Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique

The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique Tseng-Huang Liu1, Shen-Hsing Hsu1, Yun-Tzu Huang1, Shih-Ming Lin1, Tsu-Wei Huang2, Tzu-Han Chuang3, Shih-Kang Fan4, Chien-Chung Fu3, Fan-Gang Tseng2,* and Rong-Long Pan1,*

1 Department of Life Sciences and Institute of Bioinformatics and Structural Biology, College of Life Sciences, National Tsing Hua Univer- sity, Hsin Chu, Taiwan, ROC 2 Department of Engineering and System Science, National Tsing Hua University, Hsin Chu, Taiwan, ROC 3 Institute of NanoEngineering and MicroSystems, National Tsing Hua University, Hsin Chu, Taiwan, ROC 4 Institute of Nanotechnology, National Chiao Tung University, Hsin Chu, Taiwan, ROC

Keywords atomic force microscopy; proton translocation; tonoplast; vacuolar H+-pyrophosphatase; vacuole

Correspondence R.-L. Pan, Department of Life Sciences and Institute of Bioinformatics and Structural Biology, College of Life Sciences, National Tsing Hua University, Hsin Chu 30013, Taiwan, ROC Fax: +886 3 5742688 Tel: +886 3 5742685 E-mail: rlpan@life.nthu.edu.tw

*These authors contributed equally to this work

(Received 1 March 2009, revised 17 May 2009, accepted 10 June 2009)

doi:10.1111/j.1742-4658.2009.07146.x

Vacuolar H+-translocating inorganic pyrophosphatase [vacuolar H+-pyro- phosphatase (V-PPase); EC 3.6.1.1] is a homodimeric proton translocase; it plays a pivotal role in electrogenic translocation of protons from the cyto- sol to the vacuolar lumen, at the expense of PPi hydrolysis, for the storage of ions, sugars, and other metabolites. Dimerization of V-PPase is neces- sary for full proton translocation function, although the structural details of V-PPase within the vacuolar membrane remain uncertain. The C-termi- nus presumably plays a crucial role in sustaining enzymatic and proton- translocating reactions. We used atomic force microscopy to visualize V-PPases embedded in an artiﬁcial lipid bilayer under physiological condi- tions. V-PPases were randomly distributed in reconstituted lipid bilayers; approximately 43.3% of the V-PPase protrusions faced the cytosol, and 56.7% faced the vacuolar lumen. The mean height and width of the cyto- solic V-PPase protrusions were 2.8 ± 0.3 nm and 26.3 ± 4.7 nm, whereas those of the luminal protrusions were 1.2 ± 0.1 nm and 21.7 ± 3.6 nm, respectively. Moreover, both C-termini of dimeric subunits of V-PPase are on the same side of the membrane, and they are close to each other, as visualized with antibody and gold nanoparticles against 6·His tags on C-terminal ends of the enzyme. The distance between the V-PPase C-termi- nal ends was determined to be approximately 2.2 ± 1.4 nm. Thus, our to provide structural details of a membrane-bound study is the ﬁrst V-PPase dimer, revealing its adjacent C-termini.

Introduction

Vacuolar H+-pyrophosphatase (V-PPase; EC 3.6.1.1) is a homodimeric protein with a monomeric molecular mass of 71–80 kDa [1]. V-PPase catalyzes electrogenic proton translocation from the cytosol to the vacuolar lumen to generate an inside-acidic and inside-positive membrane potential for the secondary transport of

ions, metabolites, and toxic substances [1–3]. The cDNAs of V-PPase have been cloned from several higher plants, some protozoa, and several species of eubacteria and archeubacteria, and are highly similar (86–91% deduced amino acid identity) [1,3,4]. V-PPase requires Mg2+ as a cofactor, and the binding of Mg2+

Abbreviations AFM, atomic force microscopy; DDM, n-dodecyl-b-D-maltoside; GNP, gold nanoparticle; SD, standard deviation; V-PPase, vacuolar H+-pyrophosphatase; TEM, transmission electron microscopy.

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4381

T.-H. Liu et al.

Adjacent C-termini of dimeric H+-pyrophosphatase

the C-terminus

the this proton-transporting V-PPase. Furthermore, molecular volume of V-PPase calculated from AFM images suggests the presence of two identical subun- its, verifying the notion of the homodimeric V-PPase enzyme. A gold nanoparticle (GNP) technique com- bined with transmission electron microscopy (TEM) the distance analysis was utilized to determine between C-termini within a membrane-bound V-PPase dimer, and indicated that the C-termini are located at the interface of subunits.

Results and discussion

can stabilize and activate the enzyme [1,5]. Relatively high concentrations of K+ stimulate the proton-trans- locating function of V-PPase, whereas excess amounts of PPi, Ca2+, Na+ and F) inhibit its enzymatic activ- ity [6–8]. It is conceivable that the V-PPase provides speciﬁc binding domains for the substrate and the above-mentioned ions, as well as proton translocation. Truncation of induces a dramatic decline in V-PPase enzymatic activity, proton translo- cation, and coupling efﬁciency [9]. In addition, deletion of the C-terminus of V-PPase increases its susceptibil- ity to heat stress and substantially increases the appar- ent K+ binding constant. It is thus likely that the C-terminus plays an essential role in sustaining the physiological functions of V-PPase.

AFM analysis of puriﬁed V-PPase adsorbed onto mica

the

that

analysis

for

the

enzymatic

exclusion

size

Recombinant DNAs for overexpression of V-PPases containing a 6·His tag at either the C-terminus or N-terminus were prepared and transformed into a yeast host. Recombinant V-PPase containing a 6·His tag at the C-terminus (Fig. 1C) was overexpressed in yeast and successfully puriﬁed from microsomes. Unfortunately, V-PPase containing a 6·His tag at the N-terminus was poorly expressed in yeast and was therefore excluded from the study (data not shown). SDS/PAGE analysis of the puriﬁed C-termi- nal 6·His-tagged V-PPase followed by Coomassie Blue staining or western blotting showed that it was highly puriﬁed, comprising a single major band with a molecular mass of 73 kDa (Fig. 1A), as expected from the known structure of the V-PPase monomer [1,2,10]. During chromatography, V-PPase was eluted with an apparent molecular mass of (cid:2) 145 kDa, similar to its native form and in agreement with previous studies suggesting a dimeric conformation [2,10–12].

Interactions between the subunits of the V-PPase dimer have been studied [1,2,10–12]. Radiation inac- tivation proper demonstrated dimeric structure of V-PPase on tonoplastic mem- branes is a prerequisite for both enzymatic activity and PPi-supported proton translocation [2,11,12]. Further target size measurements revealed that only one subunit of the puriﬁed dimeric complex was suf- ﬁcient reaction of V-PPase, although proton translocation requires the presence [2]. Moreover, high hydrostatic of both subunits pressure was employed to inhibit V-PPase through subunit dissociation of the enzyme, resulting in inac- tive forms [10]. The physiological substrate and sub- strate analogs enhance the high-pressure inhibition of V-PPase, indicating the vulnerability of the subunit– subunit interaction [10]. The above lines of evidence illustrate explicitly the importance of dimer forma- tion for V-PPase function, and suggest nonrandom subunits and sequestered association of V-PPase within the vacuolar membrane. Furthermore, the structures of puriﬁed V-PPases from pumpkin (Cu- curbita sp. Kurokawa Amagur) and Thermotoga mar- itime have been examined by electron microscopy [13,14]. Notwithstanding this, structure–function rela- tionships within this proton-translocating complex require further study.

Atomic force microscopy (AFM)

high-resolution

images

of

The puriﬁed V-PPase was then reconstituted into liposomes by a detergent removal method using Bio- Rad SM-2 beads combined with freeze–thaw sonica- tion [13]. On addition of PPi to the proteoliposome solution containing Mg2+, a dramatic decrease in pH was generated in the interior of the liposomes (Fig. 1B, lower trace). The acidic pH was eliminated by the addition of the ionophore gramicidine D (5 lgÆmL)1), indicating the integrity of the membrane (data not shown). The liposomes alone (without V-PPase) did exhibit proton-translocating activity (Fig. 1B, not upper trace).

Individual V-PPase molecules were

adsorbed randomly on the mica surface and exhibited a proto- typical globular structure under physiological condi- tions (Fig. 2A). Figure 2B shows the heights of the adsorbed particles along the cross-section in Fig. 2A.

is a powerful tool used for nanoscale structural analysis of protein complexes [15,16], and of supported lipid bilayers in particular [17–20]. For instance, AFM has provided puriﬁed marvelously dimeric membrane proteins in 2D crystals and of densely packed proteins in native membranes [21–23]. In the present study, we used AFM to directly observe puriﬁed V-PPases reconstituted into planar lipid bilayers under physiological conditions. Our images unambiguously reveal a dimeric complex for

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4382

T.-H. Liu et al.

Adjacent C-termini of dimeric H+-pyrophosphatase

Fig. 1. Puriﬁcation and proton transport activity of V-PPase. (A) Analysis of puriﬁed V-PPase by western blotting (top) and SDS/ PAGE and Coomassie Blue staining (bot- tom). Lane 1: V-PPase-enriched microsome. Lane 2: puriﬁed V-PPase. Lane 3: reconsti- tuted V-PPase. Molecular mass (kDa) mark- ers are indicated on the left. (B) PPi- associated proton translocation of reconsti- tuted V-PPase. Proton transport was initi- ated by adding 1.0 mM PPi. At the end of each reaction, 5 lgÆmL)1 gramicidin D was added to stop the ﬂuorescence quenching of acridine orange. (C) Topological model of V-PPase. Cylinders 1–16 indicate mem- brane-spanning domains.

AFM analysis of V-PPase reconstituted into liposomes

individual protein molecules was The width of measured at half the vertical height. The mean width and height [± standard deviation (SD), n = 21] of puriﬁed V-PPase were 22.5 ± 3.2 nm and 1.6 ± 0.4 nm, respectively. Furthermore, major peaks on height and width histograms for the AFM images also concurred with those parameters obtained above for V-PPase molecules (Fig. 2C,D). The ﬂattening of particles was presumably caused by the interaction between the polar surface of the protein molecules and the charged surface of the mica [24]. These images represent the ﬁrst direct nanoscale observation of V-PPase.

(Fig. 3A3). Lipid

bilayers

The homodimeric structure of V-PPase in a planar lipid bilayer was imaged directly by AFM (Fig. 3). Puriﬁed V-PPase was ﬁrst reconstituted into a sup- ported lipid bilayer, as conﬁrmed by immunoﬂuores- cence imaging (Fig. 3A). Figure 3A1 shows a planar lipid bilayer reconstituted with V-PPases and ana- lyzed by immunoﬂuorescence using a primary anti- body against His followed by a Cy3-conjugated secondary antibody; no ﬂuorescence was detected in bilayers without immunoﬂuorescence labeling of the protein (Fig. 3A2). In addition, no immunoﬂuores- cence was observed when the reconstituted sample was incubated directly with the Cy3-conjugated sec- ondary antibody in the absence of primary antibody lacking against His V-PPases also did not exhibit detectable ﬂuorescence (Fig. 3A4). These results indicated successful incorpo- ration of V-PPase into a lipid bilayer, allowing for subsequent AFM analysis.

tip with the

the

[25]. Nonetheless,

for nanoscale

Determination of molecular volume provides the stoichiometry of subunit components for functional enzymes [24]. In this study, the volume of V-PPase was calculated using Eqn (1) and determined to be 302.4 ± 40.6 nm3 (Vs) (n = 21), which was slightly larger than the theoretical value (Vprot; 274.5 nm3) of the protein (Table 1). This slight overestimation in volume probably arose from the broadening effect of the AFM tip [24]. It is also likely that variations in volume measurements might arise from distinct inter- individual puriﬁed actions of results V-PPase particles these this unambiguously demonstrate the feasibility of technique investigation of puriﬁed V-PPase molecules.

To obtain high-resolution AFM images of individ- ual V-PPases within reconstituted membranes, the proteoliposomes prepared above were fused into a large planar lipid bilayer for direct observation. The thickness of the lipid bilayer without any protein was 4.6 ± 0.5 nm (n = 12), determined approximately

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4383

T.-H. Liu et al.

Adjacent C-termini of dimeric H+-pyrophosphatase

A

individual V-PPases

B

C

from a cross-section of the lipid bilayer. The bilayer thickness was consistent with previous AFM mea- surements of a lipid bilayer composed of a phospha- tidylcholine/cholesterol mixture and prepared in a similar aqueous environment [26]. V-PPases reconsti- tuted into the lipid bilayer protruded from the bilayer surface in a diffuse pattern with a random distribution. The V-PPase images fell within two cat- egories according to the extramembranous protrusion height. These height differences reﬂect two distinct populations of individual V-PPases facing the recon- stituted membrane surface (Fig. 3D,E). Three-dimen- randomly sional analysis of distributed on the membrane surface indicated that 56.7% of the protrusions were small, with a mean height of 1.2 ± 0.1 nm (n = 20) (Fig. 3B, solid cir- cles), and the remainder of the protrusions (43.3%) were large, with a mean height of 2.8 ± 0.3 nm (n = 17) (Fig. 3B, dotted circle). The uneven distri- bution and/or orientation of V-PPases on the mem- brane suggests that targeting of the V-PPase into the vacuolar membrane of plant cells may follow a spe- ciﬁc pattern, as previously suggested [10]. Figure 3C shows a cross-section along the line in Fig. 3B. The widths and heights of the reconstituted V-PPase pro- trusions in Fig. 3B are listed in Table 1. The AFM image of reconstituted V-PPase shows a ratio of approximately 2.40 : 1 for the height values of the cytosolic and luminal sides. In addition, the theoreti- cal ratio of the total amount of amino acids on the cytosolic and luminal sides was calculated as 2.31 : 1 (data not shown), verifying the efﬁcacy of this tech- nique.

D

The high protein density in 2D crystals or in native membranes allows high-resolution AFM topographs and the elucidation of protein subunit organization [21–23]. However, it is presently difﬁcult to obtain V-PPase reconstituted in 2D crystals or packed at high density into a membrane (data not shown). Notwith- standing this, current AFM techniques sufﬁce to provide unambiguous images of the dimeric structure of V-PPase. Four representative examples exhibiting minor variations are shown in Fig. 4A. The small differences in topography of the individual V-PPases in

Fig. 2. AFM analysis of puriﬁed V-PPase. (A) Three-dimensional AFM image of puriﬁed V-PPase adsorbed onto mica. (B) Proﬁle of peak heights along the cross-section shown in (A). Puriﬁed V-PPase protrudes 1.6 ± 0.4 nm (n = 21) from the mica surface. (C) Histo- gram of V-PPase height determined using the AFM image in (A). (D) Histogram of V-PPase width determined using the AFM image in (A).

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4384

T.-H. Liu et al.

Adjacent C-termini of dimeric H+-pyrophosphatase

Table 1. Dimensions of free and membrane-bound recombinant V-PPase determined by AFM. Values represent means ± SD. n = number of observations. Observed and predicted volumes were determined from AFM analysis using Eqn (1) and from theoretical analysis using Eqn (2).

Volume (nm3) Observed

Predicted

Protein (145 kDa)

Height (nm)

Width (nm)

1.6 ± 0.4

22.5 ± 3.2

302.4 ± 40.6 332.9 ± 46.9

274.5 274.5

21.7 ± 3.6 26.3 ± 4.7

Puriﬁed V-PPase (n = 21) Reconstituted V-PPase Lumen side (n = 20) Cytosolic side (n = 17) Lipid bilayer (n = 12)

1.2 ± 0.1 2.8 ± 0.3 4.6 ± 0.5

Fig. 3. Reconstitution of V-PPase into proteoliposomes. (A) Immunoﬂuorescence imaging of V-PPases reconstituted into lipid bilayers. (1) Sample treated with primary and secondary antibodies. (2) Sample not treated with either antibody. (3) Sample treated with only secondary antibody. (4) Lipid bilayer lacking V-PPases but treated with primary and secondary antibodies. (B) AFM image of V-PPase extramembranous protrusions on the luminal and cytosolic sides of the membrane. Solid circle, luminal side; dotted circle, cytosolic side. Inset: section of a lipid bilayer with thickness of 4.6 ± 0.5 nm (n = 12). (C) Proﬁle of protrusion heights along the cross-section shown in (B). Two populations of V-PPase protrusions were observed: one with a mean height of 1.2 ± 0.1 nm (n = 20), and one with a mean height of 2.8 ± 0.3 nm (n = 17). (D) Histogram of V-PPase protrusion heights determined using the AFM image in (B). (E) Histogram of V-PPase peak widths deter- mined using the AFM image in (B).

resolution of

the

the resolution of

the reconstituted lipid bilayer have probably resulted from contact with the AFM tip during scanning. these AFM images are adequate for Nevertheless,

structural details of nanoscale V-PPase [27,28]. Moreover, the images from V-PPases in reconstituted membranes was

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4385

T.-H. Liu et al.

Adjacent C-termini of dimeric H+-pyrophosphatase

Fig. 4. High-resolution AFM image of V-PPase dimers in a reconstituted membrane. (A) AFM analysis of extramembranous protrusions on the cytosolic side of proteoliposomes containing V-PPase (top panels) and those on the luminal side (bottom panels). (B) Topological model of the homodimeric structure of V-PPase.

typically higher than that of those directly adsorbed onto a mica surface.

of V-PPase reconstituted in a lipid bilayer. This study individual the ﬁrst 3D representation of provides V-PPases protruding from the cytosolic and luminal sides of a membrane in aqueous solution.

Proximity of V-PPase C-termini in reconstituted membranes

Topology studies examining heterologous V-PPase expression in yeast suggested that both the C-termini and the N-termini of each subunit are located on the lumen side and are opposite the catalytic domain on the cytosolic side of the vesicular membrane [1]. Because V-PPase is homodimeric, there are two possi- ble conﬁgurations for association of the two subunits; the C-termini of both subunits may protrude from the same side or from opposite sides of the membrane

The volume of the V-PPase homodimers (Vm) in the reconstituted membrane was estimated using the height of the protein protrusion and the thickness of the lipid bilayer as the parameters for the volume of a sphere (Fig. 4B). The volume of reconstituted V-PPase was measured as 332.9 ± 46.9 nm3 (n = 17). The Vprot of a V-PPase homodimer with a molecular mass of 145 kDa, calculated on the basis of the amino acid composition, was determined to be 274.5 nm3 [29]. This theoretical volume correlates very well with that measured from the AFM images. Note that these images were obtained by AFM scanning in a ﬂuid, and therefore probably provide an authentic illustra- tion of V-PPase structure under physiological condi- tions. The AFM images indicate the dimeric structure

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4386

T.-H. Liu et al.

Adjacent C-termini of dimeric H+-pyrophosphatase

[30]. The present study demonstrated two distinct types of protrusions randomly distributed in reconstituted lipid bilayers. If the C-termini of each V-PPase subunit within a dimer protruded from opposite sides of the membrane, the measured heights of these two types of protrusion should presumably be the same. The nega- tive results above thus indicate that the C-termini of the individual subunits of the enzyme are facing the same side of the membrane.

The relative positions and proximity of the V-PPase C-termini on the surface of the reconstituted mem- branes were examined using an IgG antibody against the C-terminal His tag of the enzyme (Fig. 5). The AFM image of the immunolabeled V-PPase showed that protrusions of different heights and widths were randomly distributed on the lipid bilayer (Fig. 5A). The antibody could bind to V-PPase on either one or two

molecules (Fig. 5B). Clearly, Fig. 5B2 depicts that two antibodies bind respectively to a single V-PPase mole- cule in close vicinity. AFM image analysis using spip software was used to generate histograms delineating the distribution of protrusion heights and widths (Fig. 5C,D), and this revealed three major groups of protrusions: (a) lower peaks (peak 1; 1.4 ± 0.2 nm mean height, n = 10) for structures of V-PPase on the lumen side of the membrane lacking bound antibody; (b) intermediate peaks (peak 2; 2.9 ± 0.2 nm mean height, n = 20) for those on the cytosolic side of the membrane; and (c) higher peaks (peak 3; 4.2 ± 0.3 nm mean height, n = 10) for antibodies bound presumably to the lumen side. The ratio of the sum of integrals for peak 1 and peak 3 (free lumen side and antibodies bind- ing to the lumen side) to peak 2 (cytosolic side) is con- sistent with our prior results (approximately 5.6 : 4.4).

Fig. 5. AFM analysis of V-PPase in a reconstituted lipid bilayer immunolabeled with an antibody against His to detect the C-terminal 6·His tag of V-PPase. (A) Image of a large section of immunolabeled lipid bilayer reconstituted in the presence of V-PPase. (B) High-resolution (1) Protrusion showing a single antibody bound to V-PPase. (2) Protrusion showing two images of immunolabeled protrusions in (A). antibodies bound to V-PPase. (C) Histogram of protrusion height determined using the AFM image in (A). (D) Histogram of protrusion width determined using the AFM image in (A).

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4387

T.-H. Liu et al.

Adjacent C-termini of dimeric H+-pyrophosphatase

a

single

IgG molecule

the height of

in the those of its cytosolic sides alone. Moreover, width distribution histogram, the higher peaks (peak 1) represent either cytosolic protrusions of V-PPase lacking GNPs (mean width = 26.3 ± 4.7 nm, n = 17) or the luminal side containing GNP-bound C-termini (mean width = 28.2 ± 1.4 nm, n = 48). Other peaks (peaks 2 and 3) in the width distribution histogram (> 50 nm) probably reﬂect GNP clusters, because (cid:2) 20% of GNPs in solution are visualized as collec- tions after sonication (data not shown).

lipid bilayer,

in the

empirically

determined

using

the

Previous AFM imaging studies have demonstrated that is 2.4 ± 0.1 nm [24]. Taking this value into account, the height of peak 3 protrusions (4.2 ± 0.3 nm, n = 10) would be that of IgG molecules (2.4 ± 0.1 nm) sitting on V-PPase at the lumen side (1.2 ± 0.1 nm, n = 20). There were also two major groups in the histogram representing the distribution of protrusion widths, probably for those of the single IgG molecule (mean width = 41.5 ± 1.8 nm, n = 12; 38.5% of protru- sions) and those of two IgG molecules (mean width = 51.3 ± 0.8 nm, n = 20; 62.5% of protrusions) bound respectively to a V-PPase (Fig. 5D). It is well established that the hinge region of IgG links the two Fab arms to the Fc portion, provid- ing global ﬂexibility to the IgG. The ﬂexibility of the IgG molecule results in Fab ‘elbow bending’, Fab ‘arm waving’ and rotation, and Fc ‘wagging’ [31]. The observed variations in the number of IgG molecules bound to the 6·His-tagged C-termini of V-PPase subunits have presumably arisen from such antibody ﬂexibility. Therefore, the space between the two anti- body molecules could not be precisely determined using current techniques. As a result, we were also unable to accurately determine the proximity of the antibody-binding V-PPase C-termini technique.

The number of GNPs bound to V-PPase C-termini was then predicted using a Microscope Simulator (Com- puter Integrated Systems for Microscopy and Manipula- tion, University of North Carolina, Chapel Hill, NC, USA) (Fig. 6E). The width of the image for a single GNP on mica was as 21.2 ± 1.1 nm (n = 27, data not shown); the theoreti- cal width of a single GNP on the surface of V-PPase was 24 nm (Fig. 6E, solid rhombus). The mean width of GNPs on the surface of V-PPase was empirically mea- sured as 28.2 ± 1.4 nm (n = 48), suggesting that more than one GNP was present on the surface of V-PPase. Because V-PPase is a homodimeric enzyme, it is conceiv- able that one GNP was bound to each C-terminus. Moreover, the distance between two GNPs (reﬂecting that between two V-PPase C-termini) was extrapolated from a simulation plot (Fig. 6E, solid circles). The solid triangle in Fig. 6E reﬂects the mean width of GNPs on the surface of V-PPase, corresponding to a GNP dis- tance of 2.2 ± 1.4 nm. Our results suggest explicitly that the two C-termini of V-PPase are in close proximity.

the heights of

the enzyme (Fig. 6C). The height of

To validate the prediction that the V-PPase C-termini are adjacent, a TEM analysis was used to directly mea- sure the distance between two GNPs bound to the C-ter- mini of puriﬁed V-PPase. The TEM image displays the bound GNPs as solid spheres with a diameter of 2.0 ± 0.2 nm (n = 18) (Fig. 7A). In addition, GNPs bound to V-PPase C-termini occurred in pairs (Fig. 7B), indicating the dimeric structure of the enzyme. The his- togram showing the distribution of distances between GNP pairs observed from the TEM image yields a mean distance of 1.9 ± 0.8 nm (Fig. 7C), concurring with the result generated by AFM analysis of GNP-labeled V-PPase (Fig. 6E; distance = 2.2 ± 1.4 nm). The slight ﬂuctuation in distances between GNP pairs most likely arose from the ﬂexibility of the V-PPase C-termini. For instance, the shorter distance observed indicates two closed GNPs on the C-termini of the enzyme. In con- trast, the longer distance indicates a probable extension of the C-termini of V-PPase. Veriﬁcation of these possi- bilities requires further investigation.

We hence employed Ni2+–nitrilotriacetic acid GNP labeling as an alternative technique to evaluate the proximity of C-termini within V-PPase homodimers. Extremely small Ni2+–nitrilotriacetic acid GNPs were bound to the 6·His tags of V-PPase C-termini recon- stituted in lipid bilayers in aqueous solution, resulting in two major types of protrusion as observed with AFM: the cytosolic side of V-PPase, and the particles bound to the lumen side of V-PPase, respectively (Fig. 6). The solid circle in Fig. 6B indicates GNP bound to V-PPase C-terminus protruding from the surface of the lipid bilayer, whereas the dotted circle, V-PPase protrusion at the lumen side lacking bound GNP (Fig. 6B). More than 70% of V-PPases were covered by GNPs on the luminal side (data not shown). The height distribution histogram indicated that the lower V-PPase protrusions (peak 1) were consistent with those of its cytosolic por- tions, whereas the heights of the higher ones (peak 2) represented those of the GNPs bound to the C-termini of the latter protrusions (4.9 ± 0.1 nm) reﬂects the sum of Ni2+– nitrilotriacetic acid GNP heights (mean height = 2.0 ± 0.1 nm, n = 16) and V-PPase heights on the luminal side (mean height = 1.2 ± 0.1 nm, n = 20). In contrast, the lower V-PPase protrusions represent

The C-terminus of V-PPase has been determined to be relatively conserved among various plant V-PPases,

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4388

T.-H. Liu et al.

Adjacent C-termini of dimeric H+-pyrophosphatase

Fig. 6. AFM analysis of Ni2+–nitrilotriacetic acid GNPs bound to the C-terminal 6·His tag of V-PPase. (A) Lipid bilayer reconsti- tuted in the presence of Ni2+–nitrilotriacetic acid GNP-bound V-PPase. (B) High-resolu- tion image of individual dimeric structures of V-PPase labeled with GNPs in reconstituted membrane. Solid circle, GNP-bound V-PPase protrusion on the luminal side of the recon- stituted membrane; dotted circle, V-PPase protrusion lacking a GNP label on the lumi- nal side of the membrane. (C) Histogram of the protrusion heights determined using the AFM image in (A). (D) Histogram of the pro- trusion widths determined using the AFM image in (A). (E) Simulation of potential V-PPase protrusion widths based on dis- tances between GNP pairs bound to the V-PPase C-termini. Solid rhombus, predicted protrusion width based on a single GNP molecule bound to the C-terminus of V-PPase; solid circle, predicted protrusion widths based on the distance between two GNP molecules bound to V-PPase C-termini; solid triangle, actual protrusion width of GNP-bound V-PPase determined by AFM. Data represent the mean ± SD.

in which the proton channel

and is presumed to be proximal to the catalytic site [32]. In addition, the importance of the V-PPase C- terminus in sustaining enzymatic and proton-translo- cating function and for indirect regulation of K+ binding has been demonstrated [9]. Moreover, inter- subunit interactions of V-PPase are critical for proper enzyme function [10], suggesting that the interface between the two subunits may participate in enzy- matic and proton-pumping reactions. In the present study, AFM measurements and single nanoparticle

analysis using TEM further demonstrated that the two C-termini of V-PPase homodimers are approxi- mately 1.9–2.2 nm apart. In conclusion, our study single V-PPase provides high-resolution images of molecules within a membrane, allowing analysis of the architecture, size and structure of V-PPase in a physiologically relevant environment. We propose a lies at working model the interface between the C-termini of the V-PPase homodimer (Fig. 8).

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4389

T.-H. Liu et al.

Adjacent C-termini of dimeric H+-pyrophosphatase

Fig. 8. A working model of V-PPase. The distance between C-termini of V-PPase is approximately 2.2 nm.

Fig. 7. TEM analysis of Ni2+–nitrilotriacetic acid GNP-labeled (A) TEM image of Ni2+–nitrilotriacetic acid GNP-labeled V-PPase. puriﬁed V-PPase. (B) A gallery of zoomed images for the GNP pairs labelled on puriﬁed V-PPases. the distances between GNP pairs determined using the TEM image in (A).

and the two synthesized oligonucleotides Phis (5¢-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT (5¢-GTACACGCG GTAATTAGTTATGT-3¢) and PMluI the TCTGATCAG-3¢) were inserted into the 3¢-end of pYES2–VPP plasmid to generate the V-PPase–(His)6 tail.

Experimental procedures

Cloning, expression, and puriﬁcation

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4390

The pYES2–VPP–(His)6 cDNA was transferred into the Saccharomyces cerevisiae strain BJ2168 (MATa, prc-407, prb1-1122, pep4-3, leu2, trp1, ura3, GAL) according to the method described previously [34]. The yeast microsomal membranes enriched in 6 · His-tagged V-PPase were pre- pared as described by Kim et al. [35], with minor modiﬁca- tions. Finally, V-PPase-enriched membrane fractions were resuspended in the storage buffer [10 mm Tris/HCl (pH 7.6) and 10% (w/v) glycerol] and stored at )70 (cid:2)C for fur- ther use. The V-PPase (1 mgÆmL)1)-enriched microsomal membrane fraction was solubilized in an extraction buffer [10 mm Tris/HCl (pH 8.0), 400 mm KCl, 15% (w/v) glyc- erol, 1 mm phenylmethanesulfonyl ﬂuoride, 0.1% (w/v) n-dodecyl-b-d-maltoside (DDM)] by adding the detergent DDM dropwise, to a ﬁnal concentration of 6 mgÆmL)1, and gently stirred for 30 min on ice. The solution was diluted with the extraction buffer described above three- fold to ﬁve-fold, and unsolubilized materials were removed by ultracentrifugation at 75 000 g at 4 (cid:2)C for 1 h. The supernatant was incubated with Ni2+–nitrilotriacetic acid beads prewashed with the extraction buffer for 1 h. The Ni2+–nitrilotriacetic acid beads were injected into the empty column and eluted at a ﬂow rate of 0.5 mLÆmin)1 with the elution medium [10 mm Tris/HCl (pH 8.0), 15% (w/v) glycerol, 10 mm b-mercaptoethanol, 1 mm phen- ylmethanesulfonyl ﬂuoride, 0.1% (w/v) DDM] with a step gradient of 20, 40, 60 and 250 mm imidazole, respectively. The fractions with highest PPi hydrolysis activity at 250 mm imidazole were pooled and dialyzed against med- ium containing 10 mm Tris/HCl (pH 8.0), 15% (w/v) glyc- erol, and 0.1% (w/v) Triton X-100, and then stored at )70 (cid:2)C for further studies. The mung bean (Vigna radiata L.) V-PPase cDNA (VPP; accession number P21616) [33] was cloned into the yeast expression vector pYES2 (Invitrogen, Carlsbad, CA, USA),

T.-H. Liu et al.

Adjacent C-termini of dimeric H+-pyrophosphatase

Enzyme assay and protein determination

PPi hydrolytic activity was measured as the release of Pi from PPi in a reaction medium [30 mm Tris/Mes (pH 8.0), 1 mm MgSO4, 0.5 mm NaF, 50 mm KCl, 1 mm PPi, 1.5 lgÆmL)1 gramicidin D, 20–30 lgÆmL)1 microsome protein] at 37 (cid:2)C for 15–20 min. The rate of pyrophosphate hydrolysis is lin- ear with respect to the concentration of V-PPase and reac- tion time under these conditions (data not shown). After incubation, the reaction was terminated with a stop solution [1.7% (w/v) ammonium molybdate, 2% (w/v) SDS, 0.02% (w/v) 1-amino-2-naphthol-4-sulfonic acid]. The released Pi was determined spectrophotometrically as described previ- ously [36,37]. The protein concentration was calculated by a modiﬁed Bradford method with BSA as the standard [38].

Measurement of proton translocation

minor modiﬁcations. One hundred milligrams of soybean phosphatidylcholine and 20 mg of cholesterol were dissolved in 1 mL of chloroform. The lipid mixture was dried in a vac- uum chamber, and then suspended in 1 mL of suspension medium [0.25 m sorbitol, 1 mm MgSO4, 0.1 mm EGTA, 2 mm dithiothreitol, 10 mm Tricine-Na (pH 7.5)]. The sus- pension was sonicated in a bath-type sonicator for 5 min at 4 (cid:2)C. The sonicated lipid mixture (15 lL) was added to 1 mL of 50 lgÆmL)1 V-PPase solution, and SM-2 Bio-Beads (Bio- Rad Laboratories, Hercules, CA, USA) were added to the mixture at 0.25 mgÆlL)1. The mixture was stored for 1 h on ice with gentle agitation, and the beads were then removed by ﬁltration through a paper ﬁlter. The mixture was applied to a Sephadex G-50 column equilibrated with 0.25 m sorbitol, 10 mm Tricine-Na (pH 7.5), 1 mm MgSO4, 0.1 mm EGTA and 2 mm dithiothreitol to remove NaCl and glycerol. The proteoliposome fraction was then frozen in liquid nitrogen, thawed on ice, and sonicated for 20 s at 4 (cid:2)C in a bath-type sonicator. The proteoliposomes thus obtained were immedi- ately used for measurement of proton-translocating activity.

Immunoﬂuorescence microscopy

[34,39–41]. The ionophore,

Proton translocation was measured as the initial rate of ﬂu- orescence quenching of acridine orange (excitation wave- length, 495 nm, emission wavelength, 530 nm) as described previously [34,39–41]. The reaction mixture for proton (pH 8.0), 1 mm translocation contained 5 mm Tris/HCl (pH 7.6), 400 mm glycerol, 100 mm KCl, EGTA/Tris 1.3 mm MgSO4, 5 lm acridine orange, and 100 lgÆmL)1 microsomes. The reaction was initiated by adding 1 mm sodium pyrophosphate (pH 7.6). The initial rate of ﬂuores- cence quenching was calculated as the proton transport activity gramicidin D (5 lgÆmL)1), was then included at the end of each assay to conﬁrm the integrity of the membrane.

SDS/PAGE and western analysis

V-PPase proteoliposomes were prepared on glass coverslips and then fused into the lipid bilayer. After being washed with NaCl/Pi, the coverslips were placed in blocking solution [NaCl/Pi containing 3% (w/v) BSA] for 30 min at room tem- perature. Samples were then incubated with mouse monoclo- nal antibody against the C-terminal 6·His tag of V-PPase in NaCl/Pi (1 lgÆmL)1) for 2 h at room temperature. After being rinsed with NaCl/Pi, samples were subsequently incu- bated with carboxymethylindocyanine 3-coupled goat anti- (mouse IgG) as secondary antibody (1 lgÆmL)1) for 2 h at room temperature [43]. Samples were then washed again with NaCl/Pi. Fluorescence images were captured using an Olym- pus BX51 microscope with a 100· oil lens (Olympus, Tokyo, Japan). Immunoﬂuorescence images were collected with the green channel ﬁlter set (excitation wavelength, 525 nm; emis- sion wavelength, 585 nm) for V-PPases. Bilayers reconsti- tuted under several conditions were also imaged as controls.

Immunolabeling of reconstituted V-PPase

to positions 261–275 of the C-terminal 6·His

The lipid bilayer reconstituted with V-PPases on mica was incubated for 2 h at room temperature with a mouse mono- clonal antibody against tag of V-PPase (1 lgÆmL)1) and then washed twice with NaCl/Pi. Finally, the specimen was imaged by AFM.

SDS/PAGE was performed according to Laemmli [42]. Denatured proteins were subjected to SDS/PAGE on a Phast System (Pharmacia, Uppsala, Sweden) with a 12.5% (w/v) polyacrylamide PhastGel. The gels were stained with Coomassie Blue or electrotransferred to a poly(vinylidene diﬂuoride) membrane by using semidry electrotransblotting apparatus (Nova Blot, Amersham Pharmacia Biotech, Piscataway, NJ, USA). The blots were incubated with the rabbit polyclonal antibody raised against the MAP (Mito- gen-activated protein kinase)-conjugated synthetic peptide the sequence KVERNIPEDDPRNPA, which corre- of sponds the substrate-binding domain of mung bean V-PPase. Bands of immunoblots were visualized using a chemiluminescence kit (New England Nuclear, Boston, MA, USA), according to the manufacturer’s recommendations.

Ni2+–nitrilotriacetic acid GNP labeling of reconstituted V-PPase

Reconstitution of V-PPase into the lipid bilayer

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4391

The lipid bilayer reconstituted with V-PPases was incubated for 2 h at room temperature with Ni2+–nitrilotriacetic acid Puriﬁed V-PPase was reconstituted into the lipid bilayer according to the protocol described by Sato et al. [13], with

T.-H. Liu et al.

Adjacent C-termini of dimeric H+-pyrophosphatase

Nanogold solution (Nanoprobes, NY, USA), washed twice with NaCl/Pi, and then subjected to AFM imaging. V2 is the speciﬁc volume of water (1 cm3Æg)1), and d is a factor describing the extent of hydration for air-dried pro- teins (0.4 mol H2O/mol protein) [44].

AFM

TEM image analysis

electron microscope transmission Twenty microliters of C-terminal 6·His tag of V-PPase (10 lgÆmL)1) was incubated with 5 lL (0.01 nm) of Ni2+– nitrilotriacetic acid Nanogold for 24 h at 4 (cid:2)C. Samples were then centrifuged at 13 400 · g for 1 min. The speci- mens were examined with a Philips Tecnai F20 high-resolu- tion (Fa. Philips, Eindhoven, the Netherlands) operating at 200 keV.

Acknowledgements

This work was supported by grants from National Science Council, Republic of China: NSC 96-2627- M-007-003 and NSC 97-2627-M-007-003 to R. L. Pan, NSC 96-2627-M-009-001 to S. K. Fan, NSC 96-2627- M-007-004 to C. C. Fu, and NSC 96-2627-M-007-003 to F. G. Tseng.

References

1 Maeshima M (2000) Vacuolar H+-pyrophosphatase. Biochim Biophys Acta 1465, 37–51. 2 Tzeng CM, Yang CY, Yang SJ, Jiang SS, Kuo SY,

Hung SS, Ma JT & Pan RL (1996) Subunit structure of vacuolar proton pyrophosphatase as determined by radiation inactivation. Biochem J 316, 143–147. AFM was performed in the contact mode using a Nano- scope IIIa Multimode atomic force microscope equipped with an E-type scanner (Digital Instruments, Santa Bar- bara, CA, USA) and a Picoplus instrument (Molecular Imaging, MI, USA). Muscovite mica (Electron Microscopy Sciences, Hatﬁeld, PA, USA) was freshly cleaved and immediately covered with adsorption buffer [10 mm Tris/ HCl (pH 7.8), 300 mm KCl, 25 mm MgCl2]. Subsequently, 10 lgÆmL)1 of protein solution was dropped onto the mica surface. After 1 h, the sample was rinsed with imaging buf- fer [10 mm Tris/HCl (pH 7.8), 150 mm KCl]. V-shaped sili- con nitride (Si3N4) cantilevers with spring constants of 0.08 NÆm)1 (Olympus, Tokyo, Japan) were used for all AFM image scanning. The set point was adjusted to the highest setting without signiﬁcant noise to minimize the force applied to the sample. All AFM imaging of lipid reconstituted V-PPase was bilayers with/or without performed in the imaging buffer at room temperature (22–23 (cid:2)C). All images were captured at 512 · 512 pixel resolution and processed using nanoscope III software (Digital Instruments, Santa Barbara, CA, USA) and spip software (Scanning Probe Image Processor; Image Metrol- ogy, Lyngby, Denmark). In general, AFM images were low-pass ﬁltered, and single protein images were further passed through an additional Gaussian ﬁlter to reduce pixi- lation. Sizes and statistics of puriﬁed and reconstituted pro- teins were obtained from 20–50 protrusion features for each molecule in the height image.

3 Drozdowicz YM & Rea PA (2001) Vacuolar proton- pyrophosphatases: from the evolutionary backwaters into the mainstream. Trends Plant Sci 6, 206–211. 4 Rea PA, Kim Y, Saraﬁan V, Poole RJ, Davies JM &

Molecular volume measurements of membrane proteins

Sanders D (1992) Vacuolar H+-translocating pyrophos- phatases: a new category of ion translocase. Trends Biochem Sci 17, 348–353. 5 Gordon-Weeks R, Steele SH & Leigh RA (1996) The

The volume of a single membrane protein or protein sub- structure (Vprot) was calculated using the volume equation for a sphere [Vm = (4/3)pr3]. In addition, the volume of a single soluble or puriﬁed protein was calculated by regard- ing the molecule as a segment of a sphere, using Eqn (1) [29]:

ð1Þ Vs ¼ ðph=6Þð3r2 þ h2Þ role of magnesium, pyrophosphate, and their complexes as substrates and activators of the vacuolar H+-pump- ing inorganic pyrophosphatase (studies using ligand protection from covalent inhibitors). Plant Physiol 111, 195–202.

where Vs is the molecular volume, and h and r are the height and the radius (half of the measured width) of the protein, respectively. 6 Walker RR & Leigh RA (1981) Mg2+-dependent, cat- ion-stimulated inorganic pyrophosphatase associated with vacuoles isolated from storage roots of red beet (Beta vulgaris L.). Planta 153, 150–155. In addition, molecular volume based on molecular mass was calculated using the Eqn (2):

ð2Þ Mo ¼ ðNAVprotÞ=ðV1 þ dV2Þ

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4392

7 Maeshima M (1991) H+-translocating inorganic pyro- phosphatase of plant vacuoles: inhibition by Ca2+, stabilization by Mg2+ and immunological comparison with other inorganic pyrophosphatases. Eur J Biochem 196, 11–17. where NA is the Avogadro constant (6.022 · 1023Æmol)1), V1 is the partial speciﬁc volume of the protein (0.74 cm3Æg)1),

T.-H. Liu et al.

Adjacent C-termini of dimeric H+-pyrophosphatase

8 Baykov AA, Dubnova EB, Bakuleva NP, Evtushenko 21 Liu LN, Aartsma TJ & Frese RN (2008) Dimers of

OA, Zhen RG & Rea PA (1993) Steady-state kinetics of substrate hydrolysis by vacuolar H+-pyrophosphatase. A simple three-state model. FEBS Lett 327, 199–202.

light-harvesting complex 2 from Rhodobacter sphaero- ides characterized in reconstituted 2D crystals with atomic force microscopy. FEBS J 275, 3157–3166. 22 Bahatyrova S, Frese RN, Siebert CA, Olsen JD, van Der Werf KO, van Grondelle R, Niederman RA, Bullough PA, Otto C & Hunter CN (2004) The native architecture of a photosynthetic membrane. Nature 430, 1058–1062. 9 Lin HH, Pan YJ, Hsu SH, Van RC, Hsiao YY, Chen JH & Pan RL (2005) Deletion mutation analysis on C-terminal domain of plant vacuolar H+-pyrophospha- tase. Arch Biochem Biophys 442, 206–213.

10 Yang SJ, Ko SJ, Tsai YR, Jiang SS, Kuo SY, Hung SH & Pan RL (1998) Subunit interaction of vacuolar H+-pyrophosphatase as determined by high hydrostatic pressure. Biochem J 331, 395–402. 23 Fotiadis D, Liang Y, Filipek S, Saperstein DA, Engel A & Palczewski K (2003) Atomic-force microscopy: rhodopsin dimers in native disc membranes. Nature 421, 127–128.

11 Maeshima M (1990) Oligomeric structure of H+-trans- locating inorganic pyrophosphatase of plant vacuoles. Biochem Biophys Res Commun 168, 1157–1162. 12 Saraﬁan V, Potier M & Poole RJ (1992) Radiation- 24 Schneider SW, La¨ rmer J, Henderson RM & Oberleith- ner H (1998) Molecular weights of individual proteins correlate with molecular volumes measured by atomic force microscopy. Pﬂu¨gers Arch 435, 362–367. 25 Geisse NA, Cover TL, Henderson RM & Edwardson

inactivation analysis of vacuolar H+-ATPase and H+- pyrophosphatase from Beta vulgaris L. Functional sizes for substrate hydrolysis and for H+ transport. Biochem J 283, 493–497. JM (2004) Targeting of Helicobacter pylori vacuolating toxin to lipid raft membrane domains analysed by atomic force microscopy. Biochem J 381, 911–917. 26 Gallova´ J, Uhrı´ kova´ D, Islamov A, Kuklin A &

Balgavy´ P (2004) Effect of cholesterol on the bilayer thickness in unilamellar extruded DLPC and DOPC liposomes. Gen Physiol Biophys 23, 113–128. 13 Sato MH, Kasahara M, Ishii N, Homareda H, Matsui H & Yoshida M (1994) Puriﬁed vacuolar inorganic pyrophosphatase consisting of a 75-kDa polypeptide can pump H+ into reconstituted proteoliposomes. J Biol Chem 269, 6725–6758. 27 Ho¨ rber JKH & Miles MJ (2003) Scanning probe evolu- tion in biology. Science 302, 1002–1005.

28 Engel A & Mu¨ ller DJ (2000) Observing single biomole- cules at work with the atomic force microscope. Nat Struct Biol 7, 715–718.

14 Lo´ pez-Marque´ s RL, Pe´ rez-Castin˜ eira JR, Buch-Peder- sen JB, Marco S, Rigaud JL, Palmaren MG & Serrano A (2005) Large-scale puriﬁcation of the proton pumping pyrophosphatase from Thermotoga maritina: a ‘Hot-Solve’ method for isolation of recombinant thermophilic membrane proteins. Biochim Biophys Acta 1716, 69–76. 29 Schneider S, Folprecht G, Krohne G & Oberleithner H (1995) Immunolocalization of lamins and nuclear pore complex proteins by atomic force microscopy. Pﬂu¨gers Arch 430, 795–801.

15 Dufrene YF & Lee GU (2000) Advances in the charac- terization of supported lipid ﬁlms with the atomic force microscope. Biochim Biophys Acta 1509, 14–41. 16 Rinia HA & de Kruijff B (2001) Imaging domains in 30 Rapp M, Seppa¨ la¨ S, Granseth E & von Heijne G (2007) Emulating membrane protein evolution by rational design. Science 315, 1282–1284. 31 Brekke OH, Michaelsen TE & Sandlie I (1995) The model membranes with atomic force microscopy. FEBS Lett 504, 194–199.

structural requirements for complement activation by IgG: does it hinge on the hinge? Immunol Today 16, 85–90.

17 Yuan C & Johnston LJ (2001) Atomic force microscopy studies of ganglioside GM1 domains in phosphatidyl- choline and phosphatidylcholine/cholesterol bilayers. Biophys J 81, 1059–1069.

32 Takasu A, Nakanishi Y, Yamauchi T & Maeshima M (1997) Analysis of the substrate binding site and car- boxyl terminal region of vacuolar H+-pyrophosphatase of mung bean with peptide antibodies. J Biochem 122, 883–889. 18 Slade A, Luh J, Ho S & Yip CM (2002) Single molecule imaging of supported planar lipid bilayer-reconstituted human insulin receptors by in situ scanning probe microscopy. J Struct Biol 137, 283–291. 19 Saslowsky DE, Lawrence J, Ren X, Brown DA,

33 Hung SH, Chiu SJ, Lin LY & Pan RL (1995) A cDNA clone encoding the A subunit of the vacuolar H+-AT- Pase from etiolated mung bean seedlings. Plant Physiol 109, 1125–1127. 34 Hsiao YY, Van RC, Hung SH, Lin HH & Pan RL Henderson RM & Edwardson JM (2002) Placental alkaline phosphatase is efﬁciently targeted to rafts in supported lipid bilayers. J Biol Chem 277, 26966–26970. 20 Milhiet PE, Giocondi MC, Baghdadi O, Ronzon F,

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4393

(2004) Roles of histidine residues in plant vacuolar H+- pyrophosphatase. Biochim Biophys Acta 1608, 190–199. 35 Kim EJ, Zhen RG & Rea PA (1995) Site-directed muta- genesis of vacuolar H+-pyrophosphatase: necessity of Roux B & LeGrimellec C (2002) Spontaneous insertion and partitioning of alkaline phosphatase into model lipid rafts. EMBO Rep 3, 485–490.

T.-H. Liu et al.

Adjacent C-termini of dimeric H+-pyrophosphatase

In Methods in Enzymology, vol. 55 (Fleischer S & Packer L eds), pp 547–569. Academic Press, New York. Cys634 for inhibition by maleimides but not catalysis. J Biol Chem 270, 2630–2635. 41 Clerc S & Barenholz Y (1998) A quantitative

model for using acridine orange as a transmembrane pH gradient probe. Anal Biochem 259, 104–111. 42 Laemmli UK (1970) Cleavage of structural proteins 36 Fiske CH & Subbarow Y (1925) The colorimetric deter- mination of phosphorus. J Biol Chem 66, 375–400. 37 Wang MY, Lin YH, Chow WM, Chung TP & Pan RL (1989) Puriﬁcation and characterization of tonoplast ATPase from etiolated mung bean seedlings. Plant Physiol 90, 475–481. during the assembly of the head of bacteriophage T4. Nature (Lond) 222, 680–685.

38 Bradford M (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 72, 248–254. 43 Lin H, Zhu YJ & Lal R (1999) Amyloid beta protein (1–40) forms calcium-permeable Zn2+-sensitive channel in reconstituted lipid vesicles. Biochemistry 38, 11189–11196.

FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS

4394

39 Rea PA & Turner JC (1990) Tonoplast adenosine triphosphatase and inorganic pyrophosphatase. In Methods in Plant Biochemistry, vol. 3 (Lea PJ ed), pp 385–405. Academic Press, London. 40 Rottenberg H (1979) The measurement of membrane 44 Edstrom RD, Meinke MH, Yang R, Yang X, Elings V & Evans DF (1990) Direct visualization of phosphory- lase–phosphorylase kinase complexes by scanning tunneling and atomic force microscopy. Biophys J 58, 1437–1448. potential and deltapH in cells, organelles, and vesicles.