Báo cáo khoa học: Mutants of Saccharomyces cerevisiae deficient in acyl-CoA synthetases secrete fatty acids due to interrupted fatty acid recycling

Mutants of Saccharomyces cerevisiae deficient in acyl-CoA synthetases secrete fatty acids due to interrupted fatty acid recycling Michael Scharnewski1, Paweena Pongdontri1,*, Gabriel Mora1, Michael Hoppert2 and Martin Fulda1

1 Department of Plant Biochemistry, Albrecht-von-Haller Institute, Georg-August University Goettingen, Germany 2 Institute for Microbiology and Genetics, Georg-August University Goettingen, Germany

Keywords endoplasmic reticulum; FAA; FAT1; fatty acid accumulation; lipid remodelling

Correspondence M. Fulda, Department of Plant Biochemistry, Albrecht-von-Haller Institute for Plant Sciences, Georg-August University Goettingen, Justus-von-Liebig-Weg 11, D-37077 Goettingen, Germany Fax: +49 551 39 5749 Tel: +49 551 39 5750 E-mail: mfulda@gwdg.de

*Present address Department of Biochemistry, Faculty of Science, Khon Kaen University, Thailand

(Received 9 January 2008, revised 12 March 2008, accepted 20 March 2008)

doi:10.1111/j.1742-4658.2008.06417.x

In the present study, acyl-CoA synthetase mutants of Saccharomyces cerevisiae were employed to investigate the impact of this activity on cer- tain pools of fatty acids. We identified a genotype responsible for the secre- tion of free fatty acids into the culture medium. The combined deletion of Faa1p and Faa4p encoding two out of five acyl-CoA synthetases was necessary and sufficient to establish mutant cells that secreted fatty acids in a growth-phase dependent manner. The mutants accomplished fatty acid export during exponential growth-phase followed by fatty acid re-import into the cells during the stationary phase. The data presented suggest that the secretion is driven by an active component. The fatty acid re-import resulted in a severely altered ultrastructure of the mutant cells. Additional strains deficient of any cellular acyl-CoA synthetase activity revealed an almost identical phenotype, thereby proving transfer of fatty acids across the plasma membrane independent of their activation with CoA. Further experiments identified membrane lipids as the origin of the observed free fatty acids. Therefore, we propose the recycling of endogenous fatty acids generated in the course of lipid remodelling as a major task of both acyl-CoA synthetases Faa1p and Faa4p.

Abbreviations ACP, acyl-carrier protein; ER, endoplasmic reticulum; FAS, fatty acid synthase; Fat1p, fatty acid transport protein 1; Fat2p, fatty acid transport protein 2; YPR, yeast proteose raffinose medium.

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2765

Fatty acid metabolism pervades large areas of cellular life. In all known ramifications of this metabolism, fatty acids almost never undergo direct metabolic conversion as free molecules. The fatty acid molecule usually requires the activation of its carboxyl group via esterification to either acyl-carrier-protein (ACP) or to CoA. Only as thioesters are fatty acids able to accom- plish any of their possible metabolic fates. In Saccha- romyces cerevisiae, the fatty acids are synthesized by a large multienzyme complex designated as fatty acid synthase (FAS) on the basis of ACP [1]. In S. cerevi- siae, the ACP is an integral component of the FAS complex and, therefore, free acyl-ACP is not available for any other metabolic purposes. The synthetic cycle is terminated by transferring the generated acyl chain directly to CoA [2]. Due to this mechanism, the direct product of fatty acid de novo synthesis in S. cerevisiae is acyl-CoA, which consequently is the only activated fatty acid molecule serving all other metabolic path- ways [1]. Besides deriving from de novo synthesis, lipid degradation as well as import of exogenous fatty acids may feed into the pool of intracellular fatty acids. In both cases, enzymatic activation with CoA is required to allow further metabolization of these fatty acids. In

M. Scharnewski et al.

Fatty acid secretion in mutants of yeast

developed describing fatty acid movement across a membrane as a passive process. This mechanism of simple diffusion is based on the fast flip-flop of fatty acids through the membrane and has been reviewed comprehensively [18,19].

exact genetic the

Reviewing the currently available data, the precise role of acyl-CoA synthetases in regulating certain pools of fatty acids as well as their potential impact on fatty acid transport across membranes both remain elusive. In this context, we were intrigued by two linking the disruption of FAA1 in reports [20,21] Candida lipolytica and in S. cerevisiae to a fatty acid secretion phenotype. In the mutant strains described, the control over certain fatty acid pools appeared to be restricted and, fatty acid transport in addition, could also be affected. Because the mutant strains derived in both cases from random mutagenesis experi- ments, constitutions were not unequivocally established and the molecular basis for the phenotype may have been not fully understood. However, if the underlying mechanisms of this pheno- type could be elucidated, such a strain might provide a valuable tool to study the role of distinct acyl-CoA synthetases in regulating certain pools of fatty acids.

S. cerevisiae, five genes coding for acyl-CoA syntheta- ses have been identified. All these activities are poten- tially able to mediate between the pool of free fatty acids and the pool of acyl-CoA molecules. Four genes, termed FAA1 to FAA4 (fatty acid activation), were characterized in pioneering work by Gordon et al. [3– 9]. FAA1 and FAA4 encode acyl-CoA synthetases involved in the activation of imported fatty acids [10]. Although Faa1p represents the major cellular activity, both enzymes display partial redundancy and a lack of either one can be compensated by the activity of the other [6]. Faa1p localizes to the endoplasmic reticulum the plasma membrane and vesicles, whereas (ER), Faa4p is found at the ER as well as at lipid droplets [11]. FAA2 encodes a peroxisomal activity involved in the activation of fatty acids scheduled for b-oxidation whereas the biological role of Faa3p has remained unclear to date. In addition to the four FAA genes, FAT1 was identified as the fifth source of activity feed- ing into the acyl-CoA pool [12]. Initially isolated as a protein involved in fatty acid transport across the it finally proved to have plasma membrane [13,14], acyl-CoA synthetase activity as well, with a preference for fatty acids with chain length longer than 22 car- bons. The protein was localized to lipid droplets and to the ER [11], but was also reported at the plasma membrane [15].

To assess the role of acyl-CoA synthetases in regu- lating particular pools of fatty acids, we used mutants of S. cerevisiae characterized by various combinations of deletions in the corresponding genes. In mutants defective for Faa1p and Faa4p, we observed a tran- sient fatty acid secretion phenotype. We demonstrate fatty acid transport in the absence of any acyl-CoA synthetase activity, and data are presented demonstrat- ing that the direction of transport is dependent on the growth phase of the mutants. In addition, we provide evidence for the hypothesis that Faa1p and Faa4p are involved in the recycling of fatty acids deriving from lipid remodelling processes.

Results

faa1D faa4D mutant cells secrete a large amount of free fatty acids into the medium

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2766

In a first attempt to explore the fatty acid secretion phenotype for the faa1D mutant described earlier by Michinaka et al. [21], we employed the faa1D mutant strain YB497 instead (similar to the other YB strains generously provided by J. I. Gordon) and tested its ability to secrete fatty acids. By contrast to the data presented by Michinaka et al. [21], we were unable to detect even traces of free fatty acids in the culture medium by using this different strain harbouring the same mutation. Because the strains investigated by Given the diverse functions of fatty acids within the metabolism, a carefully regulated distribution of fatty acids within the cell can be anticipated. In this respect, it is of relevance that, besides the pure enzymatic reac- tion, acyl-CoA synthetase activity is also involved in fatty acid transport across membranes. Cellular uptake as well as subcellular distribution of fatty acids could be influenced by this enzymatic activity converting a hydrophobic substrate into a water soluble CoA-ester. It was first established in a mutant of Escherichia coli that a defective acyl-CoA synthetase abolished the uptake of fatty acids from the medium. To emphasize the tight link between fatty acid transport and acyl- CoA synthetase activity, the mechanism was termed ‘vectorial acylation’ [16]. In S. cerevisiae, a comparable model was proposed and evidence was provided for a participation of Fat1p in transport in concert with the two acyl-CoA synthetases Faa1p and Faa4p [17]. In this model, Fat1p is involved in the import mechanism directly, whereas acyl-CoA synthetases Faa1p and Faa4p is proposed to be responsible for the abstraction of the delivered fatty acid from the membrane and concomitantly rendering the fatty acid water soluble by esterification, thereby trapping the molecule in the cytoplasm. On the other hand, the model is not with- out controversy and, alternatively, a concept has been

M. Scharnewski et al.

Fatty acid secretion in mutants of yeast

[21]

supplementary Fig. S1). We conclude from this experi- ment that the deletion of FAA1 and FAA4 is necessary and sufficient to produce the fatty acid secretion phenotype. No other combination of FAA deletions keeping either FAA1 or FAA4 intact resulted in a com- parable phenotype.

To characterize the observed phenotype in more detail, we first determined the progress of fatty acid secretion in a growing culture. Therefore, we measured the concentration of free fatty acids in the media at several time points during the exponential and station- ary growth phases. In these experiments, a tight corre- lation between stage of growth and fatty acid secretion was observed, revealing several striking characteristics (Fig. 1A). First, the total amount of fatty acids in the media increased continuously during early exponential the fatty acid concentration in the phase. Second, media did not reach a stable plateau. Instead, the total amount of fatty acids in the media started to decline during the late exponential phase and continued to decrease during the stationary phase. Third, the point in time of maximum concentration in the media was different for specific fatty acids. Whereas 16:0 reached its maximum concentration at 48 h and subsequently declined, the level of the unsaturated fatty acids 16:1 their maximum concentration until and 18:1 kept approximately 70 h before they also began to decline. Taken together these results clearly identified the growth stage of the culture as being an important parameter influencing the fatty acid secretion pheno- type.

In the next step, the underlying mechanisms were analysed. Whereas export of free fatty acids from the cells during early exponential growth phase most prob- ably explains the accumulation of fatty acids in the media, several alternative models may explain the subsequent decline in fatty acid concentration. One possible interpretation would be a re-import of the ini- tially secreted fatty acids back into the cells. If this assumption is correct, this transport should result in an increase of free fatty acids within the cells because the mutant cells are unable to utilize these fatty acids due to the lack of acyl-CoA synthetase activity. To evaluate this possibility, we measured the concentra- tion of intracellular free fatty acids at the same time points during the exponential and stationary growth phases that had been used for the estimation of the extracellular fatty acids. In addition, we determined the amount of lipid-bound fatty acids to cover all major pools of fatty acids (Fig. 1B,D).

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2767

Michinaka et al. resulted from a repeatedly employed mutagenesis with ethyl-methane sulfonate, the precise genotype of their mutant was not well established. Nevertheless, the data presented appeared to indicate a role of Faa1p in the fatty acid secretion phenotype. Assuming that one of the additional four acyl-CoA synthetases in S. cerevisiae could mask the phenotype by overlapping functions, we assumed that a combined elimination of two or more of those activi- ties might induce fatty acid secretion. Therefore, we tested strains deficient in combinations of FAA1 and one or more additional FAA. The experiments were complicated by the fact that strains carrying deletions in both FAA1 and FAA4 were flocculent in liquid cul- ture, as described previously [10]. This characteristic trait resulted in large cellular lumps swimming in an impossible to essentially clear medium, making it determine the status of the culture by measuring cell density. By testing alternative medium compositions, a YP medium containing raffinose (YPR) instead of dex- trose was identified to allow proper growth as homoge- nous cultures for all strains tested. Because the use of raffinose was essential for the accurate measurement of cell density in different stages of the cultures, this sugar was used as carbon source for all following experiments unless otherwise noted. The different strains were grown for 48 h in YPR before the cells were removed by centrifugation and the supernatant was extracted and tested for free fatty acids. For strains carrying a combined deletion of FAA1 and FAA2 or of FAA1 and FAA3, we did not observe any fatty acid secretion phenotype. However, the combined deletion of FAA1 and FAA4 resulted in the accumula- tion of significant amounts of free fatty acids in the culture medium. Whereas no fatty acids were detected in the media of wild-type cells of 48-h-old cultures, approximately 220 lmolÆL)1 free fatty acids were found in the media of the mutant strain YB525 (see supplementary Fig. S1). To investigate whether the deletion of additional Faap would further increase the amount of secreted fatty acids, we also tested the qua- druple mutant YB526 deficient in four Faap activities. The detected fatty acid concentrations in the media proved to be similar for the double and for the qua- druple mutant, indicating that Faa2p and Faa3p are not significantly involved in the observed phenotype. Surprisingly, the detected amounts of free fatty acids in the media were high enough to result in whitish flakes on the surface of the culture. The composition of the secreted fatty acids reflects the profile of fatty acids found in membrane lipids of yeast and consists of myristic acid (14:0), palmitic acid (16:0), palmitoleic acid (16:1), stearic acid (18:0) and oleic acid (18:1) (see The amount of cellular free fatty acids could be easily affected by lipid hydrolysis during the extraction the possibility that major procedure. To rule out

M. Scharnewski et al.

Fatty acid secretion in mutants of yeast

A

the time points indicated.

(C) Growth curve of

Fig. 1. Relationship between fatty acid concentration and stage of the culture. (A) Extracellular free fatty acids in the culture medium of YB526 were determined at the time points indicated. The bars representing individual fatty acids are indicated as 14:0 (black), 16:0 (dark gray), 16:1 (spotted), 18:0 (hatched), 18:1 (light gray). (B) Time-course of intracellular free fatty acid accumulation. Intracellu- lar free fatty acids accumulated by cells of YB526 were determined at the culture [YB332 (triangle), YB526 (diamonds) and MS51 (square)]. (D) Con- centration of fatty acids in the pools of free fatty acids in the media (diamonds), of free fatty acids in the cells (square) and of esterified fatty acids (triangle). The error bars represent the SEM from three independent experiments.

B

proportions of the detected free fatty acids are result- ing from such effect, we analysed extractions with and without boiling and the results obtained were not sig- nificantly different. Therefore, boiling was omitted in subsequent experiments. To differentiate between free fatty acids and esterified fatty acids, the cellular lipid extracts were subjected to two different protocols to achieve either methylation of free fatty acids or trans- methylation of esterified fatty acids [22,23].

C

fatty acids

D

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2768

The concentration of bound fatty acids at different time points resulted in a typical curve corresponding to the growth of the culture and is independent of the observed changes in the pools of free fatty acids (Fig. 1C,D). For the free fatty acids, the results clearly demonstrated that the decline of fatty acid concentra- tion in the media was indeed paralleled by a constant increase of the concentration of intracellular free fatty acids (Fig. 1D). This could indicate an import of fatty acids into the cells. On the other hand, the increase of in absolute amounts was intracellular approximately three-fold greater than the concomitant decrease of extracellular fatty acids. Therefore, besides the import of exogenous fatty acids, additional release of internal fatty acids had to contribute to the increase of intracellular fatty acids. However, analysis of the previously mentioned fatty acid specificity of the trans- port appeared to provide additional indications for ongoing fatty acid import. As described earlier, the amount of 16:0 specifically decreased strongly in the media between time points 48 h and 65 h ()30.0 lmolÆL)1), whereas the concentration of the other fatty acids in the media changed only moderately during this period ()4.6 to +5.6 lmolÆL)1). Strikingly, it was also 16:0 that increased within the cells during this time interval in a much stronger fashion than any fatty acid (+68.8 lmolÆL)1 versus +3.6 to other +30.3 lmolÆL)1), suggesting re-import of 16:0 into the cell during this growth stage. In summary, the results demonstrated an export of free fatty acids out of the

M. Scharnewski et al.

Fatty acid secretion in mutants of yeast

early exponential growth phase, cells during the whereas the strong increase of intracellular free fatty acids at the late exponential phase is compatible with the hypothesis that the reduction of fatty acid concen- tration in the media is due to a significant re-import of free fatty acids into the cells.

(diamonds), MS51 intracellular

Fig. 2. Total amount of intracellular and extracellular fatty acids of YB526 and MS51. The cells were grown in YPR medium and har- vested at different time points during the exponential and stationary phases. Medium and cells were extracted and the total fatty acid concentrations of the different pools were determined. The fatty (square), acid concentrations are given for YB526 intracellular YB526 extracellular (circle), and MS51 extracellular (triangle). The error bars represent the SEM from three independent experiments.

Fatty acid transport across the plasma membrane is functional in absence of all known acyl-CoA synthetases

The translocation of fatty acids across the plasma membrane in the absence of Faap activity appeared to be in contrast to the model suggesting vectorial acyla- tion as a basis for fatty acid transport [17]. On the other hand, the strains used so far might contain resid- ual acyl-CoA synthetase activity due to the presence of Fat1p, which was shown to possess this enzymatic activity also. To address the question of whether fatty acid transport protein 1 (Fat1p), or even fatty acid transport protein 2 (Fat2p) for which no enzymatic activity has been demonstrated to date, is responsible for the fatty acid transport observed in the previous experiment, we generated knockout deletions of FAT1 and FAT2 in the background of the well established FAA quadruple mutant YB526 [6]. The obtained strains with five (MS51) and six gene deletions (MS612), respectively, are devoid of any detectable acyl-CoA synthetase activity (data not shown). Both strains were subjected to the same measurements of free and bound fatty acids as described for the quadru- ple mutant. The results indicated that the additional gene deletions did not change the capacity of the cells to transport fatty acids. As shown in Fig. 2, the loss of Fat1p resulted in even higher levels of intracellular free fatty acids during the stationary phase. More impor- tantly, the same two phases of early fatty acid export followed by re-import at later stages were observed in exactly the same chronological order as in the quadru- ple mutant. Therefore, it was concluded that cells of S. cerevisiae lacking any cellular acyl-CoA synthetase activity are nevertheless able to transport fatty acids efficiently across the plasma membrane.

Fat1p is responsible for remaining acyl-CoA synthetase activity of strain YB526

the FAA quadruple mutant

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2769

As shown above, the deletion of Fat1p in the back- ground of further increased the concentration of intracellular accumu- lated free fatty acids. This suggested a capacity for Fat1p to access the pool of free fatty acids, most likely via its proven acyl-CoA synthetase activity [12]. Despite in vitro assays for the acyl-CoA synthetase activity of Fat1p showing a strong specificity for very long chain fatty acids [12], our data also appeared to indicate activity against C16 and C18 fatty acids. To test this possibility in vivo, we incubated the different strains with radiolabelled oleic acid. Successful feeding of the exogenous fatty acid into the cellular acyl-CoA pool should result in incorporation of the label in the various lipid classes. Cells of wild-type, YB526, MS51, MS52 and MS612 were grown in YPR to the early sta- tionary phase before radiolabelled oleic acid was added. Following incubation for 24 h, the cellular lipids were extracted and subjected to TLC (Fig. 3). As expected, the lipid extract of wild-type cells showed the label spread to phospholipids and neutral lipids. In comparison, the level of incorporation in YB526 cells was drastically reduced, but the label was still clearly detectable in phospholipids as well as an additional spot tentatively identified by co-migration with lipid standards as fatty acid ethyl ester (Fig. 3). By contrast, there was no longer any incorporation of labelled fatty acids to either phospholipids or TAG if, in addition to the FAA genes, FAT1 was deleted, as shown by the lipid extracts of MS51 and MS612. The combined deletion of all FAA genes and FAT2 in strain MS52, on the other hand, resulted in the same level of incor- poration as in YB526, indicating that Fat2p is not responsible for the remaining capacity to channel exog- enous fatty acids into lipids. Control strains carrying deletions in only FAT1 or FAT2, or in both FAT1 and FAT2, incorporated labelled fatty acids comparable to the wild-type (see supplementary Fig. S2). Surprisingly,

M. Scharnewski et al.

Fatty acid secretion in mutants of yeast

Fig. 3. TLC of lipid extracts of yeast strains fed with radiolabelled oleic acid. Cells of wild-type and the mutants indicated were grown for 24 h in the presence of radiolabelled oleic acid. The cells were lipids were extracted, and these harvested by centrifugation, extracts were separated by solvent A [acetic acid methyl ester ⁄ iso- propanol ⁄ chloroform-methanol ⁄ 0.75% KCl (25 : 25 : 28 : 10 : 7, v ⁄ v)] followed by solvent B (chloroform ⁄ acetone (8 : 2. v ⁄ v) + 1% NH3) on silica plates. Comparison between YB526 and MS51 clearly indicate that Fat1p in YB526 is responsible for the incorpora- tion of exogenous oleate into phospholipids. The band labelled as EE was tentatively identified as fatty acid ethyl esters produced by all strains even in absence of any acyl-CoA synthetase activity. Lipid classes were determined by co-migration of lipid standards and staining with copper sulfate. TAG, triacylglycerol; EE, fatty acid ethyl ester; OA, oleic acid; PC, phosphatidylcholine; PI, phosphati- dyinositol; PS, phosphatidylserine. The figure shows one represen- tative result out of three independent experiments.

these molecules. regarding the metabolic origin of Obviously, acyl-CoA synthetase activity in wild-type cells is masking a permanent internal generation of sig- nificant amounts of free fatty acids. To test whether these fatty acids were derived from lipid turn-over pro- cesses, we aimed to achieve a fatty acid modification that is restricted to lipid bound fatty acids. For this purpose, we introduced a D12 specific lipid desaturase from sunflower into strain MS51. By contrast to the endogenous stearoyl-CoA desaturase, the heterologous D12-desaturase converts exclusively lipid-bound 18:1 to 18:2 [25,26]. Due to the nature of this desaturase, the generated 18:2 was considered as marker for the pool of bound fatty acids. Therefore, the occurrence of 18:2 in the pool of free fatty acids would argue for lipid turnover as the source of fatty acid accumulation. The expression of the D12-desaturase resulted in diminished growth of the yeast cells, causing reduced levels of fatty acids in all pools measured. However, analysis of lipid extracts of the transformed cells demonstrated 18:2 to be a significant constituent of the pool of ester- ified fatty acids, indicating successful expression of the D12-desaturase (Fig. 4A). More interestingly, the pool of free fatty acids contained 18:2 as well; indicating a release of formerly lipid bound fatty acids into this pool (Fig. 4B,C). Moreover, the ratio of the sum of all natural fatty acids of S. cerevisiae (14:0 to 18:1) to the artificially produced 18:2 was almost identical in the fraction of bound fatty acids compared to the fraction of free fatty acids (11.19 and 11.03, respectively; see supplementary Table S1). This constant ratio would be in line with lipid remodelling processes as a source for the accumulated fatty acids in the mutant cells, provided that the release of the fatty acids is rather unspecific.

The direction of fatty acid transport is dependent on the metabolic state of the cells

in raffinose

even in MS51 and MS612, the radioactive label showed up in the spot identified as fatty acid ethyl ester, demonstrating a potential to incorporate free fatty acids into fatty acid ethyl esters in absence of any acyl-CoA synthetase activity. This observation sup- ports a recent description of enzymatic activity found in microsomal preparations from plants and yeast that is able to acylate aliphatic alcohols without prior acti- vation to acyl-thioesters [24]. Irrespective of this side reaction, the labelling experiments identified Fat1p as the remaining acyl-CoA synthetase activity in the strain YB526 that is able to activate imported fatty acids prior to their incorporation into phospholipids.

The accumulated free fatty acids derive from lipid remodelling processes

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2770

The strong accumulation of free fatty acids in the media and within the mutant cells raised questions To gain further insight into the correlation of growth phase of the culture and the direction of fatty acid transport, we investigated the possibility of manipulat- ing the transport by changing the medium conditions of the growing culture. Therefore, we grew cells as described above containing medium. Approximately 3 h after the cultures reached the sta- tionary phase and the cells already started to re-import fatty acids from the media, we again fed raffinose to the cultures (Fig. 5A–C). In controls, water was added to the cells. As expected, the culture fed with raffinose started to grow again indicated by increasing attenu- ance (data not shown). We then analyzed the amount of fatty acids in the medium and inside the cells.

M. Scharnewski et al.

Fatty acid secretion in mutants of yeast

A

A

B

B

C

C

Fig. 5. Feeding of raffinose to MS51 cells in stationary phase. Total fatty acid concentration in different pools was measured in cultures fed with raffinose (diamonds) at time point 65 h (arrows) during the stationary phase (A–C). As a control, the same amount of water was added to separate cultures (square). (A) Free fatty acids inside the cells. (B) Free fatty acids in the medium. (C) Esterified fatty acids. The error bars represent the SEM from three independent experiments.

Fig. 4. Profile of free and esterified fatty acids upon expression of D12-desaturase in MS51. Cells of strain MS51 expressing a D12- desaturase of sunflower were grown for 70 h in minimal media before the cells were harvested and lipids were extracted. The dif- ferent pools of fatty acids were analyzed and presented as: (A) intracellular esterified fatty acids; (B) intracellular free fatty acids; (C) extracellular free fatty acids. As a control, cells transformed with empty vector were extracted. The bars representing individual fatty acids are depicted as 14:0 (dark gray), 16:0 (hatched), 16:1 (gray), 18:0 (spotted), 18:1 (light gray), 18:2 (black). The error bars represent the SEM from three independent experiments.

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2771

acids were secreted by the cells (Fig. 5B). At the same time, the concentration of the total esterified fatty acids remained constant (Fig. 5C). To allow for simple comparison, the amount of fatty acids in the medium prior to the addition of either water or of raffinose was set as 100%. In control experiments, we observed Surprisingly, the accumulation of free fatty acids inside the cells stopped immediately after adding raffinose (Fig. 5A). Simultaneously, large quantities of free fatty

M. Scharnewski et al.

Fatty acid secretion in mutants of yeast

A

B

a decrease of free fatty acids in the medium by 25% within 30 h. This decrease is accompanied by an increase of cellular free fatty acids partly due to re-import, as described earlier. By contrast, the the free fatty acids in the medium of amount of cultures fed with raffinose increased by 100% within 30 h after adding the raffinose. The supply of raffinose allowed the cells, on the other hand, to maintain the concentration of free fatty acids inside the cells at a constant level. When the supply of raffinose was finally exhausted, after approximately 95 h of the experiment, the cells again started to re-import fatty acids from the medium and to accumulate these fatty acids intra- cellularly in even higher amounts than in the control culture. From these results, it was concluded that the direction of transport was reversible and that it was regulated by the metabolic state of the cells.

Cytological features of MS51

C

apposed the to

D

Fig. 6. Electron microscopic analysis of cells of wild-type and MS51 in stationary phase. Overview of wild-type (A) and mutant cells (B,C). In wild-type cells, the ER lumen is inconspicuous, ER lumen in mutant cells appears to be dilated; the ER is marked by arrows. The ER lumen appears darker than the cytoplasm (C,D) and is filled with dark stained, laminated material. (D) A detail of (C) is shown at higher magnification.

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2772

During the stationary phase of the culture, the concen- tration of free fatty acids found in the mutant cells was up to 50-fold greater than that observed in wild- type cells. High concentrations of free fatty acids are believed to be rather unfavourable to cells due to their the mutant cells detergent character. Nevertheless, were not only viable, but also showed only minor dif- ferences in their growth behaviour compared to wild- type. To investigate whether the level of free fatty acids might have observable consequences for the cell, we inspected the subcellular morphology by electron microscopy. Whereas most organelles, the cytoplasm and the plasma membrane showed no obvious anom- aly, we observed a strikingly enlarged ER in the mutant cells (Fig. 6). The mutant cells were pervaded by strands of ER with conspicuously dilated lumen. This is especially apparent in the cortical ER, which is cytoplasmic membrane closely (Fig. 6C,D). The lumen appears darker than the cyto- plasm (Fig. 6B–D) and is filled with dark stained, lam- inated material. This striking phenotype was observed in all mutant cells inspected, whereas it was never found in wild-type cells. To a moderate extent, the dilated ER-phenotype was visible already in cells har- vested during the exponential phase but it became

M. Scharnewski et al.

Fatty acid secretion in mutants of yeast

drastically enhanced in cells harvested from stationary phase (see supplementary Fig. S3). Therefore, the severity of the symptoms appeared to correlate directly with the level of accumulated free fatty acids. This observation might suggest that the mutant cells are able to deposit excess of free fatty acids specifically in the ER, thereby excluding an excess of free fatty acids from other cellular compartments.

Discussion

tant for fatty acid import in S. cerevisiae [27], the transport processes of fatty acid export and re-import observed in the present study were essentially indepen- dent of this previously described activity. Instead, our results for Fat1p suggest partly overlapping functions with Faa1p and Faa4p with respect to the capacity to channel released fatty acids back into lipids. This was demonstrated not only by the increased amounts of accumulated free fatty acids in the fivefold mutant MS51, but also by feeding experiments with radiola- belled fatty acids. On the other hand, the activity of Fat1p alone was not strong enough to prevent the secretion of fatty acids upon combined deletion of FAA1 and FAA4.

The present study was designed to improve our under- standing of acyl-CoA synthetase activity on different pools of fatty acids in S. cerevisiae. The experiments were initiated by data showing a fatty acid secretion phenotype for different yeast cells deficient of Faa1p [20,21]. Despite not verifying the fatty acid secretion strains of S. cerevisiae deficient of phenotype for Faa1p alone [21], we did observe fatty acid secretion in strains deficient not only in Faa1p, but also in Faa4p. Because the faa1D mutant strain employed in the previous study [21] was isolated by a screen involv- ing two independent rounds of mutagenesis with ethyl- methane sulfonate, one possible explanation for the observed phenotype would be an unidentified addi- tional mutation in FAA4 resulting in a faa1D faa4D genotype for the strain finally described. The fatty acid secretion phenotype observed in the present study indi- cated that the presence of either Faa1p or Faa4p is necessary during exponential growth to keep endoge- nous free fatty acids inside the cell. During the station- ary phase, we then observed a re-import of those fatty acids previously secreted during the exponential growth phase. This re-import finally resulted in a ratio of approximately 10 : 1 of free fatty acids to esterified fatty acids in the mutant cells, whereas this ratio was approximately 1 : 20 in wild-type cells. The fatty acid secretion and re-import was observed not only in the faa1D faa4D double mutant, but also in the strains YB526, MS51 and MS612, indicating fatty acid uptake even in the absence of any cellular acyl-CoA synthetase activity. Surprisingly, the direction of transport proved to be reversible. Upon addition of raffinose to cells in the stationary growth phase, the import of fatty acids stopped immediately and export was again initiated. The fast response resulting in an instantaneous rever- sion of the direction of net transport strongly argues for an active mechanism to achieve fatty acid export. To allow for speculation about the biological role of the release of fatty acids, it was essential to gain infor- their precise metabolic origin. By mation about expressing a lipid specific D12-desaturase from sun- flower in the five-fold mutant MS51, we obtained data supporting the hypothesis that the majority of the secreted fatty acids were released from phospholipids. The reasons for this release are not clear yet, but it appears to be legitimate to assume that lipid remodel- ling processes are involved that ensure continuous adaptation of membrane parameters to cellular needs. Initial evidence for prominent lipid remodelling was obtained from analyses of the fatty acid composition of different lipid classes described as molecular species. Despite the fact that the biosynthesis of each different phospholipid class involves common precursors, strong differences in the molecular species were detected [28]. To establish distinct molecular species, a system involving sequential deacylation by phospholipases and reacylation by acyltransferases was proposed [29]. Lipid labelling experiments strongly supported this model for S. cerevisiae [28] and the results obtained from studies with rat hepatocytes provided information suggesting, for phosphatidylcholine and phosphatidyl- ethanolamine, a similar rate of de novo synthesis and of remodelling activities [30]. Taken together, these data indicate lipid remodelling as a quantitatively important process, which probably is responsible for the establishment of distinct molecular species of cer- tain lipid classes. In this respect, the free fatty acids observed in the present study are most likely the result of interrupted lipid remodelling processes. Conse- quently, we propose the activation of endogenous free fatty acids produced within this recycling mechanism as a most important role for Faa1p and Faa4p.

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2773

It is important to note that the additional deletion of FAT1 did not change the biphasic mode of fatty acid transport but it did further increase the amount of accumulated free fatty acids. Whereas convincing data had been presented showing that Fat1p is impor- Although being metabolically inaccessible to the mutant cells, the re-import of the released free fatty acids during stationary phase finally resulted in the free fatty acids large amounts of accumulation of

M. Scharnewski et al.

Fatty acid secretion in mutants of yeast

on accumulation least

In addition, a comparison of

in transport might fit

endoplasmic towards the

inside the cells. By electron microscopy, the effect of this cellular morphology was inspected and diagnosed as a severe phenotype of the ER. To our knowledge, similar structures of the ER have not been described previously. Because the strength of the phenotype corresponded to the level of accumulated free fatty acids, it is fair to assume that the free fatty acids themselves account for the dark stained dilated lumen of the ER. How the free fatty acids are organized in these structures is currently unknown. The accumulation of free fatty acids result- ing in electron-dense material has recently been described in lipid bodies of pex5D cells that are unable to degrade fatty acids by b-oxidation [31]. The observed structures were termed gnarls and it was speculated that they could represent self assembled fatty acid structures. Different to the conspicuous ER phenotype of the faaD mutant cells, the gnarls were of a delicate nature and visible only upon permanganate staining [31]. This might reflect the significantly lower amount of free fatty acids in cells containing gnarls compared to cells described in the present study. Given the significant concentrations of free fatty acids, it was, nevertheless, remarkable to note that the morpho- logical changes were limited to the ER, whereas the plasma membrane or membranes of other organelles were essentially unaffected. This selectivity appeared to rule out passive dissolving of fatty acids into the lipo- philic phase of membranes in general, but rather indi- cates specific channelling to the ER. Such targeted intracellular transport of free fatty acids strongly sug- gests the existence of an active and most likely protein mediated process. investigations. Initially, the cells in the previous studies were taken from cultures in the exponential growth phase. During this stage, we showed, at for mutants deficient of Faa1p and Faa4p, a phenotype of active fatty acid secretion obviously causing conflict with simultaneous fatty acid import. By contrast, the strong capacity to import fatty acids in our experi- ments was observed for mutant cells in the stationary the results phase. obtained by uptake assays with C1-BODIPY-C12 [10,27] to those of the present study revealed the time scale as being another important difference. The fatty acid uptake described in the present study is a rather slow process, observed over hours during the station- ary phase, whereas the uptake involving acyl-CoA synthetase was measured with a fluorescent fatty acid analogue in the range of 60 s. Nevertheless, the two different velocities into a common model describing the removal of fatty acids from the inner leaflet of the membrane by two differ- ent active components. On the one hand, acyl-CoA synthetase activities were shown to make a contribu- tion. On the other hand, a targeted channelling of free fatty acids from the inner leaflet of the plasma mem- brane reticulum could provide an alternative mechanism for removing free fatty acids from the membrane. This alternative removal system might be less efficient and result in a slower net transfer across the membrane. On the other hand, the proposed model is able to balance the results obtained in the present study with the model of vecto- rial acylation and would also reconcile previous results from other studies showing fatty acid transport in the absence of acyl-CoA synthetase activity [8,32].

Experimental procedures

The yeast strains used are shown in the supplementary (Table S2). YPR consisted of 1% yeast extract, 2% peptone and 2% raffinose. Yeast proteose dextrose medium con- sisted of 1% yeast extract, 2% peptone and 2% dextrose. Yeast supplemented minimal media contained 0.67% yeast nitrogen base, 2% raffinose, amino acid content according to Brent Supplement Mixture Dropout Powder (MP Biomedicals, LCC, Illkirch, France) (1.16 gÆL)1). 2% agar was added for solid media.

Yeast strains and media

Yeast cultures were grown for 18 h in YPR and diluted until D600 of 0.02 was reached in triplicate in flasks contain-

Cell growth

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2774

Taken together, the data obtained so far clearly demonstrate fatty acid uptake into the cell in the absence of any cellular acyl-CoA synthetase activity. Therefore, the observed fatty acid transport and acti- vation are not coupled but rather are separate tasks that are independent of each other. These results appear to be in contradiction to the model of vectorial acylation postulating acyl-CoA synthetase activity as a prerequisite of fatty acid import. In this model, it was suggested that fatty acids might be removed from the inner leaflet of the plasma membrane by acyl-CoA synthetase activities releasing acyl-CoA into the cyto- plasm, thereby giving space for newly incoming fatty acids. The model was based on a complete set of experiments showing severely diminished capacity of the strains faa1Dfaa4D and fat1D to metabolize exo- genous fatty acids [10,27]. The results obtained were interpreted as consequence of impeded fatty acid trans- port. The crucial question is why these experiments failed to detect the transport that we observed in our

M. Scharnewski et al.

Fatty acid secretion in mutants of yeast

ing 100 mL of YPR. The cells were grown at 30 (cid:2)C and harvested at time points specified. Cell growth was moni- tored by D600. Cells were harvested by centrifugation and the cell pellet was resuspended in water to achieve appro- priate densities (D600 in the range 0.1–0.8).

Lipid analytical methods

Yeast cell pellet and supernatant were transferred to 10 mL glass tubes with glass-stop corks. The cell pellet was resus- pended in 1 mL of distilled water and glass beads (425– 600 lm) were added to break the cells. Intracellular and extracellular lipid extractions were performed using hepta- decanoic acid (17:0) as internal standard for free fatty acids (1 lg for wild-type and 10 lg for mutant cells) and trihep- tadecanoylglycerol as internal standard for esterified fatty acid (10 lg) [36].

Free fatty acids from intracellular and extracellular lipid extracts were methylated according to a modified protocol described previously [22]. In brief, the lipid extract (50 lL) was transferred to a new glass tube and dried under a stream of nitrogen. Methanol (400 lL) was added together with 10 lL of 1-ethyl-3-(3-dimethylaminopropylcarbodii- mide) (0.1 mgÆlL)1 in methanol) and incubated for 2 h at 22 (cid:2)C. The reaction was stopped by adding 200 lL of satu- rated NaCl solution. The methyl esters of free fatty acids were extracted with 1 mL of hexane followed by centrifuga- tion at 200 g for 2 min. The upper hexane phase was trans- ferred to a 1.5 mL microcentrifuge tube, dried and resuspended in acetonitrile (10 lL) and analyzed by gas chromatography.

Gene deletions were carried out by a PCR-based deletion strategy, as previously described [33]. Within the present study, two genes were targeted for deletion: FAT1 and FAT2, coding for Fat1p and Fat2p, respectively. These genes were deleted in the strain YB526 already deficient of all four FAA genes [6]. For the deletion of FAT1, the kan- MX4 cassette was used as selection marker. The resulting strain was termed MS51. For deletion of FAT2, the hygro- mycin phosphotransferase under control of translation elon- gation factor EF-1a promoter and cytochrome C (CYC1) terminator from S. cerevisiae was employed. The strain lacking FAT1 as well as FAT2 was designated as MS612. The deletion cassettes were transformed into the cells using a modified version of the protocol described previously [34]. Primers used for deletion of FAT1: FAT1forward, ATTCTATATCTGTGAACTTTTAATAGGCTGCGAAT ACCGACTATGCGTACGCTGCAGGTCGAC; FAT1- reverse, CATCCAAACCCTTTGGTAATTTTTGCTCTCT ATAAACCTTCTTCAATCGATGAATTCGAGCTCG.

Primers used for deletion of FAT2: FAT2forward, GTGCTGCAAGAGGTTAGACGCTTCACGCACATTTT TGCTACAATGCGTACGCTGCAGGTCGAC; FAT2- reverse, GATAGAAGCTTTCAGAGAGCATAAAATTGT ACAGGATACTGCCTAATCGATGAATTCGAGCTCG.

Mutagenesis

Esterified fatty acids from intracellular lipid extracts were transmethylated according to a modified protocol described previously [23]. Lipid extract (50 lL) was transferred to a 2 mL microcentrifuge tube and dried under a stream of nitrogen. 333 lL methanol ⁄ toluene (1 : 1, v ⁄ v) and 167 lL 0.5 m sodium methoxide were added and left at 22 (cid:2)C. After 20 min, the reaction was stopped by adding 500 lL of 1 m NaCl and 50 lL of 32% hydrochloric acid. The methyl esters of free fatty acids were extracted with 1 mL of hexane followed by centrifugation at 2300 g for 2 min. The upper hexane phase was transferred to a new 1.5 mL microcentrifuge tube, dried and resuspended in acetonitrile (10 lL). The fatty acid methyl esters were analyzed by gas chromatography using an Agilent 6890 series gas chromato- graph equipped with a capillary DB-23 column (Agilent Technologies, Waldbronn, Germany).

Expression of D12-desaturase and fatty acid isomerase

FAD2-1 from sun flower encoding a D12-desaturase cloned in pYES2 was generously provided by J. M. Martinez- Rivas [35] and was transformed into MS51. Transformed yeast cells were grown for 18 h in synthetic complete med- ium (2% raffinose) and diluted until D600 of 0.3 was reached in duplicate in flasks containing 20 mL of synthetic complete medium (2% galactose). The cell suspension was harvested at 72 h and subjected to lipid extraction.

Lipid labelling using radiolabelled oleic acid

Yeast strains were grown for 18 h in YPR and diluted to until D600 of 0.03 was reached in a flask containing 20 mL of YPR. After dilution, yeast strains were grown to late exponential stage (48 h). Aliquots (4 mL) were transferred to 10 mL flasks in duplicate prior to addition of 0.27 lCi 14C-18:1 (Amersham Biosciences, Bucks, UK) (5 nmol). The specific activity of the 14C oleic acid was 56 mCiÆ mmol)1. After 24 h of incubation, a 3 mL cell suspension was collected and cells were harvested by centrifugation and subjected to lipid extraction. Lipid extracts were

Yeast cells suspension (2 mL) was collected at the time points specified. Cells and extracellular fraction were separated by centrifugation at 1500 g for 3 min. Extracellular fraction or supernatant (1 mL) was transferred to a new 2 mL micro- the supernatant was centrifuge tube. The remainder of discarded. The cell pellet was washed once with water.

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2775

Preparation of yeast cells and extracellular fraction

M. Scharnewski et al.

Fatty acid secretion in mutants of yeast

Helianthus annuus L. This work was supported in part by grant DFG FU430 ⁄ 2-3.

References

1 Schweizer E & Hofmann J (2004) Microbial type I

separated by TLC in a single dimension using methylace- tate ⁄ isopropyl alcohol ⁄ chloroform ⁄ methanol ⁄ 0.25% KCl (25 : 25 : 28 : 10 : 7, v ⁄ v) as solvent. Neutral lipids and free fatty acids were separated using chloroform ⁄ acetone (8 : 2, v ⁄ v) and 1% NH3 as second solvent. Lipid standards were included on each TLC plate. Radiolabelled lipids were visu- alized by fluorography.

fatty acid synthases (FAS): major players in a network of cellular FAS systems. Microbiol Mol Biol Rev 68, 501–517.

2 Schweizer E, Lerch I, Kroeplin-Rueff L & Lynen F

(1970) Fatty acyl transferase. Characterization of the enzyme as part of the yeast fatty acid synthetase complex by the use of radioactively labeled coenzyme A. Eur J Biochem 15, 472–482.

The strain MS51 was grown for 18 h in YPR and diluted until D600 of 0.02 was reached in flasks containing 100 mL of YPR. The cells were grown at 30 (cid:2)C to early stationary phase before 2% raffinose (or the same volume H2O as control) was added to the culture. Subsequently, the cells were harvested at specified time points. The experiment was performed in duplicate.

Raffinose feeding to cells in stationary phase

3 Duronio RJ, Knoll LJ & Gordon JI (1992) Isolation of a Saccharomyces cerevisiae long chain fatty acyl:CoA synthetase gene (FAA1) and assessment of its role in protein N-myristoylation. J Cell Biol 117, 515–529. 4 Knoll LJ & Gordon JI (1993) Use of Escherichia coli strains containing fad mutations plus a triple plasmid expression system to study the import of myristate, its activation by Saccharomyces cerevisiae acyl-CoA synthetase, and its utilization by S. cerevisiae myristoyl- CoA:protein N-myristoyltransferase. J Biol Chem 268, 4281–4290.

5 Knoll LJ, Johnson DR & Gordon JI (1994) Biochemi- cal studies of three Saccharomyces cerevisiae acyl-CoA synthetases, Faa1p, Faa2p, and Faa3p. J Biol Chem 269, 16348–16356.

6 Johnson DR, Knoll LJ, Levin DE & Gordon JI (1994b) Saccharomyces cerevisiae contains four fatty acid acti- vation (FAA) genes: an assessment of their role in regu- lating protein N-myristoylation and cellular lipid metabolism. J Cell Biol 127, 751–762.

7 Johnson DR, Knoll LJ, Rowley N & Gordon JI

(1994a) Genetic analysis of the role of Saccharomyces cerevisiae acyl-CoA synthetase genes in regulating pro- tein N-myristoylation. J Biol Chem 269, 18037–18046. 8 Knoll LJ, Johnson DR & Gordon JI (1995a) Comple- mentation of Saccharomyces cerevisiae strains contain- ing fatty acid activation gene (FAA) deletions with a mammalian acyl-CoA synthetase. J Biol Chem 270, 10861–10867.

9 Knoll LJ, Schall OF, Suzuki I, Gokel GW & Gordon

Yeast cells were grown in YPR medium. Samples were removed during the exponential and stationary growth phases and the cells were harvested by centrifugation at 5000 g for 10 min. The pellet was then resuspended in 50 mm potassium phosphate buffer, chemically fixed in 0.5% (w ⁄ v) formaldehyde and 0.3% (w ⁄ v) glutardialde- hyde solution for 90 min at 0 (cid:2)C. Cells were then washed by two rounds of centrifugation and resuspension in potassium phosphate buffer. A 100 lL portion of a resus- pended cell pellet was embedded in 1.5% (w ⁄ v) molten to agar (final concentration). The agar block was cut small pieces of 1 mm3 volume, and the pieces were then dehydrated in a graded methanol series (15%, v ⁄ v, 30% for 15 min; 50%, 75%, 95% for 30 min; 100% for 1 h) under concomitant temperature reduction to )40 (cid:2)C. The samples were infiltrated with Lowicryl K4M resin (Sigma, Heidelberg, Germany) in methanol for 1 h; (50%, v ⁄ v, 66%, v ⁄ v, for 2 h;100% for 10 h), then polymerized for 24 h at –40 (cid:2)C and for 3 days at 22 (cid:2)C [37,38]. Resin sec- tions of 80–100 nm in thickness were cut with glass kni- ves, mounted on formvar-coated specimen grids and stained with 3% (w ⁄ v) phosphotungstic acid (pH 7.0). Electron microscopy was performed in a Philips EM 301 transmission electron microscope (Philips, Eindhoven, the Netherlands) at 80 kV and calibrated magnifications.

Electron microscopy

Acknowledgements

JI (1995b) Comparison of the reactivity of tetradecenoic acids, a triacsin, and unsaturated oximes with four purified Saccharomyces cerevisiae fatty acid activation proteins. J Biol Chem 270, 20090–20097.

10 Faergeman NJ, Black PN, Zhao XD, Knudsen J &

DiRusso CC (2001) The Acyl-CoA synthetases encoded within FAA1 and FAA4 in Saccharomyces cerevisiae function as components of the fatty acid transport system linking import, activation, and intracellular utili- zation. J Biol Chem 276, 37051–37059.

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2776

We thank Jeffery I. Gordon for generously providing yeast strains and Ingo Heilmann and Ivo Feussner for critical reading of this manuscript. We obtained cas- settes for disruptional mutations from EUROSCARF (Frankfurt, Germany). We thank Jose´ Martinez-Rivas for the plasmid encoding the desaturase FAD2-1 of

M. Scharnewski et al.

Fatty acid secretion in mutants of yeast

11 Natter K, Leitner P, Faschinger A, Wolinski H,

23 Christie WW (1982) A simple procedure for rapid trans-

methylation of glycerolipids and cholesteryl esters. J Lipid Res 23, 1072–1075.

McCraith S, Fields S & Kohlwein SD (2005) The spa- tial organization of lipid synthesis in the yeast Saccha- romyces cerevisiae derived from large scale green fluorescent protein tagging and high resolution micros- copy. Mol Cell Proteomics 4, 662–672.

24 Neal A, Banas A, Banas W, Stahl U, Carlsson AS & Stymne S (2006) Microsomal preparations from plant and yeast acylate free fatty acids without prior activa- tion to acyl-thioesters. Biochim Biophys Acta 1761, 757– 764.

25 Browse J, Roughan PG & Slack CR (1981) Light con- trol of fatty acid synthesis and diurnal fluctuations of fatty acid composition in leaves. Biochem J 196, 347– 354.

12 Watkins PA, Lu JF, Steinberg SJ, Gould SJ, Smith KD & Braiterman LT (1998) Disruption of the Saccharomy- ces cerevisiae FAT1 gene decreases very long-chain fatty acyl-CoA synthetase activity and elevates intracellular very long-chain fatty acid concentrations. J Biol Chem 273, 18210–18219.

26 Slack CR, Roughan PG & Terpstra J (1976) Some properties of a microsomal oleate desaturase from leaves. Biochem J 155, 71–80.

13 Schaffer JE & Lodish HF (1994) Expression cloning and characterization of a novel adipocyte long chain fatty acid transport protein. Cell 79, 427–436.

27 DiRusso CC, Connell EJ, Faergeman NJ, Knudsen J,

Hansen JK & Black PN (2000) Murine FATP alleviates growth and biochemical deficiencies of yeast fat1Delta strains. Eur J Biochem 267, 4422–4433.

28 Wagner S & Paltauf F (1994) Generation of glycero-

14 Faergeman NJ, DiRusso CC, Elberger A, Knudsen J & Black PN (1997) Disruption of the Saccharomyces cerevisiae homologue to the murine fatty acid transport protein impairs uptake and growth on long-chain fatty acids. J Biol Chem 272, 8531–8538.

15 Obermeyer T, Fraisl P, DiRusso CC & Black PN

phospholipid molecular species in the yeast Saccharomy- ces cerevisiae. Fatty acid pattern of phospholipid classes and selective acyl turnover at sn-1 and sn-2 positions. Yeast 10, 1429–1437.

29 Lands WEM & Crawford CG (1976) Enzymes of

(2007) Topology of the yeast fatty acid transport pro- tein Fat1p: mechanistic implications for functional domains on the cytosolic surface of the plasma mem- brane. J Lipid Res 48, 2354–2364.

membrane phospholipid metabolism. In The Enzymes of Biological Membranes (Martonosi AN, ed), pp. 3–85. Plenum Press, New York, NY.

30 Schmid PC, Deli E & Schmid HH (1995) Generation

16 Overath P, Pauli G & Schairer HU (1969) Fatty acid degradation in Escherichia coli. An inducible acyl- CoA synthetase, the mapping of old mutants, and the isolation of regulatory mutants. Eur J Biochem 7, 559–574.

17 Zou Z, Tong F, Faergeman NJ, Borsting C, Black PN & DiRusso CC (2003) Vectorial acylation in Saccharo- myces cerevisiae. Fat1p and fatty acyl-CoA synthetase are interacting components of a fatty acid import complex. J Biol Chem 278, 16414–16422.

and remodeling of phospholipid molecular species in rat hepatocytes. Arch Biochem Biophys 319, 168–176. 31 Binns D, Januszewski T, Chen Y, Hill J, Markin VS, Zhao Y, Gilpin C, Chapman KD, Anderson RG & Goodman JM (2006) An intimate collaboration between peroxisomes and lipid bodies. J Cell Biol 173, 719–731. 32 Blobel F & Erdmann R (1996) Identification of a yeast peroxisomal member of the family of AMP-binding proteins. Eur J Biochem 240, 468–476.

33 Wach A, Brachat A, Pohlmann R & Philippsen P

18 Hamilton JA, Guo W & Kamp F (2002) Mechanism of cellular uptake of long-chain fatty acids: do we need cellular proteins? Mol Cell Biochem 239, 17–23. 19 Kamp F & Hamilton JA (2006) How fatty acids of different chain length enter and leave cells by free diffusion. Prostaglandins Leukot Essent Fatty Acids 75, 149–159.

(1994) New heterologous modules for classical or PCR- based gene disruptions in Saccharomyces cerevisiae. Yeast 10, 1793–1808.

34 Ito H, Fukuda Y, Murata K & Kimura A (1983)

20 Miyakawa T, Nakajima H, Hamada K, Tsuchiya E,

Transformation of intact yeast cells treated with alkali cations. J Bacteriol 153, 163–168.

35 Martinez-Rivas JM, Sperling P, Luehs W & Heinz E

Kamityo K & Fukui S (1984) Isolation and character- ization of a mutant of Candida lipolytica which excretes long-chain fatty acids. Agric Biol Chem 48, 499–503.

21 Michinaka Y, Shimauchi T, Aki T, Nakajima T,

(2001) Spatial and temporal regulation of three different microsomal oleate desaturase genes (FAD2) from nor- mal-type and high-oleic varieties of sunflower (Helian- thus annuus L.). Mol Breeding 8, 159–168.

36 Bligh EG & Dyer WJ (1959) A rapid method of total

Kawamoto S, Shigeta S, Suzuki O & Ono K (2003) Extracellular secretion of free fatty acids by disruption of a fatty acyl-CoA synthetase gene in Saccharomyces cerevisiae. J Biosci Bioeng 95, 435–440.

lipid extraction and purification. Can J Biochem Physiol 37, 911–917.

37 Roth J, Bendayan M, Carlemalm E, Vilinger W & Garavito M (1981) Enhancement of structural

22 Stumpe M, Kandzia R, Gobel C, Rosahl S & Feussner I (2001) A pathogen-inducible divinyl ether synthase (CYP74D) from elicitor-treated potato suspension cells. FEBS Lett 507, 371–376.

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2777

M. Scharnewski et al.

Fatty acid secretion in mutants of yeast

preservation and immunocytochemical staining in low temperature embedded pancreatic tissue. J Histochem Cytochem 29, 663–671.

38 Hoppert M & Holzenburg A (1998) Electron Micros-

copy in Microbiology. Bios Scientific Publishers (Bios-Springer), New York, NY.

Fig. S3. Electron microscopic analysis of MS51 cells in the exponential phase. Table S1. Ratio of the sum of natural fatty acids to 18:2 produced by the expression of a D12-desaturase of sunflower. Table S2. Yeast strains used in this study. This material is available as part of the online article from http://www.blackwell-synergy.com

Supplementary material

is available

Please note: Blackwell Publishing are not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the corre- sponding author for the article.

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

2778

The following supplementary material online: Fig. S1. Secretion of free fatty acids of FAA-deficient cells. Fig. S2. TLC of lipid extracts of yeast strains fed with radiolabelled oleic acid.