Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle

A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle Lydie Laure*, Nathalie Danie` le*, Laurence Suel, Sylvie Marchand, Sophie Aubert, Nathalie Bourg, Carinne Roudaut, Ste´ phanie Duguez, Marc Bartoli and Isabelle Richard

Ge´ ne´ thon, CNRS UMR8587 LAMBE, Evry, France

Keywords calpain 3; cardiac ankyrin repeat protein; limb girdle muscular dystrophy 2A; NF-jB; skeletal muscle; titin

Correspondence I. Richard, Ge´ ne´ thon, CNRS UMR8587 Lambe, 1 bis rue de l’Internationale, 91000 Evry, France Fax: +33 (0) 1 60 77 86 98 Tel: +33 (0) 1 69 47 29 38 E-mail: richard@genethon.fr

*These authors contributed equally to this work

(Received 1 June 2010, revised 11 August 2010, accepted 18 August 2010)

doi:10.1111/j.1742-4658.2010.07820.x

A multiprotein complex encompassing a transcription regulator, cardiac ankyrin repeat protein (CARP), and the calpain 3 protease was identified in the N2A elastic region of the giant sarcomeric protein titin. The present study aimed to investigate the function(s) of this complex in the skeletal muscle. We demonstrate that CARP subcellular localization is controlled by the activity of calpain 3: the higher the calpain 3, the more important the sarcomeric retention of CARP. This regulation would occur through cleavage of the N-terminal end of CARP by the protease. We show that, upon CARP over-expression, the transcription factor nuclear factor NF-jB p65 DNA-binding activity decreases. Taken as a whole, CARP and its reg- ulator calpain 3 appear to occupy a central position in the important cell fate-governing NF-jB pathway. Interestingly, the expression of the atro- phying protein MURF1, one of NF-jB main targets, remains unchanged in presence of CARP, suggesting that the pathway encompassing cal- pain3 ⁄ CARP ⁄ NF-jB does not play a role in muscle atrophy. With NF-jB also having anti-apoptotic effects, the inability of calpain 3 to lower CARP-driven inhibition of NF-jB could reduce muscle cell survival, hence partly accounting for the dystrophic pattern observed in limb girdle muscu- lar dystrophy 2A, a pathology resulting from the protease deficiency.

Structured digital abstract l MINT-7990388: Titin (uniprotkb:Q8WZ42) physically interacts (MI:0915) with CARP (uni-

protkb:Q9CR42) by two hybrid (MI:0018)

l MINT-7990374: calpain 3 (uniprotkb:P20807) physically interacts (MI:0915) with Titin (uni-

protkb:Q8WZ42) by two hybrid (MI:0018)

l MINT-7990342: calpain 3 (uniprotkb:P20807) physically interacts (MI:0915) with CARP (uni-

protkb:Q9CR42) by two hybrid (MI:0018)

Introduction

Calpain 3 is a muscle specific, calcium dependent, multi-substrate cysteine protease whose mutations are limb girdle muscular dystrophy 2A the cause of

(LGMD2A, OMIM 253600), a severe muscle disorder leading to selective atrophy and weakness of proximal muscles [1,2]. Calpain 3 becomes activated once an

Abbreviations Ankrd2, ankyrin repeat domain-containing protein 2; CARP, cardiac ankyrin repeat protein; DARP, diabetes-related ankyrin repeat protein; FRAP, fluorescence recovery after photobleaching; GFP, green fluorescent protein; MARP, muscle ankyrin repeat proteins; NF, nuclear factor; NLS, nuclear localization signals; qRT-PCR, quantitative RT-PCR; ROI, region of interest; TA, tibialis anterior; YFP, yellow fluorescent protein.

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4322

L. Laure et al.

Regulation of CARP by calpain 3

view, CARP is known to act as a transcriptional regula- tor. Indeed, CARP can bind to DNA [19] and inhibits the transcription of MLC-2V by association with the transcription factor YB1 in the heart [21].

internal propeptide is removed from its active site by an auto-proteolytic process [3]. Although the large majority of the substrates identified are structural pro- teins [3–5], proteins involved in cell metabolism [5–7] and in the regulation of gene and protein expression [2,7–9] were also suggested to be potential calpain 3 substrates. Taken together, the ensuing cleavages were proposed to play a role in three major physiological processes: the orchestration of sarcomere remodeling [10–12], the control of apoptosis [9,13] and the regula- tion of gene expression [2,7–9].

transcription factors,

Considering that (a) a molecular complex encom- passes calpain 3 and CARP in the N2A elastic region [18]; (b) exercise stimulates both calpain 3 activity [44] and CARP expression [30] in skeletal muscle; (c) cal- pain 3 was previously suggested to cleave unidentified regulators of transcription [9]; and (d) a member of the MARP family was previously demonstrated to be cleaved by calpain 3 [29], the present study aimed to identify the possible functional relationship(s) between CARP and calpain 3 and the physiological pathway(s) under control. We first showed that calpain 3 cleaves CARP in vitro. Once cleaved, the long C-terminal part of CARP is more efficiently bound to titin, possibly impeding CARP nuclear translocation and any subse- quent gene expression regulation. In addition, we dem- the transcriptional onstrated that CARP regulates activities of several including nuclear factor NF-jB p65. Together, CARP and con- sequently calpain 3 appear to have a central role in the regulation of the important cell fate-governing NF-jB pathway.

Results

CARP is a substrate of calpain 3

Calpain 3 is found in several different subcellular localizations within the muscle fiber, notably in associa- tion with three regions of titin, a giant structural protein spanning half the sarcomere [3,14,15]. Two of these regions, the N2A region and the M line, are involved in the transmission of mechanical signals to signaling path- ways. In the M line, mechanical stimulation activates the interaction of a protein complex with the kinase domain of titin, reducing the nuclear translocation of the transcription factor SRF and impeding gene tran- scription [16]. In the elastic N2A region, mechanical activity stimulates the expression of the muscle ankyrin repeat proteins (MARPs), a family of gene expression regulators [17,18]. Passive stretch also induces a subcel- lular redistribution of the MARPs, suggesting a titin- N2A-mediated link between stress signals and gene expression [18]. The MARP family is composed of three proteins, ankyrin repeat domain-containing protein 2 (Ankrd2), cardiac ankyrin repeat protein (CARP) and diabetes-related ankyrin repeat protein (DARP), grouped together with respect to their common minimal structure and their potential role in the control of tran- scription [17,19–21]. Although the three MARPs are expressed in both heart and skeletal muscle [18,22,23], Ankrd2 is mainly expressed in skeletal muscle [18,24,25], CARP in the heart [18,21,26–28] and DARP in equiva- lent amounts in both tissues [20].

Considering the sarcomeric localization of both CARP and calpain 3 and the fact that calpain 3 cleaves another member of the MARPs family, the possibility that CARP could be processed by active calpain 3 was investigated. A direct, in vitro digestion of CARP by calpain 3 using recombinant proteins could not be attempted because calpain 3 is inactivated during purifi- cation [45]. In skeletal muscle cells, calpain 3 is consid- ered to be inactive until specific signals trigger its dissociation from a muscle specific inhibitor [46]. We therefore tested our hypothesis using ectopic gene expression in non muscular cells, the only system lead- ing to uncontrolled activation of calpain 3. NIH-3T3 fibroblasts were transfected with expression plasmids encoding CARP (pcDNA-CARP-V5) in the presence of wild-type or catalytically-inactive C129S-mutated calpain 3 (encoded by pYFP-C3-CFP and pYFP-C3- C129S-CFP, respectively). The activation of the protease was confirmed by the appearance of an autolysis band at approximately 55 kDa on a calpain-specific western blot (Fig. 1A). CARP detection was performed using an antibody raised against the C-terminal V5 epitope. In the presence of the protease-dead C129S calpain 3,

Interestingly, Ankrd2 was previously suggested to be cleaved by calpain 3 [29] but CARP, which was shown to be the first MARP whose expression increases in response to exercise in skeletal muscle [30], was not assessed as a substrate. The structure of CARP com- prises several ankyrin-like repeats, PEST motifs (i.e. regions of protein instability rich in proline, glutamic acid, serine and threonine) and putative nuclear locali- zation signals (NLS) [18,19,26,28]. In the heart, CARP expression increases in remodeling conditions associ- ated with pathological hypertrophy [31–34]. In the skel- etal muscle, CARP expression is low under basal conditions but was reported to be induced in several conditions such as exercise [30,35–38], atrophy [26] and muscle pathologies [39–43]. From a molecular point of

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4323

L. Laure et al.

Regulation of CARP by calpain 3

Fig. 1. CARP is a substrate of calpain 3. (A) Western blot analysis performed on NIH3T3 extracts over-expressing V5-tagged CARP in the presence of either wild-type or C129S-mutated calpain 3. The appearance of a 37-kDa CARP proteolytic fragment shows that CARP is cleaved in presence of active calpain (V5 specific staining; upper panel). The activation of calpain 3 is verified by the detection of the 58 and 55 kDa autolysis fragments (calpain 3 specific staining; lower panel). (B) Yeast two-hybrid assessment of calpain 3-CARP interaction. The calpain 3 construct was mutated on its active site to prevent uncontrolled proteolysis. Yeasts resulting from the mating of clones trans- formed with calpain 3 or CARP were grown on Trp-Leu- (control medium; lower panels) or Trp-Leu-His- medium (selective medium; upper panels). As a positive control, an interaction test of calpain 3 and N2A-titin is performed (upper left panel). The yeasts carrying calpain 3 and CARP grow on the selective medium, indicating that CARP and calpain 3 interact (upper middle panel). (C) Schematic representation of CARP structure (top) and sequence (bottom) indicating the presence of two PEST domains (light gray colored box), a coiled-coil region (gray colored box), five ankyrin repeats (five dark gray boxes), two core NLS (in red) and a bipartite NLS (in yellow; the bipartite NLS encompass- ing one of the core NLS). The region of interaction with titin-N2A is highlighted in bold ⁄ blue, as well as by bold ⁄ blue underlined characters in the sequence. The consensus site for calpain 3 cleavage and the positions of the three imperfect cleavage sequences identified in CARP are shown at the bottom. The truncated constructs (DNter1-4 and NterCARP) are shown below the CARP structure and the calpain 3 cleav- age site is indicated by an arrow. (D) Western blot analysis performed on NIH3T3 extracts over-expressing either the full-length or the trun- cated CARP constructs (DNter1–4). The molecular weight of DNter2 matches the lower band detected when CARP is co-expressed with calpain 3 (37 kDa band; compare the first and the fourth lane). (E) Western blot analysis performed on NIH3T3 extracts over-expressing CARP or the truncated DNter1 or DNter2 CARP constructs, in the presence or absence of calpain 3. DNter1 is cleaved when co-expressed with calpain 3, whereas DNter2 is not.

CARP migrates at an apparent molecular weight of approximately 40 kDa. A lower band is clearly visible in the presence of wild-type calpain 3 (37 kDa for the shorter form), demonstrating that CARP is cleaved in the presence of calpain 3 in vitro (Fig. 1A).

site is between amino acids 30 and 71. Interestingly, in this region, three overlapping sequences fit the poten- tial consensus recently reported for calpain 3 cleavage [47]. Since sites almost perfectly (Fig. 1C, bottom) these sequences are localized between amino acids 65 and 88 and the cleavage site is localized before amino acid 71, the region of cleavage would be between amino acids 65 and 71. Considering the location of the N-terminal extremity of DNter2 on the structure of CARP and the presence of the potential cleavage sites, we identified the localization of the cleavage site within a predicted coiled-coil domain (Fig. 1B).

Calpain 3-mediated CARP cleavage strengthens its interaction with titin N2A

CARP and calpain 3 interaction was tested using yeast two-hybrid experiments. Because the ectopic expression of wild-type calpain 3 leads to uncontrolled proteolysis, a construct encoding catalytically inactive calpain 3 fused to GAL 4 binding domain (pAS-C3) was used as a bait and a construct encoding CARP fused with the activation domain (pGAD-CARP) was used as a prey. The yeasts resulting from the mating of clones transformed with either calpain 3 or CARP grow on Leu-Trp-His- selection medium, indicating that calpain 3 and CARP interact (Fig. 1B). The fact that calpain 3 interacts directly with CARP supports the idea that the cleavage is direct.

therefore

Efforts to identify CARP cleavage site by protein con- sequencing were unsuccessful. We structed several N-terminal truncated forms of CARP (pDNter1, pDNter2, pDNter3 and pDNter4; see Materi- als and methods) with respect to the different domains of this protein (Fig. 1C). First, after expression in NIH3T3, their migration patterns were compared by immunoblotting with the profiles observed upon cal- pain 3 mediated-CARP cleavage (Fig. 1D). The plas- mid pDNter2 produces a band that matches exactly CARP cleaved C-terminal fragment (with an apparent molecular weight of 37 kDa on SDS ⁄ PAGE). Second, the migration patterns of CARP, DNter1 or DNter2 in presence or absence of calpain 3 were compared cleaved when co- (Fig. 1E). Although DNter1 is expressed with calpain 3, DNter2 remains unchanged (Fig. 1E), suggesting that the position of the cleavage

A core and a bipartite NLS were previously identified around the CARP cleavage site within the coiled-coil region (positions 71–74 and 59–76) [28]. We therefore investigated whether calpain 3 activity could influence CARP subcellular localization. Plasmids encoding fluo- rescent fusion-proteins corresponding to CARP before and after cleavage by calpain 3 (pYFP-CARP-CFP- HIS, pYFP-DNter2-CFP-HIS and pYFP-Nter-CFP- HIS) were injected and transferred by electroporation in tibialis anterior (TA) muscles of 129SvPasIco wild- type mice. Seven days later, the muscles were exposed and submitted to direct observation using a confocal microscope and an excitation wavelength of 514 nm for yellow fluorescent protein (YFP) emission. The set- ting for the CFP emission (excitation wavelength of 457 nm) was also attempted, but the fluorescence was much weaker than YFP and the images were blurry, impeding their analysis. We therefore used YFP fluo- rescence only for further analysis.

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4324

L. Laure et al.

Regulation of CARP by calpain 3

The

staining for pYFP-CARP-CFP-HIS clearly demonstrated a mixed nuclear and cytoskeletal pattern (Fig. 2A; note the striated pattern of fluorescence at higher magnification, lower left panel), as previously found in heart cells, where it was initially identified as a partner of skeletal muscle titin-N2A [18]. An analysis of CARP expression in the subcellular compartments

obtained from the muscle of the mice injected with pYFP-CARP-CFP-HIS confirms the presence of the protein in the nucleus and on the cytoskeletal fraction (Fig. 2B). Because we also confirmed using a two- hybrid assay that CARP is able to interact with titin- N2A (Fig. 2D, top left panel), the fluorescent cytoskel- etal staining most likely corresponds to the sarcomeric

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4325

L. Laure et al.

Regulation of CARP by calpain 3

expression in 129SvPasIco mice, only a minor propor- tion of the CARP substrate is cleaved, as indicated by the clear sarcomeric pattern (Fig. 2A, upper left panel). Considering that the weak proportion of YFP-Nter protein resulting from the cleavage cannot be bleached, the comparison of the FRAP results obtained with CARP or DNter2 in wild-type animals does not take into account anything else other than the motilities of these proteins. These results suggest that, once cleaved by calpain 3, the C-terminal region of CARP binds more efficiently to the sarcomeric N2A region, possibly reducing CARP nuclear translocation.

location of titin-N2A. In the nucleus, a spotted pattern is clearly distinguished at very high magnification, sug- gesting that CARP is localized into a very peculiar, yet unidentified, nuclear subcompartment (Fig. 2A, lower right panel). This pattern is reminiscent of the PML bodies, a compartment in which Ankrd2 has previously been observed [17]. The localization of pYFP-DNter2- CFP-HIS is undistinguishable from the pYFP-CARP- CFP-HIS localization (Fig. 2C, upper panel). By contrast, the short fragment CARP-Nter has a very different localization pattern. Indeed, its expression is scattered throughout the fiber without any sarcomeric pattern, and it does not translocate into the nucleus (Fig. 2C, lower panel). This undefined localization, taken together with the absence of physiologically rele- vant protein domains in this region, suggests that this fragment is probably devoid of biological activity.

suggesting that

Because CARP was previously suggested to be able to form a dimer [49], we aimed to determine whether the cleavage of a molecule of CARP could affect the sarcomeric binding of another uncleaved CARP mole- cule. Accordingly, we compared CARP subcellular localization in the presence or absence of calpain 3 using a new calpain 3 knockout mouse model (C3- null) generated by disruption of the calpain 3 gene using homologous recombination (Figs S1 and S2 and Doc. S1). Although a weak quantity of calpain 3 mutated mRNA is still expressed (< 20% of the wild- type level) (Fig. S1B), western blot analysis confirmed the complete knockout of the protein in this murine model (Fig. S1C). CARP subcellular localization and mobility were assessed after injection of a plasmid encoding pYFP-CARP-CFP-HIS in the TA muscles of C3-null and 129SvPasIco strains. Since CARP will not be processed by calpain 3 in C3 deficient animals and will only be slightly processed in wild-type animals, the full-length CARP protein is therefore the main YFP-tagged protein present in both cases. With respect to CARP localization, no significant difference was noted: in both models, CARP is localized in the nucleus, as well as on the fiber sarcomere, easily recog- nizable by the striated pattern of the fluorescence (Fig. 3A). In FRAP experiments (Fig. 3B), the fluores- cence recovery speed is significantly slower in wild- than in calpain 3 deficient muscles type muscles (Fig. 3C), the interaction between CARP and titin is reinforced in the presence of cal- pain 3. These results suggest that the calpain 3-medi- ated cleavage of some molecules of CARP reinforces the interaction of other unprocessed CARP molecules with the sarcomere.

To further investigate the possibility of translocation in between various cell compartments, the strength of the interaction between CARP and the muscle sarco- mere was assessed in vitro using a two-hybrid assay and in vivo using fluorescence recovery after photobleaching (FRAP). Two-hybrid experiments were carried out between yeast competent cells transformed either with pAS-N2A-titin fused with GAL4-binding domain or pGAD-CARP or DNter2 fused with GAL4-activation domain. The growth of the clones is more important when titin-N2A is expressed with DNter2, suggesting that the weak interaction detected between CARP and titin-N2A is reinforced after CARP cleavage (Fig. 2D). FRAP analysis is commonly used to quantify the mobility of a fluorescent molecule in a cell compart- ment of interest [48]. FRAP experiments were carried out after injection of pYFP-CARP-CFP-HIS, pYFP- DNter2-CFP-HIS or pYFP-Nter-CFP-HIS in the TA of 129SvPasIco mice. The fluorescence recovery speed observed in the presence of the Nter protein is so rapid that we could not even bleach a region of interest (ROI) efficiently, impeding FRAP measurement (data not shown). This result suggests that the short N-ter- minal CARP fragment is freed from the sarcomere, which is consistent with the results obtained by direct localization of the fluorescence and with the fact that this fragment does not bear the binding site for titin- N2A (Fig. 1C). After photobleaching, the recovery speed of DNter2 is significantly slower than the recov- ery speed of CARP, suggesting that the long C-termi- nal CARP fragment is more efficiently bound to titin after cleavage by calpain 3 (P < 0.01; Fig. 2E). It is worth noting that, in skeletal muscle, an endogenous inhibitor maintains calpain 3 in an inactive state until a signal, such as eccentric exercise [44], activates its proteolytic functions. As a result, after 7 days of

Taken together, the results obtained in the present study appear to corroborate that, once cleaved by cal- pain 3, the C-terminal part of CARP, as well as unprocessed CARP molecules, bind more efficiently to titin N2A, which is consistent with the fact that CARP nuclear translocation could be controlled by calpain 3 activity.

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4326

L. Laure et al.

Regulation of CARP by calpain 3

Fig. 2. CARP cleavage strengthens its interaction with the titin N2A region. (A) Localization of YFP-CARP in the mouse TA after electrotrans- fer. CARP is localized both on the sarcomere (lower left panel) and in the nucleus (lower right panel) of the fibers. Scale bars = 20 lm. (B). Analysis of CARP expression in subcellular compartments of TA transduced by YFP-CARP (detection by GFP-specific western blot) confirms that CARP is present on the cytoskeleton and the nucleus in skeletal muscle. (C) Localization of YFP-DNter2 and YFP-Nter in the mouse TA after electrotransfer. Similar to CARP, DNter2 is localized on the sarcomere and in the nucleus (upper panel), whereas the Nter-CARP fluo- rescence (lower panel) is scattered throughout the fiber. (D) Yeast two-hybrid assay of the interaction of titin with CARP or DNter2. Yeasts resulting from the mating of clones transformed with titin or CARP were grown on Trp-Leu- (lower panels, control medium) or Trp-Leu-His- medium (upper panels, selective medium). On the selective medium, the yeasts carrying titin and DNter2 grow more than the yeasts carry- ing titin and CARP, suggesting that, once cleaved, the association of the long C-terminal fragment of CARP and titin is reinforced. (upper panels). (E) Quantification of FRAP experiments. FRAP was measured in several ROI after photobleaching at 514 nm in mouse TA trans- duced with YFP-tagged CARP or DNter2. The fluorescence recovery speed is slower when CARP is truncated (i.e. slower in the presence of the DNter2 construct compared to the CARP construct) (**P < 0.01, n = 12).

In vitro, CARP can act as a regulator of transcription factors activity in the nucleus

Considering that CARP is a known regulator of tran- scription in the heart, we investigated the possibility that CARP might play a similar role on gene regula- tion in skeletal muscle. The DNA binding activities

of nuclear proteins from C2 myotubes transfected either with pcDNA3-CARP or with a mock vector (pcDNA3-lacZ) were compared using a membrane- based analysis (protein ⁄ DNA array) of a set of 345 pre-selected transcription factors. Sixty-eight transcrip- tion factors appear to be regulated by CARP (cut-off ratio CARP ⁄ lacZ < 0.6 or > 1.3). Apart from pax5,

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4327

L. Laure et al.

Regulation of CARP by calpain 3

performed real-time quantitative RT-PCR (qRT-PCR) of MuRF1, an E3 ubiquitin ligase whose transcription is up-regulated through NF-jB activation in atrophic muscle fibers [51–53]. Interestingly, MuRF1 expression remains constant in this experiment, strongly suggest- ing that the corresponding signaling pathway regulated by NF-jB does not involve this protein (Fig. 4D).

Discussion

In the present study, we provide new insights into the regulation and function of the molecular complex encompassing CARP and calpain 3 in the N2A region. We identified CARP as a new calpain 3 substrate. Interestingly, this cleavage regulates CARP subcellular localization by increasing the strength of its interaction with the sarcomere. In addition, we investigated the modification of transcription factor activities induced by CARP over-expression and demonstrated CARP- induced regulation of NF-jB activity.

Fig. 3. Calpain 3 produces a reinforcement of CARP interaction with titin. (A) CARP localization after electrotransfer of YFP tagged CARP in TA muscles from wild-type (left) and C3-null (right) mice. In both models, CARP is localized in the nucleus and on the sarco- mere of the fibers. Scale bars = 20 lm. (B) Quantification of FRAP experiments. FRAP was measured for several ROI after photoble- aching at 514 nm in TA muscles from wild-type and C3-null mice transduced with YFP-tagged CARP. The fluorescence recovery speed is slower in muscles of animals bearing functional calpain 3 (**P < 0.01, n = 10).

Even though CARP bears two potential PEST insta- its cleavage does not occur in any of bility regions, these sequences but takes place in a strongly structured coiled-coil region [49]. A core and a bipartite NLS were previously predicted to be encoded in this region, core NLS the bipartite NLS encompassing the (Fig. 1B) [28]. It should be noted that an additional core NLS is present downstream of this region (posi- tion 94–98; Fig. 1B) [19,28,54]. Cleavage by calpain 3 would theoretically disrupt the bipartite NLS and leave the two core NLS intact on CARP C-terminal region. The N-terminal region liberated by the cleavage has no NLS left and is consistently never observed inside the nucleus. However, it is possible that the loss of one NLS in the C-terminal fragment affects the nuclear transport of this form of CARP, although the sensitiv- ity of the methods we used could not confirm this hypothesis.

whose DNA-binding activity is slightly elevated in the presence of CARP (on one out of the two consensus sequences considered), all the other transcription fac- tors are inhibited (Fig. 4A). The 32 factors most signif- icantly inhibited (cut-off ratio CARP ⁄ lacZ < 0.5) are presented schematically in Fig. S3. Although its inhibi- tion does not reach this level with this quantification method, the activity of the transcription factor NF-jB, as measured with three different consensus sequences, is consistently repressed. This transcription factor appeared to be particularly interesting considering that it was previously described as having a role in muscle atrophy [50] and is abnormally distributed subsequent to calpain 3 deficiency [8].

Using a quantitative ELISA-based method, we con- firmed that, when CARP is significantly over-expressed by two-fold, NF-jB p65 transcriptional activity is sig- nificantly decreased two-fold (P < 0.05; Fig. 4B). Using the quantification of its messenger level on RNA extracts of the same cells, we confirmed that this transcription factor is not transcriptionally regulated (Fig. 4C) and concluded that its nuclear translocation its activity is modulated by CARP. We also or

The results obtained in the present study strongly suggest that, once cleaved, CARP interaction with the region N2A is reinforced. CARP interacts with titin- N2A using a region situated in its second ankyrin repeat (Fig. 1B) [18]. Bio-informatics analysis indicated that this region remains structurally unaffected by the cleavage, whereas the coiled-coil region appears to be destructed (for methodology, see Materials and meth- ods). In addition to carrying NLS, this region was previously proposed to be involved in the homodi- merization of CARP [49]. We therefore propose that the loss of CARP dimerization promotes the binding to titin by improving the accessibility of the titin-binding domain. Interestingly, the importance of CARP inter- action for its function was recently demonstrated in a

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4328

L. Laure et al.

Regulation of CARP by calpain 3

Fig. 4. In vitro, CARP can act as a regulator of transcription factors activity in the nucleus. (A) Effect of CARP on the DNA-binding activities of 345 transcription factors. DNA-binding activities were measured on nuclear extracts of C2 myotubes over-expressing either CARP or lacZ (control). Black boxes highlight the 32 transcription factors that were most significantly inhibited (cut-off ratio CARP ⁄ lacZ < 0.5). Although less severely, the DNA-binding activity of NF-jB is also inhibited (single white boxes indicate NF-jB DNA-binding activities measured on three different consensus sequences). Pax5 is the only factor whose DNA-binding activity is slightly elevated (double white boxes). (B) Quan- tification of NF-jB DNA-binding activities in C2 myotubes over-expressing CARP. The DNA-binding activity of the NF-jB isoform p65 is sig- nificantly inhibited when CARP is over-expressed. (*P < 0.05, n = 3). (C) Real-time quantification of the mRNA level of NF-jB p65 in myotubes over-expressing CARP. The gene expression of NF-jB p65 does not vary with CARP over-expression (n = 3). (D) Real-time quanti- fication of the mRNA level of MuRF1 in myotubes over-expressing CARP. The gene expression of MURF1 does not vary with CARP over- expression (n = 3).

pathophysiological context since pathogenic mutations result in the loss of CARP binding to talin and FHL2 and, consequently, in the perturbation of its function [55].

Regulation of function through the control of sub- information for the calpain family, although it was

cellular localization represents novel a member of

previously described for other proteases such as casp- ases [56]. Several different subcellular traffic mechanisms controlling transcription are known to be controlled by protein cleavage. the liberation and In particular, nuclear translocation of transcription factors can be triggered by proteasome-mediated degradation of a partner, as exemplified by the prototypical regulation of

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4329

L. Laure et al.

Regulation of CARP by calpain 3

of the MARPs. This differential regulation might be necessary to tune muscle signaling pathways with pre- cision in response to various physiological stimuli.

translocation

through

nuclear

the factor NF-jB by the protein IjBa [57]. Addition- ally, the transmembrane receptor Notch is the target of ligand-dependent proteolysis and one of the frag- ments released migrate into the nucleus to regulate gene expression [58]. The results reported in the pres- ent study illustrate a novel mechanism of gene regula- tion inhibition, combining the destruction of an NLS with an increase in the affinity of the targeted gene regulator for one of its partners.

the up-regulation of

Under which conditions the pathway identified in the present study is physiologically relevant and how its dysfunction participates in the pathogenesis of LGMD2A represent two important issues that remain to be addressed. The NF-jB pathway is a key regula- tor of numerous cellular events, such as proliferation and differentiation, and catabolic or apoptotic path- ways, in many organs. In particular, it was previously established that NF-jB is a major inducer of muscle atrophy in the skeletal muscle. Indeed, NF-jB inhibi- tion in mice models invariably protects against muscle atrophy, whereas NF-jB activation promotes proteoly- sis in vivo [51,64–66]. However, in our hands, although the over-expression of CARP in muscle cells results in NF-jB p65 inhibition, it does not affect the expression of MURF1, which is one of the main mediators of NF-jB-dependent muscle atrophy [51]. It was also pre- viously suggested that p65 is not the member of the NF-jB family involved in the induction of atrophy [64]. Taken together, CARP-dependent NF-jB inhibi- tion therefore appears unlikely to play a role in muscle atrophy. On the other hand, several studies have sug- gested a possible involvement of NF-jB in muscle cell survival through induction of anti-apoptotic factors [8,9,67]. Calpain 3 deficiency was previously reported to be associated with a deregulation of the NF-jB pathway and an increase in muscle fiber apoptosis [8]. The participation of NF-jB signaling in the pathogen- esis of LGMD2A is therefore an interesting possibility. The findings obtained in the present study lead to a proposed working hypothesis: in the absence of calpain 3, CARP nuclear activities would be exacerbated, which would lead to a decrease in NF-jB activity (Fig. S4). NF-jB inhibition would impede the protec- tion of muscle from apoptosis, an event leading to progressive muscle destruction. In line with this hypothesis, CARP ectopic expression was previously reported to be able to induce apoptotic cell death in hepatoma cells [62]. In conclusion, calpain 3, through its action on CARP, appears to have a central role in regulating important cell fate-governing pathways.

Materials and methods

Plasmid constructions and antibodies

The sequences encoding full-length DNter1-4 and Nter CARP were amplified by PCR on a random primed cDNA transcription of murine library obtained by indicated in 129SVter reverse skeletal muscle RNA (primers

The sarcomeric sequestration consecutive to calpain 3 activation might, as a consequence, control CARP- dependent gene expression. Indeed, MARPs are con- sidered to be involved in gene transcription because (a) Ankrd2 localizes in euchromatin, the region of chro- matin where active gene transcription occurs [59], is able to bind to three transcription factors, YB-1, PML and p53, and enhances the p21(WAFI ⁄ CIPI) promoter by p53 [17] and (b) CARP can bind to DNA [19] and is a negative regulator of the transcription factor YB1 in the heart [21]. Interest- ingly, calpain 3 was also reported to participate in the control of gene expression [2,7–9], suggesting that the complex calpain 3 ⁄ CARP might comprise an axis for gene regulation. Amongst the possible CARP targets identified in the present study, NF-jB p65 DNA bind- ing activity was confirmed to be inhibited by CARP over-expression. Interestingly, we previously demon- strated that calpain 3 possibly participates in the the NF-jB pathway because calpain 3 control of deficiency is associated with an altered distribution of both NF-jB and of its regulator IjBa [8], as well as with blockade of the induction of specific anti-apopto- tic NF-jB target genes such as c-FLIP [9]. From a mechanistic point of view, it could be postulated that a direct interaction between CARP ankyrin repeats and NF-jB p65 is the cause of a cytoplasmic sequestration (and hence inhibition) of NF-jB, similar to IjB which associates through its ankyrin repeats with NF-jB [60]. However, CARP could also act upstream of a sig- naling cascade controlling directly NF-jB activity as the transcription factor is now known to be regulated by both phosphorylation and acetylation [61]. Interest- ingly, it was previously reported that the inhibition of the NF-jB pathway during the induction of apoptosis induces CARP upregulation, suggesting that a positive feedback mechanism could exacerbate this phenome- non [62]. On the other hand, a recent study shows that the stimulation of NF-jB activity by skeletal muscle longitudinal stretch up-regulates Ankrd2 expression through direct stimulation of its promoter [63]. Taken together, these studies suggest that the NF-jB pathway might be a key differential regulator of the expression

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4330

L. Laure et al.

Regulation of CARP by calpain 3

Table 1. Primers used for cloning.

Plasmid

Insert

Upper primer Lower primer

pGAD-CARP

Full-length CARP

CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC

pYFP-CARP- CFP-HIS

Saint Genes Champanelle, France) and has been described previously [8]. NF-jB-specific rabbit polyclonal antibody was obtained from Chemicon. Mouse monoclonal antibody specific for the V5 epitope was purchased from Invitrogen. Horseradish peroxidase linked donkey anti-rabbit IgG and sheep anti-mouse IgG antibodies were obtained from GE Healthcare (Piscataway, NJ, USA).

Cell culture and transfection

pDNter1

pDNter2

pDNter3

pDNter4

pCarpNter

CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC

pGAD-DNter2 CARP from 71 to 319 Full-length CARP 1–319 CARP from 30 to 319 CARP from 71 to 319 CARP from 102 to 319 CARP from 124 to 319 CARP from 1 to 70

The NIH3T3 cell line was obtained from the American Type Culture Collection (Rockville, MD, USA) and the C2 mouse myoblasts from the ATCC [69]. Fibroblasts and myoblasts were cultured in DMEM containing gentamicin (10 lgÆmL)1) and supplemented with 10% or 20% fetal bovine serum (HyClone(cid:2) Thermo Scientific, Hudson, NH, USA), respectively. Myogenic differentiation of C2 cells was initiated by replacement of the growth medium with DMEM containing 5% horse serum (Gibco(cid:2) Invitrogen, Carlsbad, CA, USA) and the subsequent maintenance of the cells in this medium for 4–10 days.

For plasmid transfections, cells were plated (300 000 C2 cells or 1 000 000 NIH3T3 cells per 100 mm dish) and allowed to grow for 24 h. Transfections were performed with 6 lg of plasmid and 30 lL of FuGENE 6 transfection reagent (Roche Applied Science, Indianapolis, IN, USA). In case of co-transfections, plasmids were mixed at equimo- lar concentrations. To increase C2 transfection efficiency, the same transfection method was used a second time before the start of myogenic differentiation. respectively)

Table 1). PCR products were cloned in pcDNA3.1D ⁄ V5- His-Topo using the TOPO(cid:2) cloning technology (Invitrogen, Carlsbad, CA, USA). After digestion by XhoI and BamHI, the inserts of the resulting plasmids were subcloned into pYFP-CFP-HIS, a plasmid carrying the enhanced YFP at the 5¢ end of the cloning site. The plasmids pYFP-C3-CFP and pYFP-C3-C129S-CFP were previously described and bear the murine calpain 3 coding sequence (wild-type or C129S between protease-dead mutant [3]. The plasmid enhanced YFP in 5¢ and eCFP in 3¢ pcDNA3-lacZ was obtained from Invitrogen. Every ampli- fied sequence was confirmed by automated sequencing.

Preparation of protein samples and immunoblotting

Cells were washed with NaCl ⁄ Pi and proteins were extracted using a buffer containing 20 mm Tris (pH 7.5), 150 mm NaCl, 2 mm EGTA, 1% Triton X-100, 2 lm E64 and protease inhibitors (Complete mini protease inhibitor cocktail; Roche Applied Sciences). After centrifugation at 10 000 g for 10 min at 4 (cid:3)C, the supernatants were recov- ered for western blot analysis.

For two-hybrid experiments, the cloning of the N2A region of titin in the pGAD vector (Clontech, Mountain View, CA, USA) and of human calpain 3 in the pAS vector (Clontech) were described previously [68]. The calpain 3 construct carries the C129S mutation, which invalidates the protease activity of calpain 3. The N2A region of titin (exons 101–110) was PCR amplified (see primers in Table 1) from a random primed cDNA library obtained by reverse transcription of an adult human skeletal muscles poly(A) RNA library (Ambion AM7983; Ambion, Austin, TX, USA). The PCR product was digested by XmaI and NcoI and cloned in fusion with the GAL4 DNA-binding domain in pAS. CARP and DNter2 cDNA were fused to GAL4 activation domain in pGAD. Briefly, CARP and DNter2 were PCR amplified with primers containing the restriction sites NcoI in the 5¢ primer and XmaI in the 3¢ primer (Table 1). The digested fragments were ligated in EcoRI ⁄ BamHI linearized pGAD. Every amplified sequence was validated by automated sequencing.

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4331

IL, USA). Protein samples were Rabbit polyclonal antibody directed against the epitope QESEEQQQFRNIFKQ in exon 17 of the calpain 3 (B3) was kindly provided by Dr Ahmed Ouali (INRA UR 370, The muscle proteins of the different sub-cellular compart- ments were extracted using the ProteoExtract(cid:2) Subcellular (S-PEK; Calbiochem(cid:2) Merck Proteome Extraction Kit KGaA, Darmstadt, Germany). Briefly, TA muscles were homogenized in 1 mL of lysis buffer with a Fast-Prep instru- ment (MP-Biomedicals, Solon, OH, USA), and proteins of the cytosol, membranes, nucleus and cytoskeleton were extracted in accordance with the manufacturer’s instructions. The samples were denatured before SDS ⁄ PAGE using LDS NuPage buffer (Invitrogen) supplemented with 100 mm dithiothreitol. Sample protein concentrations were deter- mined by the BCA methodology (Thermo Scientific, Rock- ford, submitted to SDS ⁄ PAGE in precast 4–12% acrylamide gradient gels (Nu-

L. Laure et al.

Regulation of CARP by calpain 3

Transcription factor activity assays

Page system; Invitrogen) and transferred onto poly(vinyli- dene difluoride) membranes (Millipore, Billerica, MA, USA) by the appliance of an electric field (100 V for 1 h). The transfer efficiency was evaluated by Ponceau red protein staining (0.2%, w ⁄ v, in 5% acetic acid). The membranes were probed with antibodies against calpain 3 (dilution 1 : 150), green fluorescent protein (GFP) (dilution 1 : 5000), NF-jB p65 (dilution 1 : 4000) or V5 epitope (dilution 1 : 5000). For calpain 3 and V5 specific western blot, detection was performed with secondary antibodies (dilution 1 : 10 000) coupled to horseradish peroxidase and revelation was rea- lised with the SuperSignal West Pico substrate (Pierce). For GFP and NF-jB-specific western blot, detection was carried out with a secondary antibody coupled to IRDye 680 (Li-Cor, Lincoln, NE, USA; dilution 1 : 10 000) and the membranes were exposed to the Odyssey infrared imaging system (Li-Cor) for detection of the signal.

RNA extraction and real-time qRT-PCR

Protein ⁄ DNA arrays were used to screen simultaneously a large number of transcription factors for DNA binding activity. Five 100 mm dishes of 2 · 105 C2 myogenic cells were prepared for each condition. They were transfected with pcDNA3-CARP or with a mock plasmid (pYFP-C3- CFP or pcDNA3-lacZ). Transfected cells were purified using a method taking advantage of the co-expression of a trun- cated H-2Kk surface marker (MACSelect Kk system; Milte- nyi Biotec, Auburn, CA, USA). After selection, cells were differentiated into myotubes for 5 days. Nuclear extracts were prepared with the S-PEK sub-cellular fraction kit (Calbiochem) and quantified using the Bradford technique (Bio-Rad, Hercules, CA, USA). The protein ⁄ DNA assays were carried out on 25 lg of total nuclear proteins using the TranSignal Protein ⁄ DNA Combo Array (Affymetrix, Santa Clara, CA, USA) in accordance with the manufacturer’s instructions. DNA-binding activity is proportional to the intensity of the spot obtained after membrane revelation. Films were scanned and spot density was determined using the quantity one software (Bio-Rad).

Table 2. Primers and probes sets used for qRT-PCR of mouse genes.

Upper primer Probe Lower primer

Acronym

Name

Accession number

C3

Calpain 3

NM_007601.3

CARP

Ankyrin repeat domain 1

NM_013468

Reticuloendotheliosis viral oncogene

NM_009045

NF-jB p65

homolog A (Rela)

MurF1

Tripartite motif-containing 63 (Trim63),

NM_001039048

P0

Acidic ribosomal phosphoprotein

XR_004667

mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R TGGCACTGATTTTGGCTCCT mp65NFjB.F GGCGGCACGTTTTACTCTTT mp65NFjB.P CGCTTTCGGAGGTGCTTTCGCAG mp65NFjB.R TCAGAGTTCCCTACCGAAGCAG mMurf1.F AGGGCCATTGACTTTGGGAC mMurf1.P AGGAGG AGTTTACAGAAGAGGAGGCTGATGAG mMurf1.R CTCTGTGGTCACGCCCTCTT mP0.F CTCCAAGCAGATGCAGCAGA mP0.P CCGTGGTGCTGATGGGCAAGAA mP0.R ATAGCCTTGCGCATCATGGT

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4332

Relevant results were quantified using the ELISA-based method TransAm (Active Motif, Carlsbad, CA, USA). Five 100 mm dishes of 1 · 106 C2 myogenic cells were prepared for each condition. They were transfected with pcDNA3- CARP or with a mock plasmid (pcDNA3-lacZ) and differ- entiated into myotubes for 7–10 days. Nuclear extracts from CARP-expressing and control C2 myotubes were pre- pared using a Nuclear Extraction Kit (Active Motif) in accordance with the manufacturer’s instructions. Either 1.5 or 40 lg of nuclear extract were used for NF-jB p65 and RelB activity assay, respectively. The transcription factor activity was measured at 450 nm using a spectrophotometer. Total RNA were isolated from mouse cells using Trizol reagent (Gibco). cDNA were synthesized from 1 lg of total RNA using the SuperScript first strand synthesis system for RT-PCR kit (Invitrogen) and random oligonucleotides. Expression of calpain 3, CARP, NF-jB and MuRF1 genes was monitored by a qRT-PCR method using TaqMan probes (Perkin Elmer, Waltham, MA, USA) and a 7900 HT fast RT-PCR machine (Applied Biosystems, Carlsbad, CA, USA). The ubiquitous acidic ribosomal phosphopro- tein (P0) was used to normalize the data across samples. P0 expression was monitored by SYBRGreen incorporation. The primer pairs and TaqMan probes used for amplifica- tion are indicated in Table 2. Each experiment was per- formed in duplicate.

L. Laure et al.

Regulation of CARP by calpain 3

The results are expressed as a percentage of expression in control myotubes.

Yeast two-hybrid analysis

the same length of

Protein–protein interactions were investigated using the BD Matchmaker yeast Two-hybrid System (Clontech). The yeast competent cells AH109 (mat a) and Y187 (mat a) were trans- formed using the alkali-cation transformation kit (MP Bio- medicals, Solon, OH, USA) with 25 lg of pGAD and pAS plasmids, respectively, and plated on medium lacking leucine (for mat a-pGAD) or tryptophan (for mat a-pAS). The Y187 cells were mated with AH109 yeasts for 36 h at 30 (cid:3)C on non selective YPD medium. Colonies were harvested, resuspended in 50 lL of water, spotted on medium lacking leucine, tryptophan and histidine and incubated for 4 days at 30 (cid:3)C. Plates were scanned to obtain digitized images.

output. The prebleaching status, bleaching and fluorescence recovery were recorded by the ‘time series application’ of the Leica confocal software, using 3% laser output to mini- mize further bleaching. For quantitative analysis, a mini- mum of 12 individual muscle fibers (from three different animals) were analyzed, and the average pixel intensities in specified ROI were determined with the freeware image analysis imagej (http://rsb.info.nih.gov/ij/). Unbleached ref- erence regions were analyzed in parallel for each muscle fiber for data normalization. The fluorescence recovery speed is calculated by dividing the variation of fluorescence units between pre- and post-bleach status by the variation of fluorescence over time in an unbleached ROI, hence giving normalized results expressed as arbitrary units per minute. Box-plot representations were built for each condition. The box embraces the 25th and 75th percentile values. Whiskers extend from each end of the box to the minimum and maximum values in the data. Crosses represent the mean value.

In vivo plasmid delivery

Bio-informatics analysis

Wild-type mice from the 129SvPasIco strain were pur- (Les Oncins, chased from Charles River Laboratories France). The calpain 3-deficient (C3-null) model used in the present study corresponds to a complete inactivation of the calpain 3 expression (for a description of the model, see Doc. S1). All mice were handled in accordance with the European Communities Council Directive of 24 November 1986 (86 ⁄ 609 ⁄ EEC) and experiments were performed in accordance with Genethon ethical committee.

Bio-informatics analyses were carried out on the sequence of the full-length CARP protein and on the sequence of the C-terminal fragment resulting from calpain 3-dependent proteolysis. The 2D structures were analyzed using net- surfp software (http://www.cbs.dtu.dk/services/NetSurfP/). The prediction of the presence of coiled-coil regions was performed using coils (http://www.ch.embnet.org/software/ COILS_form.html) and paircoil (http://groups.csail.mi- t.edu/cb/paircoil/cgi-bin/paircoil.cgi) software. The analyses were confirmed using esypred3d software for the predic- tion of 3D structures (http://www.fundp.ac.be/urbm/bioinfo/ esypred/).

Statistical analysis

Data are presented as the mean ± SEM. Individual means were compared using the Mann–Whitney non parametric test. P < 0.05 or P < 0.01 was considered statistically significant.

respectively), the

Acknowledgements

Endotoxin-free plasmids were prepared with the Endo- Free Megaprep kit (Qiagen, Valencia, CA, USA). In total, 50 lg of plasmid were injected into the TA muscles of wild- type (129svPasIco) or C3-null mice (18–32 weeks old). Immediately after injection, transcutaneous electric pulses were applied through two stainless steel plate electrodes placed on each side of the hind limb. Eight square-wave electric pulses were generated by an ECM-830 electropulsa- tor (BTX, Holliston, MA, USA) with an output voltage of 200 VÆcm)1, a pulse length of 20 ms, and a frequency of pulse delivery of 2 Hz. For monitoring of fluorescence, 7 days after injection, mice were anaesthetized with intra- peritoneal injections of ketamine ⁄ xylazine (at a concentra- tion of 100 and 10 mgÆkg)1, skin surrounding the TA was dissected, a glass cover-slide was positioned on the exposed muscle and the fluorescence was observed using a confocal microscope (DM-IRBE; Leica Microsystems, Bannockburn, IL, USA) and a laser excita- tion wavelength of 514 nm for YFP detection.

We acknowledge the excellent technical expertise of Ludovic Arandel, Thibaut Marais and Lae¨ titia Van Wit- tenberghe. We are very grateful to Dr Ahmed Ouali for providing us with antibodies. This work was supported by the ‘Association Franc¸ aise contre les Myopathies’.

FRAP experiments

References

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4333

1 Fardeau M, Eymard B, Mignard C, Tome FM, Richard I & Beckmann JS (1996) Chromosome 15-linked FRAP experiments were performed by bleaching ROIs across mouse TA fibers transduced 7 days previously with YFP-tagged constructs. Ten iterations of photobleaching were used at a laser set up of k = 514 nm and 100%

L. Laure et al.

Regulation of CARP by calpain 3

13 Baghdiguian S, Richard I, Martin M, Coopman P,

limb-girdle muscular dystrophy: clinical phenotypes in Reunion Island and French metropolitan communities. Neuromuscul Disord 6, 447–453. 2 Richard I, Broux O, Allamand V, Fougerousse F,

Beckmann JS, Mangeat P & Lefranc G (2001) Patho- physiology of limb girdle muscular dystrophy type 2A: hypothesis and new insights into the IkappaBal- pha ⁄ NF-kappaB survival pathway in skeletal muscle. J Mol Med 79, 254–261.

Chiannilkulchai N, Bourg N, Brenguier L, Devaud C, Pasturaud P, Roudaut C et al. (1995) Mutations in the proteolytic enzyme calpain 3 cause limb-girdle muscular dystrophy type 2A. Cell 81, 27–40. 3 Taveau M, Bourg N, Sillon G, Roudaut C, Bartoli

M & Richard I (2003) Calpain 3 is activated through autolysis within the active site and lyses sarcomeric and sarcolemmal components. Mol Cell Biol 23, 9127–9135. 14 Sorimachi H, Kinbara K, Kimura S, Takahashi M, Ishiura S, Sasagawa N, Sorimachi N, Shimada H, Tagawa K, Maruyama K et al. (1995) Muscle-specific calpain, p94, responsible for limb girdle muscular dystrophy type 2A, associates with connectin through IS2, a p94-specific sequence. J Biol Chem 270, 31158– 31162. 4 Guyon JR, Kudryashova E, Potts A, Dalkilic I, Brosius

15 Kinbara K, Sorimachi H, Ishiura S & Suzuki K (1997) Muscle-specific calpain, p94, interacts with the extreme C-terminal region of connectin, a unique region flanked by two immunoglobulin C2 motifs. Arch Biochem Bio- phys 342, 99–107. MA, Thompson TG, Beckmann JS, Kunkel LM & Spencer MJ (2003) Calpain 3 cleaves filamin C and regulates its ability to interact with gamma- and delta-sarcoglycans. Muscle Nerve 28, 472–483.

16 Lange S, Xiang F, Yakovenko A, Vihola A, Hackman P, Rostkova E, Kristensen J, Brandmeier B, Franzen G, Hedberg B et al. (2005) The kinase domain of titin controls muscle gene expression and protein turnover. Science 308, 1599–1603. 17 Kojic S, Medeot E, Guccione E, Krmac H, Zara I, 5 Cohen N, Kudryashova E, Kramerova I, Anderson LV, Beckmann JS, Bushby K & Spencer MJ (2006) Identifi- cation of putative in vivo substrates of calpain 3 by comparative proteomics of overexpressing transgenic and nontransgenic mice. Proteomics 6, 6075–6084. 6 Kramerova I, Kudryashova E, Wu B, Ottenheijm C,

Martinelli V, Valle G & Faulkner G (2004) The Ankrd2 protein, a link between the sarcomere and the nucleus in skeletal muscle. J Mol Biol 339, 313–325. Granzier H & Spencer MJ (2008) Novel role of calpain-3 in the triad-associated protein complex regulating calcium release in skeletal muscle. Hum Mol Genet 17, 3271–3280.

18 Miller MK, Bang ML, Witt CC, Labeit D, Trombitas C, Watanabe K, Granzier H, McElhinny AS, Gregorio CC & Labeit S (2003) The muscle ankyrin repeat pro- teins: CARP, ankrd2 ⁄ Arpp and DARP as a family of titin filament-based stress response molecules. J Mol Biol 333, 951–964.

19 Chu W, Burns DK, Swerlick RA & Presky DH (1995) Identification and characterization of a novel cytokine- inducible nuclear protein from human endothelial cells. J Biol Chem 270, 10236–10245.

7 Ono Y, Hayashi C, Doi N, Kitamura F, Shindo M, Kudo K, Tsubata T, Yanagida M & Sorimachi H (2007) Comprehensive survey of p94 ⁄ calpain 3 sub- strates by comparative proteomics - Possible regulation of protein synthesis by p94. Biotechnol J 2, 565–576. 8 Baghdiguian S, Martin M, Richard I, Pons F, Astier C, Bourg N, Hay RT, Chemaly R, Halaby G, Loiselet J et al. (1999) Calpain 3 deficiency is associated with myonuclear apoptosis and profound perturbation of the IkappaB alpha ⁄ NF-kappaB pathway in limb-girdle muscular dystrophy type 2A. Nat Med 5, 503–511. 9 Benayoun B, Baghdiguian S, Lajmanovich A, Bartoli

20 Ikeda K, Emoto N, Matsuo M & Yokoyama M (2003) Molecular identification and characterization of a novel nuclear protein whose expression is up-regulated in insulin-resistant animals. J Biol Chem 278, 3514–3520. 21 Zou Y, Evans S, Chen J, Kuo HC, Harvey RP & Chien KR (1997) CARP, a cardiac ankyrin repeat protein, is downstream in the Nkx2-5 homeobox gene pathway. Development 124, 793–804. M, Daniele N, Gicquel E, Bourg N, Raynaud F, Pasqu- ier MA, Suel L et al. (2008) NF-{kappa}B-dependent expression of the antiapoptotic factor c-FLIP is regu- lated by calpain 3, the protein involved in limb-girdle muscular dystrophy type 2A. FASEB J 22, 1521–1529. 10 Duguez S, Bartoli M & Richard I (2006) Calpain 3: a key regulator of the sarcomere? Febs J 273, 3427–3436.

22 Moriyama M, Tsukamoto Y, Fujiwara M, Kondo G, Nakada C, Baba T, Ishiguro N, Miyazaki A, Nakam- ura K, Hori N et al. (2001) Identification of a novel human ankyrin-repeated protein homologous to CARP. Biochem Biophys Res Commun 285, 715–723. 23 Pallavicini A, Kojic S, Bean C, Vainzof M, Salamon M, 11 Kramerova I, Kudryashova E, Tidball JG & Spencer MJ (2004) Null mutation of calpain 3 (p94) in mice causes abnormal sarcomere formation in vivo and in vitro. Hum Mol Genet 13, 1373–1388. 12 Kramerova I, Kudryashova E, Venkatraman G &

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4334

Ievolella C, Bortoletto G, Pacchioni B, Zatz M, Lanfranchi G et al. (2001) Characterization of human skeletal muscle Ankrd2. Biochem Biophys Res Commun 285, 378–386. Spencer MJ (2005) Calpain 3 participates in sarcomere remodeling by acting upstream of the ubiquitin-protea- some pathway. Hum Mol Genet 14, 2125–2134.

L. Laure et al.

Regulation of CARP by calpain 3

24 Kemp TJ, Sadusky TJ, Saltisi F, Carey N, Moss J,

Eschenhagen T (2002) Cardiac ankyrin repeat protein, a negative regulator of cardiac gene expression, is augmented in human heart failure. Biochem Biophys Res Commun 293, 1377–1382. Yang SY, Sassoon DA, Goldspink G & Coulton GR (2000) Identification of Ankrd2, a novel skeletal muscle gene coding for a stretch-responsive ankyrin-repeat protein. Genomics 66, 229–241.

35 Barash IA, Mathew L, Ryan AF, Chen J & Lieber RL (2004) Rapid muscle-specific gene expression changes after a single bout of eccentric contractions in the mouse. Am J Physiol Cell Physiol 286, C355– C364.

25 Tsukamoto Y, Senda T, Nakano T, Nakada C, Hida T, Ishiguro N, Kondo G, Baba T, Sato K, Osaki M et al. (2002) Arpp, a new homolog of carp, is preferentially expressed in type 1 skeletal muscle fibers and is markedly induced by denervation. Lab Invest 82, 645–655. 26 Baumeister A, Arber S & Caroni P (1997) Accumula- 36 Carson JA, Nettleton D & Reecy JM (2002) Differential gene expression in the rat soleus muscle during early work overload-induced hypertrophy. FASEB J 16, 207– 209.

tion of muscle ankyrin repeat protein transcript reveals local activation of primary myotube endcompartments during muscle morphogenesis. J Cell Biol 139, 1231– 1242. 37 Chen YW, Nader GA, Baar KR, Fedele MJ, Hoffman EP & Esser KA (2002) Response of rat muscle to acute resistance exercise defined by transcriptional and trans- lational profiling. J Physiol 545, 27–41.

27 Boengler K, Pipp F, Fernandez B, Ziegelhoeffer T, Schaper W & Deindl E (2003) Arteriogenesis is associated with an induction of the cardiac ankyrin repeat protein (carp). Cardiovasc Res 59, 573– 581. 28 Jeyaseelan R, Poizat C, Baker RK, Abdishoo S, 38 Hentzen E, Lahey M, Peters D, Mathew L, Barash I, Friden J & Lieber R (2006) Stress-Dependent And Stress-Independent Expression Of The Myogenic Regu- latory Factors And The Marp Genes After Eccentric Contractions. J Physiol 570, 157–167.

39 Bakay M, Zhao P, Chen J & Hoffman EP (2002) A web-accessible complete transcriptome of normal human and DMD muscle. Neuromuscul Disord 12(Suppl 1), S125–S141. Isterabadi LB, Lyons GE & Kedes L (1997) A novel cardiac-restricted target for doxorubicin. CARP, a nuclear modulator of gene expression in cardiac progen- itor cells and cardiomyocytes. J Biol Chem 272, 22800– 22808. 29 Hayashi C, Ono Y, Doi N, Kitamura F, Tagami M,

40 Laure L, Suel L, Roudaut C, Bourg N, Ouali A, Bartoli M, Richard I & Daniele N (2009) Cardiac ankyrin repeat protein is a marker of skeletal muscle pathologi- cal remodelling. Febs J 276, 669–684.

Mineki R, Arai T, Taguchi H, Yanagida M, Hirner S et al. (2008) Multiple molecular interactions implicate connectin ⁄ titin N2A region as a modulating scaffold for p94 ⁄ calpain 3 activity in skeletal muscle. J Biol Chem 283, 14801–14814. 30 Lehti M, Kivela R, Komi P, Komulainen J, 41 Nakada C, Oka A, Nonaka I, Sato K, Mori S, Ito H & Moriyama M (2003) Cardiac ankyrin repeat protein is preferentially induced in atrophic myofibers of congeni- tal myopathy and spinal muscular atrophy. Pathol Int 53, 653–658.

Kainulainen H & Kyrolainen H (2009) Effects of fatiguing jumping exercise on mRNA expression of titin-complex proteins and calpains. J Appl Physiol 106, 1419–1424. 31 Aihara Y, Kurabayashi M, Saito Y, Ohyama Y, 42 Nakada C, Tsukamoto Y, Oka A, Nonaka I, Takeda S, Sato K, Mori S, Ito H & Moriyama M (2003) Cardiac- restricted ankyrin-repeated protein is differentially induced in duchenne and congenital muscular dystro- phy. Lab Invest 83, 711–719. 43 Nakamura K, Nakada C, Takeuchi K, Osaki M,

Tanaka T, Takeda S, Tomaru K, Sekiguchi K, Arai M, Nakamura T et al. (2000) Cardiac ankyrin repeat protein is a novel marker of cardiac hypertrophy: role of M-CAT element within the promoter. Hypertension 36, 48–53.

Shomori K, Kato S, Ohama E, Sato K, Fukayama M, Mori S et al. (2002) Altered expression of cardiac anky- rin repeat protein and its homologue, ankyrin repeat protein with PEST and proline-rich region, in atrophic muscles in amyotrophic lateral sclerosis. Pathobiology 70, 197–203.

32 Arber S, Hunter JJ, Ross J Jr, Hongo M, Sansig G, Borg J, Perriard JC, Chien KR & Caroni P (1997) MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization, dilated cardiomyopathy, and heart failure. Cell 88, 393–403.

44 Murphy RM, Goodman CA, McKenna MJ, Bennie J, Leikis M & Lamb GD (2007) Calpain-3 is autolyzed and hence activated in human skeletal muscle 24 h fol- lowing a single bout of eccentric exercise. J Appl Physiol 103, 926–931. 33 Ihara Y, Suzuki YJ, Kitta K, Jones LR & Ikeda T (2002) Modulation of gene expression in transgenic mouse hearts overexpressing calsequestrin. Cell Calcium 32, 21–29.

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4335

45 Kinbara K, Ishiura S, Tomioka S, Sorimachi H, Jeong SY, Amano S, Kawasaki H, Kolmerer B, Kimura S, Labeit S et al. (1998) Purification of native p94, a 34 Zolk O, Frohme M, Maurer A, Kluxen FW, Hentsch B, Zubakov D, Hoheisel JD, Zucker IH, Pepe S &

L. Laure et al.

Regulation of CARP by calpain 3

muscle-specific calpain, and characterization of its autolysis. Biochem J 335 (Pt 3), 589–596. 46 Daniele N, Richard I & Bartoli M (2007) Ins and outs proteins (MARPs), translocates from the I-band to the nucleus after muscle injury. Histochem Cell Biol 129, 55–64.

of therapy in limb girdle muscular dystrophies. Int J Bio- chem Cell Biol 39, 1608–1624. 47 de Morree A, Lutje Hulsik D, Impagliazzo A, van

60 Inoue J, Kerr LD, Rashid D, Davis N, Bose HR Jr & Verma IM (1992) Direct association of pp40 ⁄ I kappa B beta with rel ⁄ NF-kappa B transcription factors: role of ankyrin repeats in the inhibition of DNA binding activity. Proc Natl Acad Sci USA 89, 4333–4337.

Haagen HHHBM, de Galan P, van Remoortere A, ‘t Hoen PAC, van Ommen GB, Frants RR & van der Maarel SM (2010) Calpain 3 is a rapid-action, unidirec- tional proteolytic switch central to muscle remodeling. PLoS ONE 5, e11940. 48 Reits EA & Neefjes JJ (2001) From fixed to FRAP: 61 Perkins ND (2006) Post-translational modifications reg- ulating the activity and function of the nuclear factor kappa B pathway. Oncogene 25, 6717–6730.

measuring protein mobility and activity in living cells. Nat Cell Biol 3, E145–E147.

62 Park JH, Liu L, Kim IH, Kim JH, You KR & Kim DG (2005) Identification of the genes involved in enhanced fenretinide-induced apoptosis by par- thenolide in human hepatoma cells. Cancer Res 65, 2804–2814. 63 Mohamed JS, Lopez MA, Cox GA & Boriek AM 49 Witt SH, Labeit D, Granzier H, Labeit S & Witt CC (2005) Dimerization of the cardiac ankyrin protein CARP: implications for MARP titin-based signaling. J Muscle Res Cell Motil 26, 401–408.

(2010) Anisotropic regulation of Ankrd2 gene expres- sion in skeletal muscle by mechanical stretch. FASEB J 24, 3330–3340. 50 Jackman RW & Kandarian SC (2004) The molecular basis of skeletal muscle atrophy. Am J Physiol Cell Physiol 287, C834–C843. 51 Cai D, Frantz JD, Tawa NE Jr, Melendez PA, Oh

64 Hunter RB, Stevenson E, Koncarevic A, Mitchell- Felton H, Essig DA & Kandarian SC (2002) Activation of an alternative NF-kappaB pathway in skeletal muscle during disuse atrophy. FASEB J 16, 529–538. BC, Lidov HG, Hasselgren PO, Frontera WR, Lee J, Glass DJ et al. (2004) IKKbeta ⁄ NF-kappaB activation causes severe muscle wasting in mice. Cell 119, 285– 298.

52 Glass DJ (2005) Skeletal muscle hypertrophy and atro- phy signaling pathways. Int J Biochem Cell Biol 37, 1974–1984. 53 Franch HA & Price SR (2005) Molecular signaling 65 Judge AR, Koncarevic A, Hunter RB, Liou HC, Jack- man RW & Kandarian SC (2007) Role for IkappaBal- pha, but not c-Rel, in skeletal muscle atrophy. Am J Physiol Cell Physiol 292, C372–C382. 66 Mourkioti F, Kratsios P, Luedde T, Song YH, pathways regulating muscle proteolysis during atrophy. Curr Opin Clin Nutr Metab Care 8, 271–275.

Delafontaine P, Adami R, Parente V, Bottinelli R, Pasparakis M & Rosenthal N (2006) Targeted ablation of IKK2 improves skeletal muscle strength, maintains mass, and promotes regeneration. J Clin Invest 116, 2945–2954.

54 Ishiguro N, Baba T, Ishida T, Takeuchi K, Osaki M, Araki N, Okada E, Takahashi S, Saito M, Watanabe M et al. (2002) Carp, a cardiac ankyrin-repeated pro- tein, and its new homologue, Arpp, are differentially expressed in heart, skeletal muscle, and rhabdomyosar- comas. Am J Pathol 160, 1767–1778.

67 Tolosa L, Morla M, Iglesias A, Busquets X, Llado J & Olmos G (2005) IFN-gamma prevents TNF-alpha- induced apoptosis in C2C12 myotubes through down- regulation of TNF-R2 and increased NF-kappaB activ- ity. Cell Signal 17, 1333–1342.

55 Moulik M, Vatta M, Witt SH, Arola AM, Murphy RT, McKenna WJ, Boriek AM, Oka K, Labeit S, Bowles NE et al. (2009) ANKRD1, the gene encoding cardiac ankyrin repeat protein, is a novel dilated cardiomyopa- thy gene. J Am Coll Cardiol 54, 325–333. 56 Valencia CA, Ju W & Liu R (2007) Matrin 3 is a

Ca2+ ⁄ calmodulin-binding protein cleaved by caspases. Biochem Biophys Res Commun 361, 281–286.

68 Herasse M, Ono Y, Fougerousse F, Kimura E, Stockholm D, Beley C, Montarras D, Pinset C, Sorimachi H, Suzuki K et al. (1999) Expression and functional characteristics of calpain 3 isoforms generated through tissue-specific transcriptional and posttranscriptional events. Mol Cell Biol 19, 4047– 4055. 69 Yaffe D & Saxel O (1977) Serial passaging and differen- 57 Lin X, Mu Y, Cunningham ET Jr, Marcu KB, Gelezi- unas R & Greene WC (1998) Molecular determinants of NF-kappaB-inducing kinase action. Mol Cell Biol 18, 5899–5907. 58 Schweisguth F (2004) Regulation of notch signaling tiation of myogenic cells isolated from dystrophic mouse muscle. Nature 270, 725–727. 70 Fougerousse F, Gonin P, Durand M, Richard I & activity. Curr Biol 14, R129–R138.

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4336

Raymackers JM (2003) Force impairment in calpain 3-deficient mice is not correlated with mechanical disruption. Muscle Nerve 27, 616–623. 59 Tsukamoto Y, Hijiya N, Yano S, Yokoyama S, Nak- ada C, Uchida T, Matsuura K & Moriyama M (2008) Arpp ⁄ Ankrd2, a member of the muscle ankyrin repeat

L. Laure et al.

Regulation of CARP by calpain 3

Supporting information

Doc S1. Construction and characterization of the cal- pain 3 deficient animal model.

This supplementary material can be found in the

online version of this article.

Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.

The following supplementary material is available: Fig. S1. The C3-KO murine model has no residual calpain 3 expression. Fig. S2. The C3-KO murine model reproduces features of the human disease (i.e. muscle degeneration and weakness). Fig. S3. CARP expression inhibits the DNA-binding activities of 32 transcription factors. Fig. S4. Calpain 3-mediated cleavage of CARP reduces its effects on transcription factors.

FEBS Journal 277 (2010) 4322–4337 ª 2010 The Authors Journal compilation ª 2010 FEBS

4337