Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA

Unusual metal specificity and structure of the group I ribozyme from Chlamydomonas reinhardtii 23S rRNA Tai-Chih Kuo1, Obed W. Odom2 and David L. Herrin2

1 Department of Biochemistry, Tapei Medical University, Taiwan 2 Section of Molecular Cell and Developmental Biology and Institute for Cellular and Molecular Biology, University of Texas, Austin, TX, USA

Keywords Fe2+–EDTA; group I intron; Mn2+; RNA structure; RNA–metal interactions

Correspondence D. L. Herrin, Section of Molecular Cell and Developmental Biology, 1 University Station A6700, University of Texas at Austin, Austin, TX 78712, USA Fax: +1 512 4713843 Tel: +1 512 4713843 E-mail: herrin@mail.utexas.edu Website: http://www.biosci.utexas.edu/ MCDB/

(Received 9 February 2006, revised 3 April 2006, accepted 12 April 2006)

doi:10.1111/j.1742-4658.2006.05280.x

Group I intron ribozymes require cations for folding and catalysis, and the current literature indicates that a number of cations can promote folding, but only Mg2+ and Mn2+ support both processes. However, some group I introns are active only with Mg2+, e.g. three of the five group I introns in Chlamydomonas reinhardtii. We have investigated one of these ribozymes, an intron from the 23S LSU rRNA gene of Chlamydomonas reinhardtii (Cr.LSU), by determining if the inhibition by Mn2+ involves catalysis, folding, or both. Kinetic analysis of guanosine-dependent cleavage by a Cr.LSU ribozyme, 23S.5DGb, that lacks the 3¢ exon and intron-terminal G shows that Mn2+ does not affect guanosine binding or catalysis, but instead promotes misfolding of the ribozyme. Surprisingly, ribozyme mis- folding induced by Mn2+ is highly cooperative, with a Hill coefficient larger than that of native folding induced by Mg2+. At lower Mn2+ concentrations, metal inhibition is largely alleviated by the guanosine cosubstrate (GMP). The concentration dependence of guanosine cosub- strate-induced folding suggests that it functions by interacting with the G binding site, perhaps by displacing an inhibitory Mn2+. Because of these and other properties of Cr.LSU, the tertiary structure of the intron from 23S.5DGb was examined using Fe2+-EDTA cleavage. The ground-state structure shows evidence of an unusually open ribozyme core: the catalytic P3–P7 domain and the nucleotides that connect it to the P4–P5–P6 domain are exposed to solvent. The implications of this structure for the in vitro and in vivo properties of this intron ribozyme are discussed.

introns have

group I ribozymes, but especially the intron from the large rRNA gene of Tetrahymena thermophila (Tt.LSU), indicate that some domains are modular, and that the catalytic site is buried inside the folded ribozyme [5–7]. The tertiary structure is stabilized by domain–domain interactions, such as hydrogen bond- ing of loop–receptor pairs, base triples, and pseudo- knots [1,2].

Group I introns are cis-acting ribozymes whose sub- strates (5¢ and 3¢ splice sites) are attached intramolecu- larly. These conserved uridine and guanosine nucleotides at the ends of the 5¢ exon and intron segments, respectively. Although sequence con- servation of group I introns is poor, their folded forms share a common core structure composed of two stacked-helix domains (P5–P4–P6 and P7–P3–P8) [1,2]. Group I introns can be differentiated into five major subgroups (IA, IB, IC, ID, and IE) with further subdi- visions that depend on the presence of peripheral domains that stabilize the core [3,4]. Studies of several

The group I self-splicing pathway consists of two consecutive transesterification reactions with the acti- vated phosphodiesters at the splice sites. First, the 3¢-OH of an exogenous guanosine nucleotide (GTP)

Abbreviations Cr.LSU, intron from the 23S LSU rRNA gene of Chlamydomonas reinhardtii; oligo, oligodeoxynucleotide; Tt.LSU, intron from the large rRNA gene of Tetrahymena thermophila.

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2631

T.-C. Kuo et al.

Mn2+ inhibition and structure of Cr.LSU ribozyme

attacks the 5¢ splice site (G-dependent cleavage), gener- ating 5¢ exon and intron-3¢ exon intermediates. Then, the 3¢-OH of the 5¢ exon attacks the 3¢ splice site, forming ligated exons and a free intron [9]. The liber- ated intron can react with itself, forming a circular RNA [9], or with another RNA [10], via the 3¢-ter- minal G (XG) of the intron; it can attack a phosphodi- ester that becomes properly positioned in the catalytic center [9,10].

We wished to know whether Mn2+ inhibits the for- mation of active Cr.LSU or whether it interferes with catalysis, and have addressed this question using ribo- zyme kinetics. We also wanted to probe the folding and tertiary structure of the ribozyme using Fe2+- EDTA, which promotes cleavage of the sugar–phos- phate backbone, and can determine, for example, if the active site of Cr.LSU is internalized like those of other group I ribozymes [7,31]. The wild-type Cr.LSU intron was unsuitable for this, because of its large size (888 nucleotides). Moreover, high concentrations of + and Mg2+ were required for efficient self-spli- NH4 cing of the large 23S.1 precursor [23]. Hence, a smaller RNA, 23S.5 (448 nucleotides), in which the intron was shortened by replacing the long P6 extension (which encodes the I-CreI endonuclease [32]) with a short stem–loop, and the exons were reduced, was generated. This pre-RNA self-splices efficiently without monova- lent salt, and approximately 85% of the RNA is of the same kinetic competence (kcat ¼ 1 min)1 and K1/2 G ¼ 26 lm) [18]. For this study, we have taken the 23S.5 pre-RNA and generated a ribozyme, 23S.5DGb, that performs GMP cleavage at the 5¢ splice site, but not exon ligation or intron circularization, as it lacks the 3¢ exon and the XG. This RNA was used to assay ribozyme activity, and to generate end-labeled RNA for structural probing.

Results

We have been studying the group I

Inhibition of self-splicing and G-dependent cleavage by Mn2+

In splicing reactions with 23S.5 pre-RNA, substituting part (> 1 ⁄ 3) of the Mg2+ with Mn2+ reduced the amount of products, which were undetectable when Mn2+ was the only divalent cation (not shown [26]). Varying the Mn2+ concentration (0.1–50 mm), pH (5.5–7.5), monovalent salt, temperature (37 or 47 (cid:1)C), and reaction time (0.25–60 min) also did not yield any splicing products (data not shown). Mn2+ inhibits self- splicing of the 23S.3 and 23S.4 pre-RNAs, which have different lengths of 5¢ exon [23], and it inhibits a trans- reaction [10] that involves the free intron reacting with 5.8S rRNA (not shown). Together, these data sugges- ted that inhibition by Mn2+ probably involved the core ribozyme, and not the intron open reading frame (ORF) or exon sequences.

Owing to the complexity of the ribozyme reactions and the polyanionic nature of RNA, the catalytic chem- istry and folding of group I ribozymes (and other large ribozymes) require divalent metals [11,12]. Whereas only Mg2+ and Mn2+ are able to support the chemistry of the Tetrahymena ribozyme [13], several divalent cati- ons (e.g. Mg2+, Mn2+, Ca2+, Sr2+, and Ba2+) [14], and even monovalent cations [15], are able to promote the formation of a native, or native-like, structure. With divalent and monovalent salts as the only aids to RNA folding, however, the formation of alternative, nonpro- ductive base pairs can trap a fraction of a large ribo- zyme in inactive conformations [16–18]. The conversion of these forms into an active ribozyme is sometimes hampered, ironically, by native domain–domain interac- tions or high Mg2+ concentrations [19]. Thus, in vivo, the folding of most large ribozymes is probably assisted by proteins. In a few cases, it has been shown that in the presence of the proper protein, group I ribozymes that would otherwise be inactive, or become active only at high temperatures and high Mg2+ concentrations, perform catalysis in vitro under mild conditions [20,21]. ribozyme, Cr.LSU, from the chloroplast 23S (LSU) rRNA gene of the green alga Chlamydomonas reinhardtii [22–24]. Splicing of Cr.LSU in vivo is required for ribosome formation, and could be a limiting step in ribosome biogenesis, as it is one of the slowest steps in rRNA maturation [24]. This subgroup IA3 intron self-splices efficiently in vitro, but requires higher Mg2+ concen- trations than the model intron, Tt.LSU, and it is more sensitive to nucleotide substitutions in the core [23,25]. Kinetic analysis indicated that a Cr.LSU pre-RNA containing the full-length intron and relatively long exon sequences tends to misfold in vitro, although the active fraction self-spliced rapidly [18]. Self-splicing of Cr.LSU occurs only with Mg2+, and is inhibited by equivalent concentrations of Ca2+ or Mn2+ [26]. The Mn2+ inhibition was unexpected, because Mn2+ is similar to Mg2+ [27,28], and has been shown to sup- port the activity of group I and other large and small ribozymes [27,29,30]. Thus, this group I intron exhibits several properties that distinguish it from the more well-studied Tt.LSU and phage introns.

23S.5DGb pre-RNA is a truncated version of 23S.5 that terminates 3 nucleotides before the end of the intron (Fig. 1A; see Fig. 5D for the intron sequence and structure). Core catalytic activity is preserved, however, in the form of G-dependent cleavage at the

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2632

T.-C. Kuo et al.

Mn2+ inhibition and structure of Cr.LSU ribozyme

Ct 0 .3 .7 1 1.5 3 5 10 25 60

5¢ splice site. Incubation of 23S.5DGb with saturating Mg2+ (25 mm) and GMP (150 lm) produces the InDGb and 5¢ exon (not shown) molecules as expected (Fig. 1B). In the presence of 10 mm Mn2+, however, less of the pre-RNA reacts (compare Fig. 1B,C). Thus, the inhibition of 23S.5 self-splicing by Mn2+ is recapit- ulated by the G-dependent cleavage of 23S.5DGb pre- RNA. Mixed-metal titrations over a range of total metal concentrations showed that the ratio of the two metals is somewhat more important than the absolute concentrations; a ratio of Mn2+ ⁄ Mg2+ of approxi- mately 1 : 2 or higher inhibited G-dependent cleavage of 23S.5DGb RNA (and self-splicing of 23S.5, not shown).

Quantification of

0 .3 .6 1 1.5 3 5 10 20 40 60

time-course reactions similar to those in Fig. 1B,C, except at two different GMP con- centrations (Fig. 1D), show that approximately 85% of the 23S.5DGb RNA is kinetically homogeneous and highly active (kobs approximately 0.9 min)1 at 150 lm GMP). The remaining fraction (approximately 15%) is relatively inactive, reacting 20–30 times more slowly (kobs ¼ 0.032 min)1 at 150 lm GMP, and 0.017 min)1 at 20 lm GMP). It can also be inferred from Fig. 1D that the inactive RNA fraction increases substantially when 10 mm Mn2+ is added, from 15% to 32% at 150 lm GMP, or 50% at 20 lm GMP. The inverse is true for the active fraction, which decreased from 85% to 68% and 50%, respectively. The observed rate of G-dependent cleavage by the active fraction is not sub- stantially affected by Mn2+: the kobs at 150 lm GMP is 0.96 min)1 with Mn2+ and 0.87 min)1 without it, and at 20 lm GMP, the kobs is 0.49 min)1 with Mn2+ and 0.55 min)1 without it. We conclude that Mn2+ increases the proportion of 23S.5DGb pre-RNA that is inactive, whereas GMP increases the proportion that is active.

Fig. 1. Mn2+ inhibits the activity of the 23S.5DGb ribozyme. (A) Schematic diagram of 23S.5DGb pre-RNA and the reaction being assayed. 23S.5DGb pre-RNA contains a partial 5¢ exon (rectangle) and a shortened Cr.LSU intron (line), which lacks the large P6 extension and the last three nucleotides (AU XG) of the intron. The sizes of the intron (InDGb) and 5¢ exon (5E) are indicated. The arrow indicates cleavage of the pre-RNA at the 5¢ splice site by GMPG*. (B, C) G-dependent cleavage reactions with 0 mM (B) or 10 mM (C) MnCl2. The reactions with 32P-labeled 23S.5DGb pre-RNA (Pre) included 25 mM MgCl2 and 150 lM GMP. The large product, InDGb, was separated on a denaturing gel and phosphorimaged. (D) Quan- tification of 23S.5DGb pre-RNA decay in the presence (10 mM) or absence (0 mM) of Mn2+, and either 20 or 150 lM GMP. The GMP cleavage reactions were performed as in (B) and (C), except at two different concentrations of GMP. The %23S.5DGb pre-RNA remain- ing was measured, and the data fitted to an equation for two- phase, exponential decay kinetics (see Experimental procedures).

An extensive kinetic analysis was performed at 5–300 lm GMP and 10 or 15 mm Mn2+ in the pres- ence of 25 mm Mg2+. Figure 2A shows that Mn2+ has little or no effect on the KG 1/2 or kcat for the active fraction of the ribozyme. However, as Fig. 2B shows quite dramatically, the metal decreases the size of this fraction. It should be noted that the proportion of act- ive ribozyme without Mn2+ is approximately 88% at all GMP concentrations tested. In the presence of 10 mm Mn2+, the maximum size of this fraction is 66% (> 100 lm GMP), and it decreases dramatically at GMP concentrations < 100 lm (Fig. 2B). At 15 mm Mn2+, the percentage of active ribozyme is even lower (approximately 30% at > 25 lm GMP) and it decrea- ses further at GMP < 20 lm. These data extend the above result, and support the conclusion that Mn2+ affects mainly the correct folding of the ribozyme. The

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2633

T.-C. Kuo et al.

Mn2+ inhibition and structure of Cr.LSU ribozyme

G ¼ 60 lm and

(K1/2 kcat ¼ GMP concentration 0.035 min)1, not shown). However, the inactive fraction in Mn2+ (10 mm in Fig. 2B) reacts much more slowly (approximately 0.007 min)1) and independently of the GMP concentration (not shown). This result suggests that Mn2+ induces a distinctive slow-reacting fraction that must go through a rate-limiting conformational change before it can bind GMP and catalyze cleavage.

Model for the effect of Mn2+ on the 23S.5DGb ribozyme

fraction,

size of

this

the

Since Mn2+ does not substantially affect the kinetic parameters for the active ribozyme, but instead reduces the following scheme (Scheme 1) is proposed to describe the inhibition of G-dependent cleavage by the metal ion.

Scheme 1

U þ nMg2þ +( pre-RNA(cid:1)nMg2þ active U þ mMn2þ +( pre-RNA(cid:1)mMn2þ

inactive

U is unfolded 23S.5DGb pre-RNA, and the binding of a minimum of n Mg2+ ions leads to formation of the active complex, whereas binding of a minimum of m Mn2+ ions forms the inactive complex. The sizes of the active and inactive fractions are the result of com- petitive metal binding to RNA. The values of n and m are estimated from Hill analysis of G-dependent clea- vage of 23S.5DGb. It should be noted that Scheme 1 indicates only the initial and final states of the pre- RNA; it does not invoke or rule out any misfolded intermediates that might form.

analyzed at

Fig. 2. Ribozyme activity at varying GMP and fixed Mn2+ concentra- tions. The G-dependent cleavage reactions were performed at dif- ferent concentrations of GMP (0–300 lM) and Mn2+ (0, 10 or 15 mM) in the presence of 25 mM MgCl2. The reactions were ana- lyzed as described in Experimental procedures, and the observed rate constants (A) and percentages (B) of active ribozyme were plotted versus GMP concentration. In (A), the line was fitted using the 0 mM Mn2+ data. In (B), the kcat values are 1.1, 1.0 and 1.0 min)1, respectively, for the reactions at 0, 10 and 15 mM Mn2+, and the corresponding KG 1/2 values are 22, 24 and 21 lM, respect- ively.

formation of

results also show that most of the inhibition by 10 mm Mn2+ is reversed by saturating GMP (Fig. 2B). More- over, the fact that this GMP activation curve is similar to the GMP cleavage plot (Fig. 2A) indicates that GMP is promoting ribozyme folding via the G binding site in P7.

To determine n, G-dependent cleavage of 23S.5DGb concentrations varying MgCl2 was (0–50 mm) and either 0 or 12 mm MnCl2 (plus satur- ating GMP). Figure 3A shows that in the presence of Mn2+, a much higher concentration of Mg2+ is required to form the same amount of cleavage product (InDGb). A quantitative analysis of similar experiments (Fig. 3B), but using 0–100 mm Mg2+ and several fixed Mn2+ concentrations (0, 7, 12 and 17 mm), reveals that cleavage increases cooperatively with increasing Mg2+, in the absence or presence of Mn2+. The mid- point of the Mg2+ titration curve in the absence of Mn2+ is approximately 4.5 mm, and nearly full activity is reached by 10 mm Mg2+. Hill analysis of the data gives n-values of 2.6, 2.2, 2.7 and 2.7, for reactions in 0, 7, 12 and 17 mm Mn2+, respectively. These results indicate that the active RNA–Mg2+ complex involves the binding of at least three Mg2+ ions by the ribozyme. The data also show that Mg2+ can completely block the inhibition caused by Mn2+.

The rate of G-dependent cleavage by the inactive fraction that forms in Mg2+ increases slowly with

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2634

T.-C. Kuo et al.

Mn2+ inhibition and structure of Cr.LSU ribozyme

Fig. 4. Mn2+ dependence of ribozyme inhibition at fixed Mg2+ con- centrations. G-dependent cleavage of 23S.5DGb pre-RNA was per- formed with the indicated concentrations of MnCl2 (0–30 mM), 10 or 25 mM MgCl2, and 150 lM GMP for 40 s. The reactions were analyzed as in Fig. 3.

Fig. 3. Mg2+ dependence of ribozyme activity at fixed Mn2+ con- centrations. (A) G-dependent cleavage of 23S.5DGb pre-RNA at varying Mg2+ concentration, and 0 mM (top) or 12 mM (bottom) MnCl2; the reactions also contained 150 lM GMP, and were incuba- ted for 40 s. They were separated on a denaturing polyacrylamide gel, which was phosphorimaged. (B) Mg2+ concentration curves at fixed Mn2+ concentrations. G-dependent cleavage of 23S.5DGb was performed as in (A), except for using the indicated Mn2+ con- centrations. The cleavage product (InDGb) was quantified, and expressed as a percentage of total RNA [Relative InDGb (%)]. The data were curve-fitted to obtain Hill coefficients as described in Experimental procedures.

GMP-dependent cleavage decreases sharply above 5 and 7 mm MnCl2, respectively. Quantitative analysis (Fig. 4B) gives a Hill value (m) of 5.7 for the experi- ments with 15 and 25 mm MgCl2. Thus, formation of the inactive ribozyme is highly cooperative. The data also suggest that binding of a minimum of six Mn2+ ions is involved in the misfolding that forms the inactive ribozyme.

To determine

Structure of the Cr.LSU intron in the 23S.5DGb pre-RNA

led us

The unusual metal specificity, as well as other atypical features of Cr.LSU (see Discussion), to study the global tertiary structure of the intron using

the minimal number of Mn2+ involved in forming the inactive RNA–metal com- plex, G-dependent cleavage reactions were performed at varying Mn2+ and fixed Mg2+ concentrations. Figure 4A shows representative gels of reactions that were performed at varying (0–30 mm) MnCl2 con- centrations and either 15 or 25 mm MgCl2. The

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2635

T.-C. Kuo et al.

Mn2+ inhibition and structure of Cr.LSU ribozyme

2–4-fold at most positions; Fig. 5C is the difference profile (for 0 and 25 mm Mg2+) plotted by nucleotide position. It should be noted that similar results were obtained when cleavage time, or concentration of Fe2+-EDTA, was varied over a four-fold range, or when dithiothreitol was replaced by ascorbate and hydrogen peroxide (not shown).

hydroxyl radical cleavage. This analysis was carried out by incubating end-labeled, Mg2+-folded intron (InDGb) with Fe2+-EDTA [7,8]. It should be empha- sized that the RNA structure revealed by Fe2+-EDTA is an averaged image of the RNA molecules in solu- tion. However, since the kinetic data indicate that 85– 90% of 23S.5DGb pre-RNA is functionally similar, we assume that the predominant signal in the protection pattern is from active ribozyme.

or

from,

cleavage

cleavage was

To better visualize the locations of exposed and pro- tected regions of the InDGb intron, data from the difference plot were converted to a color palette and mapped onto the proposed secondary structure (Fig. 5D). Focusing on the critical P7–P3–P8 domain, the 5¢ strand of P7, which includes the G-binding site, is cleaved, whereas the 3¢ strand is protected. The 3¢ strand of P3 is also protected, but the 5¢ strand is neither protected nor particularly exposed. The part of J8 ⁄ 7 proximal to P8 is protected, whereas the residues close to P7 are strongly cleaved; also, P8 itself is pro- tected, but L8 is not. For the P9 subdomains, most of P9 is protected, but most of P9.1 is neutral. The 5¢ strand of P9.0 is protected despite the absence of the 3¢ strand. For the idiosyncratic P7.1 and P7.2 domains, the helices are weakly protected, except for the 3¢ strand of P7.2, which is strongly protected, and both loops are cleaved.

Figure 5A shows an Fe2+-EDTA cleavage analysis performed at 0–25 mm Mg2+. In the absence of Mg2+ (lanes 1 and 12), cleavage occurs throughout the mole- cule; this profile was defined as background. As the Mg2+ concentration increased, different regions of the RNA became either more sensitive to, or more protec- ted relatively unchanged. Figure 5A shows that the overall cleavage profile changes gradually with Mg2+, a trend that appears to hold for most nucleotide positions (solid and open bars in Fig. 5A, lanes 2–11). It should be noted, however, that the degree of change at some nucleotides, such as the protection of P3¢ (Fig. 5A), appears to be greater at the higher concentrations of Mg2+ (> 5 or 6 mm), suggesting that this region may have a higher Mg2+ requirement for folding. There is also a general increase in the amplitudes of the clea- vage ⁄ protection peaks at the highest (25 mm) Mg2+ concentration tested. A similar result is apparent in some of the Tt.LSU L-21 ScaI protection data [33], and may reflect a greater overall stability of the RNA at high Mg2+.

For the other major stacked-helix domain, P5–P4–P6, as well as P2, the extent of protection or exposure was mostly neutral or relatively weak compared with the P7–P3–P8 domain. However, P5, P6 and minor parts of P5a and P6a are protected. Also, J4 ⁄ 5 is weakly protec- ted, but J5 ⁄ 4 is weakly cleaved. Of particular signifi- cance is the observed cleavage of J6 ⁄ 7 and the neutrality of J3 ⁄ 4; these joining segments link the two major domains and form base triples with P4 and P6.

Since 23S.5DGb pre-RNA is fully active at 25 mm Mg2+, we inferred the native structure of the ribozyme by comparing the cleavage profiles at 0 and 25 mm Mg2+ (Fig. 5B). For those nucleotides that showed differential cleavage, the extent of the difference was

The overall Fe2+-EDTA cleavage ⁄ protection pat- tern for this group IA3 intron (InDGb) has many

Fig. 5. Hydroxyl radical cleavage with Fe2+-EDTA of the intron ribozyme. (A) Fe2+-EDTA cleavage and protection pattern of 5¢ end-labeled InDGb RNA as a function of Mg2+ concentration. The InDGb RNA, labeled at its 5¢ end through G-dependent cleavage of 23S.5DGb pre-RNA, was incubated with Mg2+ (final concentration indicated above lanes 2–12) and then cleaved with Fe2+-EDTA. The reactions were resolved on gels of 5–12% polyacrylamide with ladders and other markers. The locations of structural elements (P5, P6, etc.) are marked to the left of the gel image, and RNA sizes to the right. Rectangular bars indicate areas where cleavage is enhanced (filled rectangles), or reduced (open rectangles), with increasing Mg2+. Other lanes are: S, starting RNA; Mn, S RNA cleaved with Mn2+ at GAAA sequences (nucleotides 56, 257 and 323); A, G, A ⁄ U, and C, enzymatic sequence ladder of S RNA; OH, partial alkaline hydrolysis of S RNA; and M, 5¢ end-labeled DNA size markers. The composite figure is from 8% (upper) and 12% (lower) polyacrylamide gels. (B) Phosphorimager scans of Fe2+-EDTA cleavage of InDGb RNA with 0 and 25 mM Mg2+. The RNA was probed as in (A) and the samples resolved on a 12% polyacrylamide gel, which was phosphorimaged. (C) Difference plot of Fe2+-EDTA cleavage at 0 and 25 mM Mg2+. Regions of cleavage are positive (> 0), and regions of protection are negative (< 0). The plot was compiled from cleavage profiles obtained on a series of 5–12% polyacrylamide gels. (D) Protection and cleavage patterns mapped onto the predicted secondary structure; the data are from (C). Protected nucleotides are shades of red and orange, whereas cleaved nucleotides are blue shades; a color bar is given on the bottom right. The analysis under these conditions was repeated twice with similar results. The accuracy of the protection data at the nucleotide level is ± 0 for residues £ 180, ± 1 for residues 181–270, and ± 2 for residues 271–342. The cleavage ⁄ protection patterns of nucleotides 1–14 and 343–378 were insufficient relative to background, and are not indicated. The red arrowheads indicate sites of cleavage by Mn2+-GAAA ribozymes [38].

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2636

T.-C. Kuo et al.

Mn2+ inhibition and structure of Cr.LSU ribozyme

the junction nucleotides that link it to the other major domain. We attempted to probe the InDGb RNA with Fe2+-EDTA in the presence of Mn2+, but cleavage was

similarities to the introns from other subgroups [7,8] (see also below). However, it is atypical because of the relative lack of protection of the catalytic domain and

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2637

T.-C. Kuo et al.

Mn2+ inhibition and structure of Cr.LSU ribozyme

too poor to obtain a clear result. This is most likely due to the similar affinities of EDTA for Mn2+ and Fe2+, and the fact that Mn2+ is in large excess in these reactions [34].

Discussion

Kinetic analysis of Mn2+ inhibition

binding site in P7. An obvious explanation for this result is that binding of GMP prevents an inhibi- tory Mn2+ from binding to this site. Interestingly, 2¢-dGTP inhibits Pb2+ cleavage of the T4-td intron at the bulge nucleotide in P7 [30], which is very close to the bound XG in recent crystal structures [35–37]. With Cr.LSU, we did not see a similar specific clea- vage with Pb2+ or other metals [38], so the same experiment could not be performed. It should be noted, however, that metal-dependent cleavage reveals only a small fraction of metal-binding sites in RNA [29]. An alternative explanation for GMP-induced folding of the ribozyme in Mn2+ is that binding of the cosubstrate to its site induces a conformational change in the RNA that inhibits Mn2+ binding at another inhibitory site(s). It may be relevant that in vitro-evolved Tt.LSU ribozymes capable of using Ca2+ as sole divalent cation had several nucleotide substitutions clustered about the G binding site and the triple base pairs at the P4–P6 junction [39]. We tried unsuccessfully to select variants of Cr.LSU act- ive with Mn2+ from pools of mutants generated by error-prone PCR (T.-C. Kuo & D. L. Herrin, unpub- lished results). Based on the high Hill coefficient reported here, however, the failure of that experiment may be attributed to the difficulty in overcoming the inhibitory Mn2+-binding relatively high number of sites in Cr.LSU.

The group I ribozyme literature indicates that divalent metals are required for tertiary folding and catalysis, and that Mg2+ or Mn2+ can satisfy these functions. However, the activity of some group I introns, inclu- ding three of the five introns in Chlamydomonas rein- hardtii (Cr.psbA2, Cr.psbA3, and Cr.LSU) is inhibited by Mn2+ [26]. We wanted to determine for the Cr.LSU intron if this metal specificity is due to a more stringent requirement for catalysis, or folding, or both. The data show that Mn2+ does not have a significant G and kcat) of the effect on the kinetic parameters (K1/2 23S.5DGb ribozyme. Thus, Mn2+ does not inhibit binding of the guanosine nucleotide, and nor does it suppress cleavage chemistry, suggesting that, as in the case of Tt.LSU and some other group I ribozymes, Mn2+ can support catalysis by Cr.LSU. The data do indicate, however, that Mn2+ inhibits formation of the active ribozyme, presumably by causing misfolding. This result was unexpected, because of the extensive work with the Tt.LSU ribozyme indicating that the metal requirement for ribozyme folding is less restrict- ive than that for catalysis [14,15].

We previously identified six Mn2+-binding sites in Cr.LSU based on site-specific cleavages at pH > 7 [38]. These sites all contain the sequence GAAA, and cleavage occurs between G and A. The cleavage effi- ciency, however, varied between sites, and correlated with the predicted secondary structure. Also, the addi- tion of sufficient Mg2+ to induce self-splicing did not affect the Mn2+ cleavage rates at the various sites, sug- gesting that most of the intron’s secondary structure forms correctly in Mn2+. The experiments herein were performed at pH 6 (self-splicing of Cr.LSU is efficient at pH 6–9 [23]), and for shorter times to limit the Mn2+-induced cleavages. Thus, these data would sug- gest that Mn2+ is probably inhibiting tertiary folding of Cr.LSU. In this respect, we note the published evi- dence [40] that correct tertiary folding of the Azoarcus intron is specific for Mg2+. However, it is possible that subtle but important changes in secondary structure could also be involved. For example, the crystal struc- tures of yeast tRNAPhe in Mg2+, or in a mixture of Mg2+ and Mn2+, are quite similar but not identical; residue D16 (D loop) forms a base pair with U59 (TWC loop) only in the latter condition [41].

It is also surprising that Mn2+-induced misfolding of this ribozyme is highly cooperative, with a Hill coeffi- cient of approximately 6. In fact, it is more cooperative than Mg2+ induction of active ribozyme (Hill coeffi- cient of approximately 3). High cooperativity is consis- tent with the great stability of the RNA formed in Mn2+, which converts very slowly to a form capable of binding GMP and reacting. The higher Hill coefficient could also indicate that Mn2+ binds to additional (three) sites on the ribozyme that do not bind Mg2+. However, the fact that Mg2+ can completely block Mn2+ inhibition would suggest that they bind to the same sites. Hence, it may be that they bind to the same basic locations, but that Mn2+ binds with slightly dif- ferent configurations at some key sites, resulting in it should be noted that, inhibition. In this respect, based on mixed-metal titrations of 23S.5 self-splicing, Mn2+ can functionally replace Mg2+ at some sites [26]. Mn2+ inhibition of 23S.5DGb is partially alleviated lower metal concentrations. this effect the nucleotide is acting via the G

by GMP, especially at The GMP concentration dependence of indicates that

It is unlikely that the three remaining GAAA-Mn2+ cleavage sites in the 23S.5DGb ribozyme (three are

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2638

T.-C. Kuo et al.

Mn2+ inhibition and structure of Cr.LSU ribozyme

Structural and functional idiosyncrasies of the 23S.5DGb intron ribozyme

deleted) are principal targets of Mn2+ inhibition, since Mn2+ cleavage is not cooperative [38]; however, one of them could be a site of Mn2+ inhibition. The best candidate would probably be J4 ⁄ 5, which is strongly cleaved with Mn2+ [38], and is involved in substrate recognition during splicing [35,36]. Changing the GAAA in J4 ⁄ 5 to GACA blocked Mn2+ cleavage and doubled the Mg2+ requirement for Cr.LSU self-spli- cing (T.-C. Kuo, S. P. Holloway & D. L. Herrin, unpublished results), suggesting that it might be an important metal-binding site. Evidence for a functional metal interaction with the J4 ⁄ 5-GAAA region of an Anabaena intron was reported recently [42].

To help us understand the noncanonical properties of Cr.LSU, the intron’s (InDGb) structure was analyzed using Fe2+-EDTA, which has been used extensively to view tertiary-folded group I ribozymes. The chelated iron generates hydroxyl radicals that cleave riboses, unless they are protected by RNA–RNA interactions [7]. Figure 6 compares the Cr.LSU protection pattern, which is the first for a subgroup IA3 intron, with five ribozymes from other subgroups: L-21 ScaI of Tt.LSU [7], T4.nrdD [8], T4.td [8], Sc.bI5 [43], and Azoarcus

Fig. 6. Comparison of the Fe2+-EDTA protection patterns of group I ribozymes. Residues protected from Fe2+-EDTA cleavage are indicated by filled squares with white letters. The data for Cr.LSU (A) are from Fig. 5; for Tt.LSU (B) from [7]; for T4.sunY (C) and T4.td (D) from [8]; for bI5 (E) from [43]; and for Azoarcus pre-tRNAIle (F) from [44]. Domain–domain interactions in introns B–F are indicated by dashed lines. In (A), the lightly shaded nucleotides in the L9.1 and P7.1 loops may form a novel base-pairing interaction; the gray dashed line between L2 and P8 also indicates a possible interaction. Solid arrows indicate sites of Mn2+ cleavage in Cr.LSU and T4-td; open arrows are sites of Pb2+ cleavage in Tt.LSU, T4.td, and T4.nrdD; and arrowheads in Azoarcus indicate the 5¢ and 3¢ splice sites.

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2639

T.-C. Kuo et al.

Mn2+ inhibition and structure of Cr.LSU ribozyme

interactions. Li et al. [25] also isolated nuclear gene suppressors of the P4 mutations; thus, based on these data, it is reasonable to speculate that one or more of these suppressors promote interaction between the two major domains. There are other

functional differences between Cr.LSU and the Tt.LSU and phage T4 introns besides Mn2+ inhibition that may reflect the distinctive struc- tures. It was shown that Pb2+ promotes specific cleav- ages in the P7 and J8 ⁄ 7 regions of Tt.LSU and the phage introns (Fig. 6B–D) in the presence of Mg2+ [30]. However, we did not observe similar specific cleavages in Cr.LSU with Pb2+ (or other cations) [38]. Cr.LSU is also more resistant to inhibition by polycat- ionic aminoglycoside antibiotics, such as neomycin B [47], to requiring 25–50-fold higher concentrations self-splicing in vitro by 50% (T.-C. Kuo, inhibit Y. Bao & D. L. Herrin, unpublished results). It is noteworthy that neomycin inhibits the T4.td intron by binding at the G binding site and displacing one or two critical Mg2+ ions [48]. We propose that the lack of Pb2+ cleavage, and the apparent absence of a high- affinity, inhibitory site for neomycin, could be conse- quences of the more open structure of Cr.LSU, which should present a less electronegative environment at the active site. It would be interesting to know if other group I introns that are inactive with Mn2+ [24] have properties similar to those of Cr.LSU, including the more stringent metal requirement for ribozyme forma- tion.

pre-tRNAIle [44]. All of these introns can self-splice, although the Mg2+ requirement for bI5 is higher than that for the others. Focusing on the catalytic domain (P8–P3–P7), the P3 3¢-strand is the only element that is uniformly protected in all ribozymes, although they all have parts of P7, J8 ⁄ 7 and P9.0 protected. The Cr.LSU pattern is distinct in that the first three nucle- otides of P7, and the 3¢-half of J8 ⁄ 7, are not protected. The first three nucleotides of P7 are part of the G binding site, as are the terminal nucleotides of J6 ⁄ 7 and J8 ⁄ 7 [35–37]; the latter nucleotides are also not protected in the InDGb RNA. It should be noted that the three terminal nucleotides of Cr.LSU, including the XG, are not present in the InDGb RNA, which presumably also lacks P9.0 (Fig. 6A). It is possible this has an effect on the protection pattern. However, the G) for G-dependent kinetic parameters (kcat and K1/2 cleavage by 23S.5DGb are very similar to those obtained for the first step of self-splicing by 23S.5 [18], indicating that P9.0 is not important for core ribozyme activity (it is probably important for the second step of splicing [45]). It is also noteworthy that the 3¢-ter- minal nucleotides were also absent from the Tt.LSU ribozyme mapped with Fe2+-EDTA [7]. To conclude, the G binding site and flanking nucleotides of Cr.LSU less internalized) are more accessible to solvent (i.e. than are those of other group I ribozymes studied to date. It is also intriguing that the kinetic data implicate the G binding site as playing an important role in Mn2+ inhibition.

Why is

the active site less

The tertiary-folded structure of the InDGb RNA in Mn2+ would probably have been instructive, but unfortunately, the Fe2+-EDTA cleavage pattern was strongly inhibited by Mn2+ under these conditions, presumably due to the similar affinities of EDTA for Mn2+ and Fe2+ (Kd approximately 10)14.1) [34]. It may be possible to accomplish this with synchrotron X-ray [49] or peroxynitrous [50] cleavage, although the former requires special equipment, and the latter rea- gent is not as easy to use as Fe2+-EDTA.

An intriguing, though speculative, implication of the relatively open ground-state structure of InDGb is that the ribozyme might undergo a transient internalization of P7, J8 ⁄ 7 and J6 ⁄ 7 after binding GMP to start the reaction. Binding of the guanosine nucleotide by the Tt.LSU ribozyme is very slow, and is believed to induce a local rearrangement of the G binding site [51]; these authors also argued that an incompletely preformed G binding site could promote specificity. The posited conformational rearrangement of Cr.LSU would seem to be more extensive, but if it does happen and is necessary, then that dynamic change could be a key step that is inhibited by Mn2+.

internalized in the InDGb RNA? The lack of protection of J6 ⁄ 7 and J3 ⁄ 4, which are involved in triple base pairs with P4 and P6 [3,35–37], and the relatively weak overall protection of the P4–P5–P6 domain (Fig. 5C), indi- cate that this domain is not tightly packed against the catalytic domain. Analysis of the predicted sec- ondary structure suggests that Cr.LSU may be some- what deficient in interactions between these domains. it seems to lack the L9 · P5 interac- For example, tion found in the other (Fig. 6). This ribozymes interaction is primarily between the L9 tetraloop and the second and third nucleotides of P5 [3]; however, in Cr.LSU, P5 is only two base pairs. Although the P4–P5–P6 domain from the T4.td deletion of intron suggests that it is not essential [46], disruption of P6 in Cr.LSU obliterated self-splicing, and point mutations in P4 strongly decreased splicing in vitro and in vivo, indicating that the P5–P4–P6 domain is important for Cr.LSU [25]. The Li et al. study [25] also indicates that Cr.LSU is more sensitive to single in the core than Tt.LSU nucleotide substitutions or T4.td, which is consistent with fewer tertiary

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2640

T.-C. Kuo et al.

Mn2+ inhibition and structure of Cr.LSU ribozyme

scales against

Experimental procedures

time. The plotted on semilogarithmic observed decrease in pre-RNA was fitted to the two-com- ponent first-order equation:

DNA templates and in vitro RNA synthesis

ð2Þ ð%PreÞt ¼ A expð(cid:4)ka (cid:3) tÞ þ B expð(cid:4)kb (cid:3) tÞ

A and ka are the percentage and observed rate constant for the fast-reacting pre-RNA, and B and kb are the same parameters for the slow fraction; t is reaction time (min). These parameters were determined at different GMP con- centrations (1–300 lm). The catalytic constant (kcat) and G) were obtained by half-maximal GMP concentration (K1/2 fitting ka and [GMP] to:

1=2 þ ½GMP(cid:2)Þ

G is not a true Michaelis–Menten constant, because the

ð3Þ ka ¼ kcat½GMP(cid:2)=ðK G

K1/2 ribozyme does not perform turnover catalysis.

Estimating the minimum number of required metal ions: Hill analysis

Rationale

The DNA template for in vitro synthesis of 23S.5DGb pre- RNA, PCR23S.5DGb, was generated by PCR using Taq polymerase and the manufacturer’s conditions (Perkin Elmer-Cetus, Norwalk, CT, USA). The template was plas- mid pGEM23S.5 [18], and oligos 104 and 158 served as the 5¢ and 3¢ primers, respectively. Plasmid pGEM23S.5 contains a shortened intron (380 bp), 26 bp of the 5¢ exon, and 25 bp of the 3¢ exon. Oligo 104 (45 nucleotides, TAATACGACTC ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA) contains, in order, a T7 RNA polymerase promoter (nucleo- tides 1–17), a six-nucleotide transcription enhancer, an EcoRI restriction site, 14 nucleotides of authentic 5¢ exon, and the first two nucleotides of the Cr.LSU intron. Oligo 158 (26 nucleotides, GAAATTTTAAAGCCGAATAAAACTTG) ends 3 nucleotides before the 3¢-end of the intron. The temperature program was 30 cycles of 94 (cid:1)C, 65 (cid:1)C, and 72 (cid:1)C (1 min each). Transcription of PCR23S.5DGb and purification of the RNA on denaturing gels was performed as described [18]. From Scheme 1, the fraction of active pre-RNA, f(pre- RNA)active, is related to Mg2+ and Mn2+ by:

½f ðpre-RNAÞactive ¼ ½pre-RNA (cid:4) nMg2þ(cid:2)active=½pre-RNA(cid:2)total

G-dependent cleavage of 23S.5DGb pre-RNA, and quantification

2þð1 þ ½Mn2þ(cid:2)

2þÞg

m=KMn

2+ and KMn

¼ ½Mg2þ(cid:2)n=f½Mg2þ(cid:2)n ð4Þ þ KMg

n n=ð½Mg2þ(cid:2)

The [pre-RNA–nMg2+]active term is the concentration of active ribozyme, and [pre-RNA]total is the RNA concentra- 2+ are the apparent dissociation con- tion. KMg stants for the RNA–nMg2+ and RNA–mMn2+ complexes. To determine n, f(pre-RNA)active at varying Mg2+ concen- tration was fitted to: temperature ð5Þ þ C1Þ f ðpre-RNAÞactive ¼ ½Mg2þ(cid:2)

2þð1 þ ½Mn2þ(cid:2)

2þÞ

m=KMn

where

C1 ¼ KMg

m

To determine m, f(pre-RNA)active was fitted to

Þ ð6Þ f ðpre-RNAÞactive ¼ C2=ðC3 þ ½Mn2þ(cid:2) quantified using and Prior to the reaction, the RNA was denatured by heating (90 (cid:1)C, 1 min) and cooled slowly (1 C(cid:1) ⁄ 5 s) to 37 (cid:1)C in the absence of divalent metals. The RNA (2–8 nm, 1500– 8000 c.p.m.) was preincubated with MgCl2 and ⁄ or MnCl2 in 50 mm Mes-KOH pH 6.0 (the relatively low pH redu- ces Mn2+-promoted cleavage at GAAA) at 37 (cid:1)C for 20 min, and then G-dependent cleavage was initiated by to 47 (cid:1)C and adding GMP raising the (2–300 lm). The reactions were performed in siliconized tubes in either 5 or 50 lL (time course). The reactions were stopped with 1.2 volumes of 80% formamide, 0.1% bromophenol blue, 0.1% xylene cyanol, 100 mm EDTA, pH 8.0, and the RNA was denatured by heating at 65 (cid:1)C for 3 min before electrophoresis on 4% polyacryla- mide ⁄ 8 m urea gels. The dried gels were imaged with a phosphorimager, ImageQuant (Molecular Dynamics, Sunnyvale, CA, USA) [18]. where

n C2 ¼ ½Mg2þ(cid:2)

Mn=K 2þ

Mg; and C3 ¼ C2 þ K 2þ Mn

G for G-dependent cleavage

(cid:3) K 2þ

Estimation of the catalytic constant, kcat, and K1/2

For the 23S.5DGb pre-RNA, the percentage remaining at time t (% Pre) is given by:

ð%PreÞ ¼ Pre=½Pre þ InDGbð1 þ 26=377Þ(cid:2) (cid:3) 100% ð1Þ

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2641

the absolute value of f(pre-RNA)active can In principle, only be obtained from the value of A (Eqn 2) in a time- dependent reaction. However, for determining n and m, relative values from single initial-time measurements are sufficient. At the initial time points, the vast majority of product comes from the highly active fraction. Hence, plots of the percentage of total RNA that is InDGb yield n and m from Eqns 5 and 6. Pre and InDGb are the amounts in c.p.m. of the pre-RNA and intron, respectively, and 26 ⁄ 377 accounts for the liber- ated 5¢ exon, which was not measured. The percentages were

T.-C. Kuo et al.

Mn2+ inhibition and structure of Cr.LSU ribozyme

Procedure

Acknowledgements

OWO and DLH were supported by a grant from the Department of Energy (DE-FG03-02ER15352) and the Robert A. Welch Foundation (F-1164). TCK was sup- ported by a grant from the Taiwan National Science Council (NSC 94-2218E038) and Taipei Medical Uni- versity (TMU94AE1B05).

G-dependent cleavage of internally labeled 23S.5DGb pre- RNA (2000–3000 c.p.m.) was performed for 40 s at the indicated concentrations of Mg2+ and Mn2+, 150 lm (sat- urating) GMP, 50 mm Mes-KOH pH 6.0 at 47 (cid:1)C. The reactions were separated on denaturing gels, and quantified as described above. The amount (c.p.m.) of InDGb formed at i mm Mg2+ and j mm Mn2+ was first expressed as %InDGb using the following definition:

References

%InDGbi;j ¼ 100% (cid:3) InDGb=½pre-RNA þ InDGbð1 þ 26=377Þ(cid:2) ð7Þ

1 Vicens Q & Cech TR (2005) Atomic level architecture of group I introns revealed. Trends Biochem Sci 31, 41–51. for the the 5¢ exon. This normalizes 2 Woodson SA (2005) Structure and assembly of group I introns. Curr Opin Struct Biol 15, 324–330.

InDGb and pre-RNA are in c.p.m., and the 26 ⁄ 377 accounts slight differences (± 10%) in RNA loaded per lane. Relative InDGb percentage at i mm Mg2+ and j mm Mn2+ was defined as:

Relative InDGb% ¼ ½ð%InDGbi;jÞ=ð%InDGb maxÞ(cid:2) (cid:3) 100% ð8Þ 3 Michel F & Westhof E (1990) Modeling of the three- dimensional architecture of group I catalytic introns based on comparative sequence analysis. J Mol Biol 216, 585–610.

%InDGb max is the maximum %InDGb obtained at varying Mg2+ and fixed Mn2+ concentrations, or vice versa. The value of Relative InDGb% replaced f(pre-RNA)active in Eqns 5 and 6, and the values of n and m were obtained by curve fitting with KaleidaGraph (Synergy). 4 Suh SO, Jones KG & Blackwell M (1999) A group I intron in the nuclear small subunit rRNA gene of Cryptendoxyla hypophloia, an ascomycetous fungus: evidence for a new major class of group I introns. J Mol Evol 48, 493–500.

5 Doudna JA & Cech TR (1995) Self-assembly of a group I intron active site from its component tertiary struc- tural domains. RNA 1, 36–45.

Probing the structure of the 23S.5DGb ribozyme with Fe2+-EDTA

6 Cech TR & Golden BL (1999) Building a catalytic

active site using only RNA. In The RNA World, 2nd edn (Gesteland R, Cech TR & Atkins J, eds), pp. 321– 350. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

7 Latham JA & Cech TR (1989) Defining the inside and outside of a catalytic RNA molecule. Science 245, 276– 282. 8 Heuer TS, Chandry PS, Belfort M, Celander DW &

Cech TR (1991) Folding of group I introns from bacter- iophage T4 involves internalization of the catalytic core. Proc Natl Acad Sci USA 88, 11105–11109. 9 Cech TR & Herschlag D (1996) Group I ribozymes:

substrate recognition, catalytic strategies, and compara- tive mechanistic analysis. In Catalytic RNA (Eckstein F & Lilley DM, eds), pp. 1–17. Springer, Heidelberg. 10 Thompson AJ & Herrin D (1994) A chloroplast insert

group I intron undergoes the first step of reverse spli- cing into host cytoplasmic 5.8S rRNA. Implications for intron-mediated RNA recombination, intron trans- position and 5.8S rRNA structure. J Mol Biol 236, 455–468. 11 Pyle AM (1993) Ribozymes: a distinct class of metallo- enzymes. Science 261, 709–714. the lanes) 12 Woodson SA (2005) Metal ions and RNA folding: a

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2642

highly charged topic with a dynamic future. Curr Opin Chem Biol 9, 104–109. The InDGb RNA was 5¢-labeled by G-dependent cleavage of nonradioactive 23S.5DGb pre-RNA (3 pmol) with 20 lm [a-32P]GTP (3000 CiÆmmol)1), 25 mm Mg2+ for 5 min at 47 (cid:1)C. The RNA was purified, renatured as described above, and then preincubated at 47 (cid:1)C for 15 min in 0–250 mm MgCl2, 15 mm Tris ⁄ HCl, pH 7.5. Cleavage was effected by adjusting the mixture to 1 mm Fe(NH4)2(SO4)2, 2 mm EDTA, 5 mm dithiothreitol [7] and incubating at 42 (cid:1)C for 50 min. The reactions were terminated with thiourea (10 mm) and gel-loading solution. For gel mark- ers, end-labeled InDGb RNA (2–4 · 105 c.p.m.) was diges- ted with RNases U2, T1, Phy M, or CL3, cleaved with alkali, and cleaved with Mn2+ (3 mm MnCl2, 0.2 m KCl, 50 mm Tris ⁄ HCl, pH 7.4, at 47 (cid:1)C for 15 min). DNA size markers were prepared by restricting a 5¢ end-labeled EcoRI ⁄ HindIII (443 bp) of plasmid pGEM23S.5 [18] with HphI, BstXI, and XhoI. Samples were denatured and separated on a series of denaturing polyacrylamide (5–12%) gels, powered at approximately 50 W (50–55 (cid:1)C); the gels were imaged and quantified as above. The data were corrected for background hydrolysis, and normalized to adjust for loading differences (by integrating the signal along the entire length of [14]. Using the sequence ladders as a guide, positions in the lanes could be related to corresponding nucleotides in the sequence.

T.-C. Kuo et al.

Mn2+ inhibition and structure of Cr.LSU ribozyme

13 Grosshans CA & Cech TR (1989) Metal ion require-

28 Feig AL (2000) The use of manganese as a probe for elucidating the role of magnesium ions in ribozymes. Met Ions Biol Syst 37, 157–182. ments for sequence-specific endoribonuclease activity of the Tetrahymena ribozyme. Biochemistry 28, 6888– 6894. 29 Pan T, Long DM & Uhlenbeck OC (1993) Divalent

14 Celander DW & Cech TR (1991) Visualizing the higher order folding of a catalytic RNA molecule. Science 251, 401–407. metal ions in RNA folding and catalysis. In The RNA World (Gesteland R, Cech TR & Atkins J, eds), pp. 271–302. Cold Spring. Harbor Laboratory Press, Cold Spring Harbor, New York.

15 Takamoto K, He Q, Morris S, Chance MR & Breno- witz M (2002) Monovalent cations mediate formation of native tertiary structure of the Tetrahymena thermo- phila ribozyme. Nature Struct Biol 9, 928–933. 30 Streicher B, von Ahsen U & Schroeder R (1993) Lead cleavage sites in the core structure of group I intron- RNA. Nucleic Acids Res 21, 311–317.

16 Pan J & Woodson SA (1998) Folding intermediates of a self-splicing RNA: mispairing of the catalytic core. J Mol Biol 280, 597–609. 31 Tullius TD & Greenbaum JA (2005) Mapping nucleic acid structure by hydroxyl radical cleavage. Curr Opin Chem Biol 9, 127–134. 17 Treiber DK, Rook MS, Zarrinkar PP & Williamson JR 32 Thompson AJ, Yuan X, Kudlicki W & Herrin DL

(1992) Cleavage and recognition pattern of a double- strand-specific endonuclease (I-CreI) encoded by the chloroplast 23S rRNA intron of Chlamydomonas rein- hardtii. Gene 119, 247–251.

(1998) Kinetic intermediates trapped by native interac- tions in RNA folding. Science 279, 1943–1946. 18 Kuo TC & Herrin DL (2000) A kinetically efficient form of the Chlamydomonas self-splicing ribosomal RNA precursor. Biochem Biophys Res Commun 273, 967–971. 33 Laggerbauer B, Murphy FL & Cech TR (1994) Two major tertiary folding transitions of the Tetrahymena catalytic RNA. EMBO J 13, 2669–2676.

19 Treiber DK & Willamson JR (2001) Beyond kinetic traps in RNA folding. Curr Opin Struct Biol 11, 309–314. 20 Gampel A, Nishikimi M & Tzagoloff A (1989) CBP2 34 Perrin DD & Dempsey B (1974) Buffers for Ph and Metal Ion Control. Chapman & Hall, London.

protein promotes in vitro excision of a yeast mitochondrial group I intron. Mol Cell Biol 9, 5424– 5433. 35 Golden BL, Kim H & Chase E (2005) Crystal structure of a phage Twort group I ribozyme–product complex. Nat Struct Mol Biol 12, 82–89. 21 Guo Q & Lambowitz AM (1992) A tyrosyl-tRNA

synthetase binds specifically to the group I intron cata- lytic core. Genes Dev 6, 1357–1372.

22 Herrin DL, Chen YF & Schmidt GW (1990) RNA spli- cing in Chlamydomonas chloroplasts. Self-splicing of 23S preRNA. J Biol Chem 265, 21134–21140.

36 Adams PL, Stahley MR, Gill ML, Kosek AB, Wang J & Strobel SA (2004) Crystal structure of a group I intron splicing intermediate. RNA 10, 1867–1887. 37 Guo F, Gooding AR & Cech TR (2004) Structure of the Tetrahymena ribozyme: base triple sandwich and metal ion at the active site. Mol Cell 16, 351–362. 38 Kuo TC & Herrin DL (2000) Quantitative studies of Mn2+-promoted specific and non-specific cleavages of a large RNA: Mn2+-GAAA ribozymes and the evolu- tion of small ribozymes. Nucleic Acids Res 28, 4197– 4206. 23 Thompson AJ & Herrin DL (1991) In vitro self-spli- cing reactions of the chloroplast group I intron Cr.LSU from Chlamydomonas reinhardtii and in vivo manipulation via gene-replacement. Nucleic Acids Res 19, 6611–6618.

39 Lehman N & Joyce GF (1993) Evolution in vitro of an RNA enzyme with altered metal dependence. Nature 361, 182–185. 24 Holloway SP & Herrin DL (1998) Processing of a com- posite large subunit rRNA: studies with Chlamydomonas mutants deficient in maturation of the 23S-like rRNA. Plant Cell 10, 1193–1206.

40 Rangan P & Woodson SA (2003) Structural require- ment for Mg2+ binding in the group I intron core. J Mol Biol 329, 229–238.

25 Li F, Holloway SP, Lee J & Herrin DL (2002) Nuclear genes that promote splicing of group I introns in the chloroplast 23S rRNA and psbA genes in Chlamydomo- nas reinhardtii. Plant J 32, 467–480. 41 Shi H & Moore PB (2000) The crystal structure of yeast phenylalanine tRNA at 1.93 A˚ resolution: a classic structure revisited. RNA 6, 1091–1105. 42 Luptak A & Doudna JA (2004) Distinct sites of phos-

26 Kuo TC (1998) The group I ribozyme from the chloro- plast rRNA gene of Chlamydomonas reinhardtii: kinetic and structural analysis of the divalent metal requirement and specific interactions with Manganese (II). PhD Dissertation, University of Texas. phorothioate substitution interfere with folding and spli- cing of the Anabaena group I intron. Nucleic Acids Res 32, 2272–2280.

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2643

43 Weeks KM & Cech TR (1995) Protein facilitation of group I intron splicing by assembly of the catalytic core and the 5¢ splice-site domain. Cell 82, 221–230. 27 Kazakov S (1996) Nucleic acid binding and catalysis by metal ions. In Bioorganic Chemistry: Nucleic Acids (Hecht SM, ed.), pp. 244–287. Oxford University Press, New York.

T.-C. Kuo et al.

Mn2+ inhibition and structure of Cr.LSU ribozyme

44 Rangan P, Masquida B, Westhof E & Woodson SA 49 Sclavi B, Woodson S, Sullivan M, Chance MR &

(2003) Assembly of core helices and rapid tertiary fold- ing of a small bacterial group I ribozyme. Proc Natl Acad Sci USA 100, 1574–1579. 45 Michel F, Netter P, Xu M-Q & Shub DA (1990) Brenowitz M (1997) Time-resolved synchrotron X-ray footprinting, a new approach to the study of nucleic acid structure and function: application to protein– DNA interactions and RNA folding. J Mol Biol 266, 144–159.

Mechanism of 3¢ splice-site selection by the catalytic core of the sunY intron of bacteriophage T4: the role of a novel base-pairing interaction in group I introns. Genes Dev 4, 777–788. 46 Ikawa Y, Shiraishi H & Inoue T (2000) Minimal cataly- 50 Chaulk SG & MacMillan A (2000) Characterization of the Tetrahymena ribozyme folding pathway using the kinetic footprinting reagent peroxynitrous acid. Bio- chemistry 39, 2–8.

tic domain of a group I self-splicing intron RNA. Nature Struct Biol 7, 1032–1035.

51 Karbstein K & Herschlag D (2003) Extraordinarily slow binding of guanosine to the Tetrahymena group I ribo- zyme: implications for RNA preorganization and function. Proc Natl Acad Sci USA 100, 2300–2305. 47 Schroeder R, Waldisch C & Wank H (2000) Modula- tion of RNA function by aminoglycoside antibiotics. EMBO J 19, 1–9. 48 Walter F, Vicens Q & Westhof E (1999) Aminoglyco-

FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS

2644

side–RNA interactions. Curr Opin Chem Biol 3, 694–704.