological conditions such as virus infection, tumor generation and self-antigen generation, it is important to elucidate the total aspects of the antigen presentation process including the regu- latory mechanisms of L-RAP gene expression.

Experimental procedures

Identification of the human L-RAP gene

On the other hand, the mechanism of IFN-c-induced L-RAP gene regulation in Jurkat-T cells is rather com- plex. It is obvious that in addition to the IRF-E site, the Ets site located between )63 and )56 also plays a role in the maximum enhancement of IFN-c-induced gene expression. It is unlikely that another Ets site located between )352 and )345 plays a role in the gene expression, because deletion of this sequence had little effect on the enhancement of the gene expression. Among the Ets family transcription factors tested, only PU.1 could mediate the cytokine action. The expres- sion of PU.1 is limited to hematopoietic lineages and is necessary for the differentiation of myeloid cell line- ages such as macrophages and osteoclasts [36,37]. Our analysis by RT-PCR indicated the expression of PU.1 in Jurkat-T cells but not HEK293 cells. Therefore, it is plausible that the lineage-dependent expression of PU.1 may determine the expression level of the L-RAP gene. Consistent with this notion, IRF-1 and PU.1 mediated the maximum expression of both reporter and endogenous genes when overexpressed, even in HEK293 cells.

A genomic sequence of (cid:1) 178 kb from the Gen- BankTM ⁄ EMBL ⁄ DDBJ Data Bank was obtained. This sequence encompasses a region on human chromosome 5q15 where the known P-LAP gene is located. The loca-

The molecular basis of the cooperative action of transcription factors is considered to be the physical interaction of the transcription factors involved [37].

FEBS Journal 272 (2005) 916–928 ª 2005 FEBS

924

T. Tanioka et al.

Regulation of L-RAP ⁄ ERAP2 gene expression

tions of the exons of the L-RAP gene were determined using the blast program.

The PU.1 expression plasmid pcDNA3-PU.1 which was constructed by using pcDNA3 (Invitrogen, Carlsbad, CA, USA) was obtained from M Matsumoto of Saitama Med- ical School (Saitama, Japan) [46].

Cell culture

Transfection and luciferase assay

Jurkat-T cells were obtained from the RIKEN Cell Bank (Tsukuba, Japan) and maintained in RPMI 1640. Human embryonic kidney (HEK) 293 cells were purchased from ATCC (Manassas, VA, USA) and maintained in RPMI 1640. All media used in this study was from Sigma (St. Louis, MO, USA) and supplemented with 10% fetal bovine serum (JRH Biosciences, Lenexa, KS, USA), peni- cillin G, and streptomycin (Meiji Seika Co., Kanagawa, Japan). The cells were cultured in a humidified 5% CO2 and 95% air incubator at 37 (cid:1)C.

Analysis of promoter activity

the

For transfection of the reporter plasmid, HEK293 cells were plated on 24 well plates at a density of 1 · 105 cells per well on the day before transfection, while Jurkat-T cells (1 · 106 cells) were plated in a 100 mm dish. Plasmid DNA was mixed with LipofectAmine (Invitorogen) and transfected into HEK293 cells following the manufacturer’s protocol. A pCMVb (0.5 lg) plasmid was employed as an internal control of transfection efficiency. To transfect into Jurkat-T cells, the electroporation (225 V, 350 lF) method was employed, using Electro Cell Manipulator (BTX, San Diego, CA, USA). After 24 h of transfection, the cells were washed three times with NaCl ⁄ Pi and then lysed in reporter lysis buffer (Promega). The luciferase activity was then measured with a luciferase assay system (Promega) accord- ing to the manufacturer’s instruction. Luciferase activity was measured in triplicate, averaged, and then normalized to b-galactosidase activity to correct for transfection effi- ciency. b-Galactosidase activity was measured using o-nitro- phenyl-b-d-galactopyranoside as a substrate. phLP3;

Electrophoretic mobility shift assay

phLP4; the sequence from )33 to )18)

The human L-RAP 5¢-flanking region and its fragments, which include initiation site, were transcriptional amplified by PCR from a BAC clone. PCR products were inserted into the promoter-less plasmid, pGL3 basic (Promega, Madison, WI, USA). The nucleotide sequence the primers used for PCR amplification were as of follows (5¢-3¢): CGGGTACCTGAACCAGCTAGTACT TACTG (sense strand of the sequence from )88 to )68) CGGGTACCTACTCAGGAAGCATGC for AAGT (sense strand of the sequence from )67 to )47) CGGGTACCACAGAAAGTGAAAGCA for (sense strand of for phLP5; CGACGCGTTGACTGAAGGGGAATTTACTTT (antisense strand of the sequence from )17 to +5) for all constructs. For phLP6 and 7, plasmids were construc- ted by using synthetic oligonucleotides corresponding to the 5¢-flanking region. We also constructed phLP1 and 2 plasmids by sequetial deletion of SmaI and Van91I fragment from phLP0 covering the sequence from )1042 to +5.

Double-stranded oligonucleotides containing the consensus sequence IRF-E site were radiolabeled with [32P]dCTP[aP] at the 3¢ end with a Klenow fragment and then purified with a MicroSpin column (Amersham Biosciences, Piscata- way, NJ, USA). The sense sequences of the synthesized oligonucleotides used were as follows: for the native IRF-E in the human L-RAP site (GAACAGAAAGTGAAAG) 5¢-flanking region, and for mutation in the IRF-E site (GAACAGAGGGTGAGGG). and the antisense sequences of synthesized oligonucleotides used were as follows: for native IRF-E site (TTTGCTTTCACTTTCT) in the human L-RAP 5¢-flanking region, for mutation in IRF-E site (TTTGCCCTCACCCTCT). The mutated nucleotide sequ- ences are underlined.

FEBS Journal 272 (2005) 916–928 ª 2005 FEBS

925

Nuclear extracts of the cells were prepared as follows: the cells suspended in 500 lL of ice-cold buffer A [10 mm He- pes, 10 mm KCl, 1.5 mm MgCl2, 0.5 mm dithiothreitol (DTT), 0.2 mm phenylmethanesulfonyl fluoride (PMSF): pH 7.9] were lysed in a Dounce-homogenizer and then the nuclei were pelleted by centrifugation at 3300 g for 15 min. The pellets were then suspended in an equal volume of low salt buffer (20 mm Hepes, 20 mm KCl, 1.5 mm MgCl2, 0.2 mm EDTA, 0.5 mm DTT, 0.2 mm PMSF, 25% glycerol: pH 7.9). Thereafter, half volume of high salt buffer (20 mm Hepes, 1.4 m KCl, 1.5 mm MgCl2, 0.2 mm EDTA, 0.5 mm DTT, 0.2 mm PMSF, 25% glycerol: pH 7.9) was added Mutagenesis of the IRF and Ets sites was performed by using mutated oligonucleotides when constructing the respective plasmids. For making mutations in IRF, 5¢-CACAGAGGGTGAGGGCAAAAGTAAATTCCCCTT CAGTCAA-3¢ (sense sequence of mutant IRF-E site) and 5¢-CGCGTTGACTGAAGGGGAATTTACTTTTGCCCT CACCCTCTGTGGTAC-3¢ (antisense sequence of mutant IRF-E site) were used. For the Ets mutant, 5¢-GGGGTA CCTACTCAAAGAGCATGCAAAGT-3¢ (sense sequence of mutant Ets site) and 5¢-CGACGCGTTGACTGAAGG GGAATTTACTTT-3¢ (antisense sequence of mutant Ets site) were used. For the construction of the double mutant plasmid, 5¢-GGGGTACCTACTCAAAGAGCATGCAAA GT-3¢ and 5¢-CGACGCGTTGACTGAAGGGGAATTTA CTTTTGCCCTCACCCTCTGTTCTAA-3¢ (antisense sequ- ence of mutant IRF-E site) were used. The mutated nucleo- tide sequences are underlined.

T. Tanioka et al.

Regulation of L-RAP ⁄ ERAP2 gene expression

Acknowledgement

stepwise, incubated at 4 (cid:1)C for 30 min and centrifuged at 25 000 g for 45 min. Supernatant was then collected.

This work was supported in part by grants-in-aid (Nos. 15390032, 15790061 and 14771302) from the Ministry of Education, Science, Sports and Culture of Japan and a grant for ‘Chemical Biology Research Program’ from RIKEN.

References

1 Taylor A (1993) Aminopeptidases: structure and func- tion. FASEB J 7, 290–298. 2 Hooper NM (1994) Families of zinc metalloproteases. FEBS Lett 354, 1–6.

The nuclear extracts were incubated with 1 ng of radio- labeled oligonucleotide corresponding to the IRF-E site in binding buffer [10 mm Hepes, 50 mm KCl, 5 mm MgCl2, 0.5 mm EDTA, 5 mm DTT, 0.7 mm PMSF, 2 lgÆmL)1 leu- peptin, 2 lgÆmL)1 pepstatin, 2 lgÆmL)1 aprotinin, 10% gly- cerol, 1 lgÆmL)1 poly(dI-dC): pH 7.9] for 30 min at 25 (cid:1)C. For competition assay, 100-fold excess of unlabeled oligo- nucleotide was added to the binding reaction prior to the addition of the radiolabeled probe. For supershift analysis, 2 lg of the required antibody was added following the bind- ing reaction for 1 h at 4 (cid:1)C. These incubation mixtures were then electrophoresed in 8% native polyacrylamide gel with Tris ⁄ borate ⁄ EDTA buffer. The gel was dried and analyzed with a BAS2000 Fuji photo film (Fuji, Kanagawa, Japan). 3 Laustsen PG, Vang S & Kristensen T (2001) Mutational analysis of the active site of human insulin-regulated aminopeptidase. Eur J Biochem 268, 98–104.

Western blot analysis

4 Tanioka T, Hattori A, Masuda S, Nomura Y, Nakay- ama H, Mizutani S & Tsujimoto M (2003) Human leu- kocyte-derived arginine aminopeptidase: the third member of the oxytocinase subfamily of aminopepti- dases. J Biol Chem 278, 32275–32283.

5 Fujiwara H, Higuchi T, Yamada S, Hirano T, Sato Y, Nishioka Y, Yoshioka S, Tatsumi K, Ueda M, Maeda M & Fujii S (2004) Human extravillous trophoblasts express laeverin, a novel protein that belongs to mem- brane-bound gluzincin metallopeptidases. Biochem Bio- phys Res Commun 313, 962–968. 6 Rogi T, Tsujimoto M, Nakazato H, Mizutani S &

IgG) Tomoda Y (1996) Human placental leucine aminopepti- dase: a new member of type II membrane-spanning zinc metallopeptidase family. J Biol Chem 271, 56–61.

7 Hattori A, Matsumoto H, Mizutani S & Tsujimoto M (1999) Molecular cloning of adipocyte-derived leucine aminopeptidase highly related to placental leucine aminopeptidase ⁄ oxytocinase. J Biochem (Tokyo) 125, 931–938. 8 Schomburg L, Kollmus H, Friedrichsen S & Bauer K Test samples were separated by SDS ⁄ PAGE on an 8% separating gel and transferred to poly(vinylidene difluo- (Pall Corp, East Hills, NY, USA). ride) membranes The membranes were blocked with Tris ⁄ HCl-buffered saline (NaCl ⁄ Tris) (pH 7.4) containing 0.1% Tween-20 (NaCl ⁄ Tris ⁄ Tween) with 5% skimmed milk for 1 h at room temperature, then incubated in NaCl ⁄ Tris ⁄ Tween, 5% skimmed milk, and 2.5 lgÆmL)1 rabbit either anti- (human IRF-1) IgG or anti-(human IRF-2) IgG for 2 h at room temperature. The filter was washed three times with NaCl ⁄ Tris ⁄ Tween and incubated for 1 h with horseradish IgG (Pro- peroxidase-conjugated goat anti(rabbit mega), diluted to 1 : 20 000 in NaCl ⁄ Tris ⁄ Tween contain- ing 5% skimmed milk. After washing the filter three times with NaCl ⁄ Tris ⁄ Tween, the blots were detected by an enhanced chemiluminescence method using an ECL plus Western blotting kit obtained from Amersham Biosciences. The results were visualized by fluorography using RX-U Fuji medical X-ray film.

Detection of L-RAP mRNA by RT-PCR

(2000) Molecular characterization of a puromycin-insen- sitive leucyl-specific aminopeptidase, PILS-AP. Eur J Biochem 267, 3198–3207.

9 Saric T, Chang S-C, Hattori A, York IA, Markant S, Rock KL, Tsujimoto M & Goldberg AL (2002) An IFN-c-induced aminopeptidase in the ER, ERAPI, trims precursors to MHC class I-presented peptides. Nat Immunol 3, 1169–1176. RT-PCR was preformed as described previously [46] using the primer pair of 5¢-ATGACAAGTAACATGCTCGC-3¢ (anti- (sense) and 5¢-AATGAGTTGGTCCCATCCAT-3¢ sense). PCR was carried out for 1 cycle at 95 (cid:1)C for 9 min, followed by 30 cycles of 94 (cid:1)C for 30 s, 55 (cid:1)C for 30 s, and 72 (cid:1)C for 30 s.

10 Tsujimoto M & Hattori A (2004) The oxytocinase sub- family of M1 aminopeptidases. Biochim Biophys Acta doi: 10.1016/j.bbapap.2004.09.011.

Materials

FEBS Journal 272 (2005) 916–928 ª 2005 FEBS

926

11 Keller SR (2003) The insulin-regulated aminopeptidase: a companion and regulator of GLUT4. Front Biosci 8, S410–S420. 12 Keller SR, Scott HM, Mastick CC, Aebersold R & Lienhard GE (1995) Cloning and characterization of a Recombinant human IFN-c was obtained from PeproTech (Rocky Hill, NJ, USA). Antibodies against human IRF-1 and IRF-2 were from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

T. Tanioka et al.

Regulation of L-RAP ⁄ ERAP2 gene expression

novel insulin-regulated membrane aminopeptidase from Glut4 vesicles. J Biol Chem 270, 23612–23618. multifunctional aminopeptidase, aminopeptidase regula- tor of TNF receptor type 1 shedding. J Immunol 171, 6814–6819.

24 Goldberg AL, Cascio P, Saric T & Rock KL (2002) The importance of the proteasome and subsequent proteolytic steps in the generation of antigenic peptide. Mol Immunol 39, 147–164. 13 Nakamura H, Itakura A, Okamura M, Ito M, Iwase A, Nakanishi Y, Okada M, Nagasaka T & Mizutani S (2000) Oxytocin stimulates the translocation of oxytocinase of human vascular endothelial cells via activation of oxytocin receptors. Endocrinology 141, 4481–4485. 25 Hattori A & Tsujimoto M (2004) Processing of anti- 14 Masuda S, Hattori A, Matsumoto H, Miyazawa S, genic peptides by aminopeptidases. Biol Pharm Bull 27, 777–780.

Natori Y, Mizutani S & Tsujimoto M (2003) Involve- ment of the V2 receptor in vasopressin-stimulated translocation of placental leucine aminopeptidase ⁄ oxytocinase in renal cells. Eur J Biochem 270, 1988– 1994. 26 Beninga J, Rock KL & Goldberg AL (1998) Inter- feron-c can stimulate post-proteasomal trimming of the N-terminus of an antigenic peptide by inducing leucine aminopeptidase. J Biol Chem 273, 18734– 18742. 27 Shapiro MB & Senapathy P (1987) RNA splice junc-

tions of different classes of eukaryotes: sequence statis- tics and functional implications in gene expression. Nucleic Acids Res 15, 7155–7174. 15 Albiston AL, McDowall SG, Matsacos D, Sim P, Clune E, Mustafa T, Lee J, Mendelsohn FAO, Simpson RJ, Connolly LM & Chai SY (2001) Evidence that the angiotensin IV (AT4) receptor is the enzyme insulin- regulated aminopeptidase. J Biol Chem 276, 48623– 48626.

28 Hattori A, Matsumoto K, Mizutani S & Tsujimoto M (2001) Genomic organization of the human adipocyte- derived leucine aminopeptidase gene and its relationship to the placental leucine aminopeptidase ⁄ oxytocinase gene. J Biochem (Tokyo) 130, 235–241. 29 Javahery R, Khachi A, Lo K, Zenzie-Gregory B & 16 Albiston AL, Mustafa T, McDowall SG, Mendelsohn FAO, Lee J & Chai SY (2003) AT4 receptor is insulin- regulated membrane aminopeptidase: potential mechan- ism of memory enhancement. Trends Endocrinol Metab 14, 72–77.

Smale ST (1994) DNA sequence requirements for tran- scriptional initiator activity in mammalian cells. Mol Cell Biol 14, 116–127. 17 Serwold T, Gonzalez F, Kim J, Jacob R & Shastri N (2002) ERAAP customizes peptides for MHC class I molecules in the endoplasmic reticulum. Nature 419, 480–483.

30 Faisst S & Meyer S (1992) Compilation of vertebrate- encoded transcription factors. Nucleic Acids Res 20, 3–26. 31 Taniguchi T, Ogasawara K, Takaoka A & Tanaka N

(2001) IRF family of transcription factors as regulators of host defense. Annu Rev Immunol 19, 623–650. 18 Yamamoto N, Nakayama J, Yamakawa-Kobayashi K, Hamaguchi H, Miyazaki R & Arinami T (2002) Identi- fication of 33 polymorphisms in the adipocyte-derived leucine aminopeptidase (ALAP) gene and possible association with hypertension. Hum Mutat 19, 251– 257. 19 Miyashita H, Yamazaki T, Akada T, Niizeki O, Ogawa 32 Oikawa T & Yamada T (2003) Molecular biology of the Ets family of transcription factors. Gene 303, 11–34. 33 Rasmussen TE, Pedraza-Diaz S, Hardre R, Laustsen

M, Nishikawa S & Sato Y (2002) A mouse orthologue of puromycin-insensitive leucyl-specific aminopeptidase is expressed in endothelial cells and plays am important role in angiogenesis. Blood 99, 3241–3249. PG, Carrion AG & Kristensen T (2000) Structure of the human oxytocinase ⁄ insulin-regulated aminopeptidase gene and localization to chromosome 5q21. Eur J Bio- chem 267, 2297–2306.

20 Akada T, Yamazaki T, Miyashita H, Niizeki O, Abe M, Sato A, Satomi S & Sato Y (2002) Puromycin insensitive leucyl-specific aminopeptidase (PILSAP) is involved in the activation of endothelial integrins. J Cell Physiol 193, 253–262. 34 Vaughan PS, Aziz F, van Wijnen AJ, Wu S, Harada H, Taniguchi T, Soprano KJ, Stein JL & Stein GS (1995) Activation of a cell-cycle-regulated histone gene by the oncogenic transcription factor IRF-2. Nature 377, 362– 365. 35 Jesse TL, LaChance R & Iademarco MF & Dean DC

FEBS Journal 272 (2005) 916–928 ª 2005 FEBS

927

21 Cui X, Hawari F, Alsaary S, Lawrence M, Combs CA, Geng W, Rouhani FN, Miskinis D & Levine SJ (2002) Identification of ARTS-1 as a novel TNFR1-binding protein that promotes TNFR1 ectodomain shedding. J Clin Invest 11, 515–526. 22 Cui X, Rouhani FN, Hawari F & Levine SJ (2003) (1998) Interferon regulatory factor-2 is a transcriptional activator in muscle where it regulates expression of vas- cular cell adhesion molecule-1. J Cell Biol 140, 1265– 1276. 36 Sharrocks AD (2001) The ETS-domain transcription ARTS-1, is required for interleukin-6 receptor shedding. J Biol Chem 278, 28677–28685. factor family. Nat Rev 2, 827–837. 23 Cui X, Rouhani FN, Hawari F & Levine SJ (2003) 37 Tondravi MM, McKercher SR, Anderson K, Erdmann Shedding of the type II IL-1 decoy receptors requires a JM, Quiroz M, Maki R & Teitelbaum SL (1997)

T. Tanioka et al.

Regulation of L-RAP ⁄ ERAP2 gene expression

Osteopetrosis in mice lacking haematopoietic transcrip- tion factor PU.1. Nature 386, 81–84. 38 Marecki S, Riendeau CJ, Liang MD & Fenton MJ regulatory element of the class II transactivator (CIITA) type IV promoter by interferon regulatory factors 1 and 2. Oncogene 18, 5889–5903.

43 van Gravesande KS, Layne MD, Ye Q, Le L, Baron RM, Perrella MA, Santambrogio L, Silverman ES & Riese RJ (2002) IFN regulatory factor-1 regulates IFN-c-depend- ent cathepsin S expression. J Immunol 168, 4488–4494. 44 Hisamatsu T, Suzuki M & Podolsky DK (2003) Inter- feron-c augments CARD4 ⁄ NOD1 gene and protein expression through interferon regulatory factor-1 in intestinal epithelial cells. J Biol Chem 278, 32962–32968. 45 Liu J, Cao S, Herman LM & Ma X (2003) Differential

(2001) PU.1 and multiple IFN regulatory factor proteins synergize to mediate transcriptional activation of the human IL-1 b gene. J Immunol 166, 6829–6838. 39 Eklund EA, Jalava A & Kakar R (1998) PU.1, inter- feron regulatory factor 1, and interferon consensus sequence-binding protein cooperate to increase gp91 (phox) expression. J Biol Chem 273, 13957–13965. 40 Eklund EA & Kakar R (1999) Recruitment of CREB- binding protein by PU.1, IFN-regulatory factor-1, and the IFN consensus sequence-binding protein is necessary for IFN-c-induced p67phox and gp91phox expression. J Immunol 163, 6095–6105. 41 Gobin SJP, van Zutphen M, Woltman AM & van den

Elsen PJ (1999) Transactivation of classical and nonclas- sical HLA class I genes through the IFN-stimulated response element. J Immunol 163, 1428–1434.

FEBS Journal 272 (2005) 916–928 ª 2005 FEBS

928

42 Xi H, Eason DD, Ghosh D, Dovhey S, Wright KL & Blanck G (1999) Co-occupancy of the interferon regulation of interleukin (IL)-12 p35 and p40 gene expres- sion and interferon (IFN)-c-primed IL-12 production by IFN regulatory factor 1. J Exp Med 198, 1265–1276. 46 Matsumoto M, Hisatake K, Nogi Y & Tsujimoto M (2001) Regulation of receptor activator of NF-jB lig- and-induced tartrate-resistant acid phosphatase gene expression by PU.1-interacting protein ⁄ interferon regu- latory factor-4. Synergism with microphthalmia tran- scription factor. J Biol Chem 276, 33086–33092.