intTypePromotion=1

Phát hiện Chlamydia Trachomatis bằng kỹ thuật khuếch đại gen trên bệnh nhân viêm khớp phản ứng

Chia sẻ: Sunshine_3 Sunshine_3 | Ngày: | Loại File: PDF | Số trang:4

0
56
lượt xem
4
download

Phát hiện Chlamydia Trachomatis bằng kỹ thuật khuếch đại gen trên bệnh nhân viêm khớp phản ứng

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Viêm khớp phản ứng (VKPƯ) lμ một bệnh viêm mμng hoạt dịch khớp vô khuẩn thường xẩy ra sau một nhiễm khuẩn nμo đó trong cơ thể. Cơ chế bệnh sinh chưa rõ, hiện nay có nhiều nghiên cứu đề cập đến vai trò của các kháng nguyên vi khuẩn như yersinia, Salmonella, Shigella, Chlamydia trachomatis...trong khởi phát vμ duy trì bệnh VKPƯ. Để tìm hiểu mối liên quan của Chlamydia trachomatis với bệnh VKPƯ, chúng tôi tiến hμnh xét nghiệm PCR trong dịch khớp vμ nước tiểu của 52 bệnh nhân VKPƯ được khám vμ điều trị tại khoa khớp bệnh viện Bạch mai từ...

Chủ đề:
Lưu

Nội dung Text: Phát hiện Chlamydia Trachomatis bằng kỹ thuật khuếch đại gen trên bệnh nhân viêm khớp phản ứng

  1. TCNCYH 34 (2) - 2005 Ph¸t hiÖn Chlamydia Trachomatis b»ng kü thuËt khuÕch ®¹i gen trªn bÖnh nh©n viªm khíp ph¶n øng B¹ch Kh¸nh Hßa(1), TrÇn ThÞ Minh Hoa(2) (1) Tr−êng §¹i häc Y Hµ Néi (2) BÖnh viÖn B¹ch Mai Viªm khíp ph¶n øng (VKP¦) lµ mét bÖnh viªm mµng ho¹t dÞch khíp v« khuÈn th−êng xÈy ra sau mét nhiÔm khuÈn nµo ®ã trong c¬ thÓ. C¬ chÕ bÖnh sinh ch−a râ, hiÖn nay cã nhiÒu nghiªn cøu ®Ò cËp ®Õn vai trß cña c¸c kh¸ng nguyªn vi khuÈn nh− yersinia, Salmonella, Shigella, Chlamydia trachomatis...trong khëi ph¸t vµ duy tr× bÖnh VKP¦. §Ó t×m hiÓu mèi liªn quan cña Chlamydia trachomatis víi bÖnh VKP¦, chóng t«i tiÕn hµnh xÐt nghiÖm PCR trong dÞch khíp vµ n−íc tiÓu cña 52 bÖnh nh©n VKP¦ ®−îc kh¸m vµ ®iÒu trÞ t¹i khoa khíp bÖnh viÖn B¹ch mai tõ th¸ng 8/2001 ®Õn th¸ng 8/2003. KÕt qu¶ nghiªn cøu ADN cña CT ®· ®−îc x¸c ®Þnh trong 53,8% mÉu bÖnh phÈm dÞch khíp vµ 42,2% ë n−íc tiÓu cña c¸c bÖnh nh©n nghiªn cøu. So s¸nh víi tû lÖ kh¸ng nguyªn lipopolyarcaride (LPS) d−¬ng tÝnh 38.5 % mÉu n−íc tiÓu,kh¸ng thÓ IgG ®Æc hiÖu víi Chlamydia trachomatis(CT) d−¬ng tÝnh 44.2% trong huyÕt thanh vµ 34.6% trong dÞch khíp. Nh− vËy xÐt nghiÖm AND cña CT ë dÞch khíp cã ®é nh¹y cao trong chÈn ®o¸n bÖnh VKP¦. I. §Æt vÊn ®Ò B¹ch mai. Tû lÖ nhiÔm chlamydia trachomatis ®−êng tiÕt niÖu sinh dôc ë Viªm khíp ph¶n øng (VKP¦) lµ t×nh bÖnh nh©n VKP¦ lµ 38.1%, cao h¬n h¼n tr¹ng viªm mµng ho¹t dÞch khíp v« nhãm bÖnh nh©n viªm cét sèng dÝnh khuÈn th−êng xuÊt hiÖn sau mét nhiÔm khíp lµ 29%, nhãm c¸c bÖnh khíp kh¸c khuÈn ë mét c¬ quan nµo ®ã cña c¬ thÓ. lµ 5.4% vµ ë ng−êi b×nh th−êng lµ 3.3% Viªm khíp ph¶n øng lµ bÖnh hay gÆp [2]. Chóng t«i tiÕn hµnh nghiªn cøu ®Ò tµi nhÊt trong nhãm bÖnh lý cét sèng thÓ nµy nh»m môc ®Ých b−íc ®Çu t×m hiÓu huyÕt thanh ©m tÝnh [1,2,6]. BÖnh sinh mèi liªn quan cña CT ®èi bÖnh nh©n cña bÖnh VKP¦ ch−a râ nh−ng cã nhiÒu VKP¦ vµ ®−a ra xÐt nghiÖm chÈn ®o¸n b»ng chøng chøng tá mét sè kh¸ng cã ®é nh¹y cao gióp cho c¸c b¸c sü l©m nguyªn vi khuÈn (Chlamydia trachomatis, sµng cã chØ ®Þnh sím vµ chÝnh x¸c trong yersinia, Salmonella...) gi÷ vai trß quan ®iÒu trÞ bÖnh VKP¦. träng trong bÖnh nguyªn vµ ®−îc coi lµ mét trong nh÷ng t¸c nh©n khëi ®éng vµ II. Ph−¬ng ph¸p nghiªn cøu duy tr× ph¶n øng viªm khíp m¹n tÝnh Trong ®Ò tµi nµy chóng t«i nghiªn cøu trong bÖnh viªm khíp ph¶n øng [4,7]. 52 bÖnh nh©n VKP¦ ®−îc kh¸m, chÈn HiÖn nay bÖnh VKP¦ ®−îc quan t©m ®o¸n vµ ®iÒu trÞ néi tró hoÆc ngo¹i tró t¹i nghiªn cøu ë c¸c n−íc T©y ¢u vµ Mü do khoa Khíp bÖnh viÖn B¹ch mai tõ th¸ng tû lÖ c¸c bÖnh lý l©y truyÒn qua ®−êng 8/2001 ®Õn th¸ng 8/2003. C¸c bÖnh t×nh dôc ngµy cµng t¨ng [4,9]. ë n−íc ta, nh©n ®−îc chÈn ®o¸n theo tiªu chuÈn viªm khíp ph¶n øng còng kh¸ th−êng chÈn ®o¸n cña Amor (4). gÆp trong nhãm bÖnh lý cét sèng vµ 2.1. L©m sµng: theo tiªu chuÈn chÈn chiÕm tû lÖ 5.4% bÖnh nh©n khíp ®Õn ®o¸n cña Amor kh¸m vµ ®iÒu trÞ t¹i khoa Khíp bÖnh viÖn 17
  2. TCNCYH 34 (2) - 2005 2.2. XÐt nghiÖm: BÖnh nh©n ®−îc xÐt nghiÖm x¸c ®Þnh kh¸ng nguyªn LPS cña CT theo ph−¬ng ph¸p Hexagon [8] (Immunochromatographic), t×m kh¸ng thÓ IgG ®Æc hiÖu CT trong huyÕt thanh vµ dÞch khíp cña bÖnh nh©n VKP¦. Chóng t«i chän nh÷ng bÖnh nh©n cã ph¶n øng d−¬ng tÝnh víi c¸c xÐt nghiÖm trªn ®Ó tiÕn hµnh xÐt nghiÖm ADN trong dÞch khíp vµ H×nh ¶nh ®iÖn di s¶n phÈm PCR cña c¸c n−íc tiÓu. mÉu ADN t¸ch tõ dÞch khíp vµ n−íc tiÓu: 1 *Kü thuËt PCR x¸c ®Þnh ADN cña CT mÉu gåm a: dÞch khíp; b: n−íc tiÓu trong bÖnh phÈm dÞch khíp vµ n−íc tiÓu Thêi gian bÞ bÖnh trung b×nh lµ 17.4 cña bÖnh nh©n nghiªn cøu (10) +12.5 th¸ng (bÖnh nh©n cã thêi gian m¾c - T¸ch ADN b»ng kit Quiagen (§øc) bÖnh ng¾n nhÊt lµ 1th¸ng, vµ bÖnh nh©n cho c¶ dÞch khíp vµ n−íc tiÓu. cã thêi gian m¾c bÖnh dµi nhÊt lµ 4 n¨m). - Ph¶n øng PCR: Thµnh phÇn cho Kh¸ng thÓ IgG ®Æc hiÖu CT d−¬ng mét mÉu 25µl gåm: dNTP 200µM, tÝnh ë 23/52 mÉu bÖnh phÈm huyÕt thanh 10mM Tris-HCL, 50mM KCL, 1,5mM bÖnh nh©n chiÕm tû lÖ 44.2%, vµ tû lÖ nµy ë bÖnh phÈm dÞch khíp lµ 34.6% (15/52 MgCl2, 2UI Taq ADN polymerase, 1µl måi tr−êng hîp). Trong ®ã cã 17 bÖnh nh©n xu«i vµ 1µl måi ng−îc, 3µl ADN cÇn xÐt (32.5%) cã kh¸ng thÓ IgG ®Æc hiÖu cho nghiÖm. CT d−¬ng tÝnh trong c¶ 2 lo¹i bÖnh phÈm - Tr×nh tù måi: lµ huyÕt thanh vµ dÞch khíp (biÓu ®å 1) 5’CTGCAGCCTCCGTAGAGTCTGGGCAGTGTC 3’ XÐt nghiÖm PCR cho thÊy cã 28/52 x¸c 5’ AAGCTTTTCTTAACAATGCAAATGAGATAG 3’ ®Þnh ®−îc sù cã mÆt cña trong mÉu bÖnh - Chu kú khuyÕch ®¹i: 3phót ë 95 oC, 35 phÈm dÞch khíp chiÕm tû lÖ 53,2% trong chu kú: 95 oC/ 1phót, 52 oC/ 1phót, 72 oC/ khi ®ã chØ cã 22/52 (42,2%) x¸c ®Þnh 1phót, cuèi cïng lµ 72 oC/ 10 phót vµ 4 oC. ®−îc ADN cña CT trong n−íc tiÓu. - §iÖn di s¶n phÈm PCR trªn gen agarose IV. Bµn luËn 2%, kÝch th−íc cña s¶n phÈm lµ 96bp. Tû lÖ kh¸ng nguyªn LPS d−¬ng tÝnh III. KÕt qu¶ 38.5% ë bÖnh phÈm n−íc tiÓu, kÕt qu¶ Trong thêi gian tõ th¸ng 8/2001 ®Õn nµy còng t−¬ng tù nh− c¸c nghiªn cøu th¸ng 8/2003, chóng t«i ®· tiÕn hµnh thu cña Ferris D. G [8,9], vµ Dougados [5]. thËp ®−îc 52 bÖnh nh©n ®−îc chÈn ®o¸n Tû lÖ nµy cao h¬n h¼n trong c¸c bÖnh VKP¦ t¹i khoa khíp, bÖnh viÖn B¹ch khíp kh¸c lµ 5.4% vµ ng−êi b×nh th−êng mai. Tuæi trung b×nh cña nhãm bÖnh lµ 3.3% (2). Tû lÖ kh¸ng thÓ IgG ®Æc hiÖu nh©n nghiªn cøu lµ 28.8 ± 10.5 tuæi (bÖnh víi CT trong bÖnh phÈm huyÕt thanh vµ nh©n Ýt tuæi nhÊt lµ 12 tuæi vµ bÖnh nh©n trong dÞch khíp cña bÖnh nh©n VKP¦ lµ nhiÒu tuæi nhÊt lµ 57 tuæi), bÖnh nh©n 44,.2%, vµ 34.6%. BÖnh nh©n VKP¦ ë nam giíi chiÕm tû lÖ 57,7%. nhãm cã CT d−¬ng tÝnh chñ yÕu xÈy ra ë 18
  3. TCNCYH 34 (2) - 2005 bÖnh nh©n nam giíi, cã thêi gian m¾c v¨n Th¹c sü y häc, Tr−êng ®¹i häc Y Hµ bÖnh kÐo dµi h¬n, cã tiÒn sö nhiÔm khuÈn néi, 2001. ®−êng tiÕt niÖu sinh dôc còng nh− biÓu 3. Vò ThÞ Nhung: B−íc ®Çu th¨m dß hiÖn viªm ®−êng niÖu dôc t¹i thêi ®iÓm t×nh h×nh nhiÔm Chlamydia trachomatis. Y nghiªn cøu nhiÒu h¬n vµ bÖnh ë giai d−¬c häc thµnh phè Hå ChÝ Minh,1995 ®o¹n ho¹t ®éng so víi nhãm bÖnh nh©n (12):44-47. CT ©m tÝnh. §iÒu nµy gîi ý CT cã vai trß 4. Amor B: Reiter’s syndrome and nhÊt ®Þnh nµo ®ã trong qu¸ tr×nh khëi ph¸t reactive arthritis. Clin Rheumatol, 1983, vµ duy tr× bÖnh VKP¦. §Æc biÖt cã 53,2% 2: 315-319. mÉu bÖnh phÈm dÞch khíp cña bÖnh nh©n nghiªn cøu x¸c ®Þnh ®−îc sù cã mÆt 5. Dougados M: The concept of ADN cña CT®· gãp phÇn vµo viÖc nghiªn reactive arthritis. Presse Medicine, 1997 cøu vai trß cña Chlamdia trachomatis Feb 22; 26(5): 204-206. trong qua tr×nh viªm khíp cña bÖnh 6. Bas S, Cungnigham T, et al.,: The VKP¦. Nh− vËy xÐt nghiÖm nµy còng value of isotype determination of serum gióp cho c¸c nhµ l©m sµng häc cã chÈn antibodies against Chlamydia for the ®o¸n sím vµ chÝnh x¸c khi kÕt hîp víi diagnosis of Chlamydia reactive arthritis. c¸c triÖu chøng chÝnh cña l©m sµng. British Journal of Rheumatology 1996, 35: 542-547. V.KÕt luËn 7. Espinoza LR, Aguilar JL, KÕt qu¶ nghiªn cøu 52 bÖnh nh©n cho thÊy 38.5 % mÉu n−íc tiÓu cã kh¸ng Guitierrez F: Chlamydia-induced reactive nguyªn LPS cña CT. Kh¸ng thÓ IgG ®Æc arthritis . Cli Exp Rheumatol 1997 Mar- hiÖu CT d−¬ng tÝnh ë 44.2% mÉu huyÕt Apr, 15 (2): 169-174. thanh vµ 34.6% mÉu dÞch khíp. §Æc biÖt 8. Ferris DG, et al.: Hexagon ADN cña CT d−¬ng tÝnh 53,2% trong dÞch Chlamydia . Product Manual, Human khíp vµ 42,2% trong n−íc tiÓu cña c¸c GmbH 1997 Feb: 3-20. bÖnh nh©n nghiªn cøu. Nh− vËy xÐt 9. Ferris DG: Sensitivity of rapid nghiÖm ADN cña CT cã tû lÖ d−¬ng tÝnh antigen detection test for Chlamydia cao h¬n c¶ trong nh÷ng xÐt nghiÖm chÈn trachomatis screening. JAMA, 1995 ®o¸n cho bÖnh VKP¦. Mar 22-29: 273 (12): 917-918. Tµi liÖu tham kh¶o 10. Patrick JB, Herve CG, Alan PH: 1. TrÇn Ngäc ¢n: BÖnh khíp. Nhµ Comparison of synovial tissue and xuÊt b¶n Y häc, 1991: 96-109. synovial fluid as the source of nucleic acids for detection of Chlamydia 2. TrÇn ThÞ Minh Hoa: T×nh tr¹ng trachomatis by polymerase chain nhiÔm Chlamydia trachomatis ®−êng tiÕt reaction. Arthritis & Rheumatism 1996, niÖu sinh dôc ë bÖnh nh©n nhãm bÖnh lý 35 (10): 1740-1746. cét sèng thÓ huyÕt thanh ©m tÝnh. LuËn 19
  4. TCNCYH 34 (2) - 2005 Summary Detection of Chlamydia trachomatis by PCR with reactive arthritis Chlamydia trachomatis has been shown to be induce reactive arthritis in man specially after sexually acquired genitourinary infection To determine the connection between Chlamydia trachomatis with reactive arthritis, in this study we examined antigen Chlamydia trachomatis lipopolysarcaride, antibody IgG, and DNA chlamydia trachomatis in samples (urine, sera, and synovial fluid) from 52 patients who were diagnosed and treated in Rheumatology department, Bachmai hospital from August 2001 to August 2003. As results we found that 38.5% urine samples positve with antigen LPS, antibody IgG positive in 44.2% sera samples and 34.6% synovial fluid samples. Specially DNA chlamydia trachomatis was detected in 53.2% synovial fluid samples and 42,2% urine samples positve. This results will contribute to determine the role of DNA-Chlamydia trachomatis in reactive arthritis diagnostic 20
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2