Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes

The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes Stan Stasinopoulos1, Mythily Mariasegaram1, Chris Gafforini1, Yoshikuni Nagamine2 and Robert L. Medcalf1

1 Monash University, Australian Centre for Blood Diseases, Melbourne, Victoria, Australia 2 Friedrich Miescher Institute for Biomedical Research, Basel, Switzerland

Keywords 3¢ untranslated region; adenylate and uridylate-rich element; mRNA decay; plasminogen activator inhibitor type 2

Correspondence R. Medcalf, Australian Centre for Blood Diseases, Monash University, 6th Floor Burnet Building, AMREP, 89 Commercial Road, Melbourne 3004, Australia Fax: +61 3 9903 0228 Tel: +61 3 9903 0133 E-mail: robert.medcalf@med.monash.edu.au

(Received 21 August 2009, revised 23 December 2009, accepted 28 December 2009)

doi:10.1111/j.1742-4658.2010.07563.x

Plasminogen activator inhibitor type 2 (PAI-2; SERPINB2) is a highly- regulated gene that is subject to both transcriptional and post-transcrip- tional control. For the latter case, inherent PAI-2 mRNA instability was previously shown to require a nonameric adenylate-uridylate element in the 3¢ UTR. However, mutation of this site was only partially effective at restoring complete mRNA stabilization. In the present study, we have identiﬁed additional regulatory motifs within the 3¢ UTR that cooperate with the nonameric adenylate-uridylate element to promote mRNA destabi- lization. These elements are located within a 74 nucleotide U-rich stretch (58%) of the 3¢ UTR that ﬂanks the nonameric motif; deletion or substitu- tion of this entire region results in complete mRNA stabilization. These new elements are conserved between species and optimize the destabilizing capacity with the nonameric element to ensure complete mRNA instability in a manner analogous to some class I and II adenylate-uridylate elements present in transcripts encoding oncogenes and cytokines. Hence, post-tran- scriptional regulation of the PAI-2 mRNA transcript involves an interaction between closely spaced adenylate-uridylate elements in a manner analogous to the post-transcriptional regulation of oncogenes and cytokines.

Introduction

The generation of the serine protease plasmin by the plasminogen activator system is a critical event in a variety of physiological processes, including ﬁbrino- lysis, development, wound healing and cell migration [1–4]. Plasmin generation is regulated by two plasmin- ogen activators: urokinase-type plasminogen activator in the extracellular environment and tissue-type plas-

minogen activator in the circulation. The proteolytic activities of both tissue-type plasminogen activator and urokinase-type plasminogen activator are controlled by plasminogen activator inhibitor types 1 and 2 (PAI-1 and PAI-2, respectively). One of the enigmatic features of PAI-2 is that, although it can inhibit extracellular plasminogen and

receptor-bound

urokinase-type

Abbreviations ARE, adenylate and uridylate rich element; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GM-CSF, granulocyte macrophage- colony-stimulating factor; IL, interleukin; PAI-2, plasminogen activator inhibitor type 2; REMSA, RNA electrophoretic mobility shift assays; RPA, RNase protection analysis.

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1331

S. Stasinopoulos et al.

PAI-2 mRNA decay requires a multicomponent ARE

been predicted that approximately 8% of human genes code for transcript that contain AREs [47].

the

presence

additional

activator [5,6], it exists primarily as a nonglycosylated intracellular protein. Over the past decade, evidence has accumulated to suggest a role for PAI-2 in intra- cellular events associated with apoptosis [7–11], prolif- eration and differentiation [4,12], and the innate immune response [7,13–15]. PAI-2 has also generated a substantial level of interest because of its impressive regulatory proﬁle. It is one of the most responsive genes known (i.e. it can be induced over 1000-fold), and is regulated in a cell type-dependent manner by phorbol esters [16,17], the phosphatase inhibitor, oka- daic acid [18], tumour necrosis factor a [19,20], lipo- polysaccharide [21,22] and elevated levels of serum lipoprotein (a) [23]. Although there is a signiﬁcant transcriptional component to the regulation of PAI-2 expression by these agents, in recent years, the role of post-transcriptional regulation has come to the fore because a number of studies have shown that the half- life of PAI-2 mRNA can also be altered in a treatment and cell type-dependent manner [19,22,24–26].

Post-transcriptional control of gene expression is particularly important for controlling the levels of tran- siently induced transcripts. Many of these transcripts have extremely short half-lives, and this is usually attrib- uted to the presence of adenylate and uridylate-rich instability elements (AREs) located with the 3¢ UTR [27]. Instability regions in the 3¢ UTR can comprise single- or multiple-ARE elements that either interact with each other or act independently to deﬁne the fate of a transcript in response to a speciﬁc physiological state [28–33]. AREs are usually 50–100 nucleotides in length and contain single or multiple copies of the consensus motif AUUUA, UUAUUUA(U ⁄ A)(U ⁄ A) or UUAUUUAUU embedded within a U-rich sequence [34,35]. AREs have been classed into three groups (groups I, II and III), depending on their particular AU-rich sequence content [35].

interleukin (IL)-8

(GM-CSF),

In a previous study, we deﬁned the functional destabi- lizing ARE element in the 3¢ UTR PAI-2 as a single nonameric AU-rich sequence (UUAUUUAUU) located 304 nucleotides upstream of the poly(A) tail [24,48] and suggested that tristetraprolin was a candidate PAI-2- nonameric element binding protein involved in desta- bilizing the PAI-2 mRNA transcript [49]. However, subsequent work from our group demonstrated that mutagenesis of the nonameric element only partially sta- bilized the b-globin-PAI-2 3¢ UTR transcript [48], sug- functional of gesting destabilizing regions within the PAI-2 3¢ UTR. In the present study, we reveal that the nonameric ARE resides within a 108 nucleotide U-rich (54%) region consisting of three pentameric AU elements (one of which is a no- nameric motif) and one atypical AU-rich region, and that this extended region fully accounts for the complete destabilizing activity of the PAI-2 3¢ UTR. Further- more, functional mapping within the 108 AU-rich region revealed that the essential destabilizing sequences, con- sisting of the ﬁrst two pentameric motifs and the atypical AU-rich region, resided within a continuous 74 nucleo- tide region, which we now deﬁne as the functional PAI-2 mRNA ARE element. The nonameric motif indeed com- prises the core sequence that is essential for constitutive mRNA decay; however, its optimal destabilizing activity is only achieved in a cooperative manner with either one of two auxiliary AREs. The results obtained support the concept that AU-rich instability elements can be composed of multiple AREs that act in a synergistic manner to destabilize or stabilize transcripts depending on the physiological status of the cell. Finally, our studies show that PAI-2 mRNA harbours a spatial and functional class I ARE proﬁle that is more analogous to that of highly-regulated cytokines and oncogenes, including granulocyte macrophage-colony-stimulating factor and c-fos. This may explain why the regulation of the PAI-2 gene differs so vastly from the broader family of serine proteases.

Results

Mutation of the PAI-2 3¢ UTR nonameric sequence results in only partial mRNA stabilization

To re-assess the mRNA destabilizing characteristics of the PAI-2 3¢ UTR, we established a tetracycline- regulated system to accurately determine mRNA decay rates. Accordingly, we used a HT-1080 ﬁbrosarcoma

Functional studies have indicated that AREs initially accelerate mRNA deadenylation, which is then followed by the degradation of the mRNA body [28,36,37]. A number of in vitro studies have also reported that both AREs and ARE-binding proteins can interact with the exosome, which then degrades the body of the transcript with 3¢- to 5¢ polarity [38–40]. Recent in vivo studies, however, have elucidated a mammalian 5¢- to 3¢ ARE decay pathway that is localized to P-bodies via an ARE interaction with tristetraprolin and BRF1 [41–44]. However, both 5¢- to 3¢ and 3¢- to 5¢ pathways can be simultaneously engaged in mRNA decay in an ARE- mediated manner [45], suggesting that the pathway of mammalian ARE-mediated mRNA decay can be ﬂexible. Recently, an excellent database compiling ARE containing transcripts was established [46] and it has

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1332

S. Stasinopoulos et al.

PAI-2 mRNA decay requires a multicomponent ARE

A

B

C

TET-OFF system (Clontech, Mountain View, CA, USA) in combination with a plasmid pTETBBB (referred to as pTETGLO), which contains the gene for b-globin under the control of a tetracycline-regulated promoter that allows transcription only in the absence of tetracycline or a derivative (e.g. doxycycline) [50]. We cloned the full- length wild-type PAI-2 3¢ UTR, and a mutant PAI-2 3¢ UTR containing a four nucleotide substitution within the nonameric ARE (UUAUUUAUU to UUAAAG CUU) sequence into the unique BglII site in the b-globin 3¢ UTR of plasmid pTETGLO to create plasmids pTET GLOPAI)2 and pTETGLOARE II-MUT, respectively. These plasmids, including the empty vector, pTETGLO, were transiently transfected into HT-1080 ﬁbrosarcoma TET-OFF cells and the decay characteristics (t1 ⁄ 2 min) of the various transcripts were determined after the addi- tion of doxycycline by RNase protection analysis (RPA). As shown in Fig. 1, the half-life of the wild-type b-globin transcript was greater than 480 min, beyond the end point of the experiment (based on the composite curve of three separate experiments presented in Fig. 1), demon- strating the high stability of this transcript. The half-life of the b-globinPAI)2 transcript was reduced to (cid:2)158 min, whereas the half-life of the b-globinARE II-MUT transcript only increased to (cid:2)301 min (Fig. 1). This demonstrates that mutation of this element only partially stabilized the b-globinARE II-MUT transcript, which is in agreement with previous studies from our laboratory using a differ- ent mRNA decay system [48] and also supports the hypothesis that the PAI-2 3¢ UTR contains uncharacter- ized functional instability elements.

the transient

The PAI-2 3¢ UTR mRNA destabilizing elements are localized to a 108 nucleotide U-rich (54%) sequence

Fig. 1. The PAI-2 3¢ UTR localized nonameric sequence only par- tially contributes to PAI-2 mRNA instability. (A) Rabbit-b-globin-PAI- 2 3¢ UTR constructs prepared for transfection of HT1080-TET OFF cells. (B) HT1080-TET OFF cells were transfected with the TET-responsive b-globin reporter plasmids described in (A). After 16 h of incubation, doxycycline was added and total RNA was isolated at the indicated times and analysed by RPA. The graph in (C) corresponds to the experiments shown in (B) (n = 3–6). Each point represents the mean ± SE.

transcript was

Analysis of the PAI-2 3¢ UTR sequence (Fig. 2) revealed that the nonameric element resided within a 108 nucleotide U-rich (54%) sequence and was ﬂanked at the 5¢ and 3¢ ends by two classical pentameric ARE (AUUUA) motifs and an atypical AU-rich region (AUUUUAUAUAAU) immediately abutting 3¢ to the nonamer. This 108 nucleotide ‘extended ARE’ can, by structure and sequence homology, be categorized as a class I ARE element [35]. Furthermore, these classical pentameric elements could be the source of the addi- tional destabilizing sequences within the ‘extended ARE’ (Fig. 2), which could act independently or in a cooperative manner with the nonameric ARE.

cloning

To determine whether the ‘extended ARE’ possessed the destabilizing elements within the PAI-2 all of 3¢ UTR, the entire 108 nucleotide sequence was deleted pTET- from the

plasmid

create

GLO3¢ UTRDARE. This plasmid was transiently trans- fected into HT1080 TET-OFF cells and the half-life of the b-globinARED shown to be > 480 min (Fig. 3). Hence, this deletion resulted in signiﬁcant mRNA stabilization, with mRNA decay kinetics reminiscent of the wild-type b-globin transcript (Fig. 1). In addition, replacement of the 108 nucleotide ‘extended ARE’ with an equivalent length of an irrele- vant sequence also substantially stabilized the tran- script (data not shown) to an extent similar to that seen previously with the b-globin and the b-globinARED 108 nucleotide transcripts. Moreover, the into the BglII site in the b-globin ‘extended ARE’ 3¢ UTR, creating plasmid pTETGLOEXT.ARE, resulted

3¢ UTR to

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1333

S. Stasinopoulos et al.

PAI-2 mRNA decay requires a multicomponent ARE

Fig. 2. The PAI-2 3¢ UTR contains a 108 nucleotide functional ‘extended ARE’. A diagrammatic representation of the PAI-2 3¢ UTR showing the location and sequence of the AU-rich regions of interest within the ‘extended ARE’, and the sequences of the various ‘extended ARE’ mutants that were generated.

ARE I and III are not independent functional destabilizing elements

(Fig. 4). Collectively,

in decay characteristics similar to the b-globinPAI)2 wild-type transcript (t1 ⁄ 2 (cid:2)178 min and t1 ⁄ 2 (cid:2)198 min, respectively) these experiments demonstrate that the 108 nucleotide ‘extended ARE’ contains all the essential destabilizing elements in the PAI-2 3¢ UTR.

A

B

To assess the relative contribution of these additional ARE elements, the essential residues in ARE I and III were mutated either alone or in combination to create plasmids pTETGLOARE I-MUT, pTETGLOARE III-MUT and pTETGLOARE I+III-MUT (Fig. 2) within the context of the full-length PAI-2 3¢ UTR, and the inﬂuence of these mutations on the mRNA decay characteristics was determined. As shown in Fig. 5, the estimated half-lives of these transcripts were (cid:2)231 min for the b-globinPAI)2 wild-type transcript, (cid:2)204 min for the b-globinARE I-MUT, (cid:2)193 min for the b-globinARE III-MUT and (cid:2)224 min for the b-globinARE I+III-MUT. These experiments dem- onstrate that ARE I and III, both of which are composed of classical pentameric sequence AUUUA, do not independently contribute to the instability of the PAI-2 transcript.

ARE I acts as a functional auxiliary element to the core destabilizing ARE II site

C

To assess the possibility that the destabilizing activity exhibited by the ‘extended ARE’ was the result of

is deleted.

Fig. 3. Deletion of the ‘extended’ ARE from the PAI-2 3¢ UTR results in a stabilization reminiscent to the wild-type b-globin tran- script. (A) Rabbit-b-globin-PAI-2 3¢ UTR constructs prepared for the transient transfection of HT1080-TET OFF cells. Plasmids pTET- GLOPAI)2, containing the full-length PAI-2 3¢ UTR, and pTET- GLO3¢ UTRDARE in which the ‘extended ARE’ (B, C) HT1080-TET OFF cells were transfected with the TET-responsive b-globin reporter plasmids described in (A) and the b-globin mRNA decay curves were quantiﬁed by RPA as described in Fig. 1 and the Experimental procedures. The experiments shown in (C) were repeated three times and each point represents the mean ± SE.

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1334

S. Stasinopoulos et al.

PAI-2 mRNA decay requires a multicomponent ARE

A

B

C

Fig. 5. The PAI-2 ‘extended ARE’ contains two classical pentamer- ic sequences (AUUUA), designated as ARE I and III, that do not independently function as instability elements. (A) Rabbit-b-globin- PAI-2 3¢ UTR constructs prepared for the transient transfections of HT1080-TET OFF cells. The full-length PAI-2 3¢ UTR was cloned into the 3¢ UTR of b-globin creating plasmid pTETGLOPAI)2. A ﬁve nucleotide substitution (as shown in Fig. 2) was introduced into the ARE I and the ARE III pentameric sequences, individually or in com- to create pTETGLOARE I-MUT, pTETGLOARE III-MUT and bination, pTETGLOARE I+III-MUT. (B) HT1080-TET OFF cells were transfected with the TET-responsive b-globin reporter plasmids described in (A) and the b-globin mRNA decay curves were quantiﬁed by RPA as described in Fig. 1 and the Experimental procedures. The experi- ments shown in (B) were repeated two or three times and each point represents the mean ± SE.

containing

the

and

pTETGLOEXT.ARE

transcript

((cid:2) 192 min)

Fig. 4. The 108 nucleotide ‘extended ARE’ independently confers mRNA instability in an analogous manner to the PAI-2 full-length 3¢ UTR. (A) Rabbit-b-globin-PAI-2 3¢ UTR constructs prepared for the transient transfection of HT1080-TET OFF cells. Plasmids pTET- GLO, Plasmids pTETGLOPAI)2, containing the full-length PAI-2 108 nucleotide 3¢ UTR, ‘extended ARE’. (B, C) HT1080-TET OFF cells were transfected with the TET-responsive b-globin reporter plasmids described in (A) and the b-globin mRNA decay curves were quantiﬁed as described in Fig. 1 and according the northern hybridization protocol (see Experimental procedures). The experiments shown in (C) were repeated three times and each point represents the mean ± SE. The dotted line represents 50% mRNA remaining.

wild-type b-globinPAI)2 in this series of experiments (Fig. 6). This result suggests that ARE I is an essential functional auxiliary element to the core destabilizing ARE II sequence and that this combination of AU-rich elements (ARE I ⁄ ARE II) plays a central role in determining the half-life of the PAI-2 mRNA transcript under physiological conditions.

Curiously,

the half-life of

(Fig. 1). This

implies

transcript was

the b-globinARE II+III double mutant transcript was only partially stabilized to (cid:2)347 min (Fig. 6), which is also reminiscent of the the b-globinARE II-MUT half-life of (cid:2)333 min for transcript is that ARE III unlikely to cooperate with the AREII ⁄ nonameric to contribute to the destabilizing activity element of the ‘extended ARE’ in the presence of an active ARE I.

cooperation between the classical AU-rich elements, double-ARE mutants (ARE II and ARE I; or ARE II and ARE III) were created within the context of the full-length PAI-2 3¢ UTR to create constructs pTETGLOARE I+II-MUT and pTETGLOARE II+III-MUT and their decay characteristics were determined. The b-globinARE I+II-MUT signiﬁcantly stabilized (t1 ⁄ 2 > 480 min; Fig. 6), to a level reminis- cent to that seen for the b-globin (Figs 1 and 4) and b-globinARED (Fig. 3) transcripts, compared to the

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1335

S. Stasinopoulos et al.

PAI-2 mRNA decay requires a multicomponent ARE

A

B

contributed to the decay rate, the same seven nucleo- tide substitution (gUUAUUUAUUaugcauuccuau) was introduced into the abutting atypical ARE IV site within the context of the full-length 3¢ UTR (Fig. 2) the plasmid pTETGLOARE IV-MUT. As to create determined by our TET-regulated globin mRNA decay system, disruption of this element resulted in a half-life the b-globinARE IV-MUT transcript of (cid:2) 223 min of (Fig. 8) compared to the half-life of the b-globinPAI)2 wild-type transcript ((cid:2) 182 min), which is unlikely to be a signiﬁcant difference. Hence, ARE IV is unlikely to function as an independent PAI-2 mRNA destabi- lizing element.

C

To determine whether the adjacent elements (ARE II and IV) could destabilize the transcript in an additive or cooperative manner in an analogous way to the AREI ⁄ AREII region, both the ARE II and the abutting ARE IV sequence were mutated (gUUAAAGCUUaugcauuccuau) within the context of the full-length 3¢ UTR to create the plasmid pTET- GLOARE II+IV-MUT. This plasmid was transiently transfected into HT1080 TET-OFF cells and the half- life of the b-globinARE II+IV-MUT transcript was sub- stantially increased (t1 ⁄ 2 > 480 min) (Fig. 8), which is equivalent to the high level of stability of the b-globin, the b-globinARED and the b-globinARE I+II-MUT tran- scripts (Figs 1, 3 and 6, respectively).

Fig. 6. The ARE I pentameric sequence can optimize the mRNA destabilizing activity of the ARE II nonameric sequence. (A) Rabbit- b-globin-PAI-2 3¢UTR constructs prepared for the transient transfec- tion of HT1080-TET OFF cells. Double ARE mutants were con- structed by combining ARE I-MUT and ARE II-MUT to create plasmid pTETGLOARE I+II-MUT and by combining ARE II and ARE III to create plasmid pTETGLOARE II+III-MUT (Fig. 2). (B, C) HT1080-TET OFF cells were transfected with the TET-responsive b-globin repor- ter plasmids described in (A) and the b-globin mRNA decay curves were quantiﬁed by RPA as described in Fig. 1 and the Experimental procedures. The graph in (C) corresponds to the experiments shown in (B) (n = 3–5). Each point represents the mean ± SE.

The ‘extended ARE’ contains an alternate atypical AU-rich auxiliary element that interacts with the core ARE II sequence

RNA electrophoretic mobility shift assays (REMSA) were next performed to determine whether these adja- cent ARE sites played a role in protein binding activ- ity. Initial experiments conﬁrmed that the extended wild-type ARE sequence provided speciﬁc protein binding sites for cytoplasmic proteins extracted from HT1080 TET-OFF cells (Fig. S1A). Subsequent analy- ses further indicate that mutations introduced into ARE II substantially reduced protein binding activity, which is consistent with our previous results using shorter RNA probes [48]. However, mutations intro- duced into the adjacent ARE IV had only a minimal effect on binding activity. When both the ARE II and IV sites were mutated simultaneously, binding activity was reduced to the level seen with mutations in ARE II alone (Fig. S1B). Hence, ARE IV does not appear to modulate protein binding activity to the ‘extended ARE’, despite the fact that it contributes to mRNA stability. Whether this is a consequence of the limita- the REMSA approach or the inﬂuence of tion of alternative functional AREs (e.g. ARE I) remains unknown.

and a

the human PAI-2 3¢ UTR with Comparison of those from a number of mammalian species (Fig. 7) using clustalw [50a] analyses revealed a high degree (nonameric) of conservation between the ARE II atypical AU-rich 12 nucleotide sequences sequence (labelled ARE IV) immediately 3¢ to ARE II. sequence To determine the extent

to which this

Taken together, the results obtained in the present study suggest that the functional PAI-2 3¢ UTR insta- bility sequence consists of an essential core nonameric sequence, for which the optimal destabilizing activity

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1336

S. Stasinopoulos et al.

PAI-2 mRNA decay requires a multicomponent ARE

Fig. 7. CLUSTALW analyses of the PAI-2 ‘extended ARE’ from different mammalian species reveals a high degree conservation in the ARE II and ARE IV regions; human (accession no. J02685), Pan troglodytes (accession no. XM_001148307), mouse (accession no. X16490), and rat (accession no. X64563). The open boxes indicate the relative positions of the human ARE I, II, III and IV elements.

PAI-2 3¢ UTR contained additional functional instabil- ity elements, AU-rich or otherwise [37,54,55], that could contribute to the overall decay rate of the tran- script.

depends on the cooperative activity of two auxiliary elements. One is a pentameric motif (ARE I) located 55 nucleotides upstream of the core ARE II element, and the second is an atypical AU-rich sequence (ARE IV) abutting 3¢ to the core ARE II sequence (Fig. 7). This functional multidomain ARE structure has been observed in a variety of class I and II ARE elements, including those of c-fos, GM-CSF, IL-8 [28,29,33].

Discussion

tumour

and

PAI-2 is a serine protease inhibitor and is a highly-reg- ulated member of the plasminogen activator system, and is one of the most highly inducible genes known. expression can be dramatically increased in Its to cytokines, growth factors, hormones, response promoters lipopolysaccharides [16,18,20,21,51]. Although the impressive induction of PAI-2 has been attributed to transcriptional events, work from the early to mid-1990s demonstrated that PAI-2 gene expression could be regulated post-trans- criptionally via the modulation of mRNA stability [19,24].

Our analysis of the PAI-2 mRNA 3¢ UTR sequence revealed that the nonameric element was present in the centre of a 108 nucleotide class I type of ARE element consisting of three copies of the AUUUA that were evenly distributed within a U-rich motif (54%) region and an atypical ARE (AREIV) immedi- ately adjacent to the nonameric element. Moreover, this region did not contain three to six clustered AUUUA motifs, which is indicative of class II ARE elements [35,56]. On the basis of this sequence analy- sis, we hypothesized that this 108 nucleotide AU-rich sequence contained all the essential destabilizing ele- ments in the PAI-2 3¢ UTR, and we conﬁrmed this by demonstrating that either deleting the 108 nucleo- tide ARE (Fig. 3) or replacing it with an irrelevant sequence of equivalent length (data not shown) stabi- lized the transcript to a level equivalent to that seen for the wild-type b-globin transcript. Furthermore, we also demonstrated that the 108 nucleotide ARE was sufﬁcient to destabilize the b-globin transcript with kinetics similar to those seen with the PAI-2 full-length 3¢ UTR.

(AUUUA)

The pentameric motif

located

(UUAUUUAUU)

transcript

We previously demonstrated that human PAI-2 mRNA was inherently unstable, with a half-life of (cid:2) 1 h and that most of the destabilizing activity was attributed to the 3¢ UTR [24] and, to a lesser extent, an instability element within exon 4 of the coding region [52]. It was originally predicted the nonameric 304 nucleotides ARE upstream of the poly(A) tail was largely responsible for the 3¢ UTR driven-instability of the PAI-2 tran- script. However, mutagenesis of this nonameric ARE only partially stabilized both a HGH-PAI2-3¢ UTR chimeric transcript [48] and a b-globin-PAI-2 3¢ UTR chimeric transcript (present study). Work from other groups has demonstrated that the presence of a single nonameric element [UUAUUUA(U ⁄ A)(U ⁄ A)] within a 3¢ UTR has a modest effect on the stability of a repor- ter transcript [34,53]; as such, we predicted that the

is the minimal active destabilizing sequence element when present within an appropriate AU-rich or U-rich environment. We therefore tested the hypothesis that each of these pentameric AREs (ARE I, II and III) contributed instability and, as equally to the overall such, were functionally equivalent in an analogous manner to the three pentameric motifs located in the c-fos transcript [33]. However, this set of experiments (Fig. 5) demonstrated that ARE I and III did not con- tribute to transcript instability, either individually or in combination (Fig. 5). We then sought an alternative model to explain the destabilizing characteristics of the PAI-2 ‘extended ARE’ element.

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1337

S. Stasinopoulos et al.

PAI-2 mRNA decay requires a multicomponent ARE

A

B

C

the transient

duction of two different sets of double mutations (e.g. ARE II + ARE IV mutant and ARE II + ARE I mutant). Taking into consideration the fact that muta- genesis of either ARE I or ARE IV in isolation (Figs 5 and 8, respectively) did not inﬂuence the transcript’s decay rate, we propose that the ARE II nonameric sequence forms the core destabilizing domain of the PAI-2 ARE and that its optimal destabilizing activity requires the contribution of either the 3¢ abutting ARE IV (AUUUUAUAUAAU) sequence or the 5¢ ARE I pentameric motif. Apart from optimizing the destabi- lizing activity of the core ARE II sequence, the ARE IV and ARE I elements also appear to buffer effects of mutations in the core ARE II nonameric sequence, thereby retaining the AREs destabilizing activity, albeit less efﬁciently (Fig. 1). Subsequently, we suggest that the PAI-2 ARE IV and ARE I elements can act as auxiliary elements to the PAI-2 core ARE II sequence. To investigate the means by which these ARE elements cooperate in modulating PAI-2 mRNA stability, REMSA analyses were performed to determine the role of the ARE II and ARE IV sites in the binding of proteins to the ‘extended ARE’. Binding of cytoplas- mic proteins to the ‘extended ARE’ probe was ﬁrst shown to be speciﬁc as determined by competition titration experiments. ARE II was shown to play a sig- niﬁcant role in this binding activity because a four nucleotide substitution introduced into the ARE II caused substantial decrease in binding activity. By con- trast, mutagenesis of ARE IV had no noticeable effect on the binding of proteins to the ‘extended ARE’ and had no additional suppression of protein binding activ- ity in the presence of the mutated ARE II. Hence, ARE IV does not appear to modulate protein binding activity to the ‘extended ARE’. The means by which ARE IV cooperates with ARE II to destabilize mRNA still remains unknown. The role of the ARE 1 site was not investigated in the present study and will be the subject of future research.

Fig. 8. An atypical AU-rich sequence (ARE IV) abutting 3¢ to the ARE II pentameric sequence can optimize the mRNA destabilizing activity of the ARE II nonameric sequence. (A) Rabbit-b-globin-PAI-2 3¢ UTR constructs prepared for transfection of HT1080-TET OFF cells. The AU-rich sequence (ARE IV) abutting 3¢ to the ARE II pentameric motif was mutated to create plasmid pTETGLOARE IV-MUT; a double ARE mutant that combined ARE II-MUT and ARE IV was constructed to create plasmid pTETGLOARE II+IV-MUT (Fig. 2). (B, C) HT1080-TET OFF cells were transfected with the TET-responsive b-globin reporter plasmids described in (A) and the b-globin mRNA decay curves were quanti- ﬁed by RPA as described in Fig. 1. The experiments shown in (C) were repeated three times and each point represents the mean ± SE.

functionally interdependent domains

We next investigated the possibility that the struc- ture of the PAI-2 ‘extended ARE’ was based on a multidomain model consisting of an essential, func- the ARE II tional destabilizing core domain (e.g. nonameric sequence), for which the destabilizing activ- ity was optimized by the presence of nearby auxiliary AU-rich sequences. Figures 6 and 8 demonstrate that the b-globin-PAI-2 3¢ UTR chimeric transcript was only stabilized in an manner comparable to the b-glo- bin and the b-globinDARE transcripts, upon the intro-

Functional multidomain ARE structures have been observed in a variety of class I and II ARE elements, including those of c-fos, GM-CSF and IL-8, amongst others (Fig. 9) [28,29,33], and appear to function via similar mechanisms. Of greatest relevance to the PAI-2 ARE is the c-fos multidomain class I ARE, for which the structure and function has been characterized in detail; this ARE is composed of two structurally dis- tinct but [33] (Fig. 9). The c-fos ARE core sequence consists of three pentameric motifs embedded within a U-rich region and is independently capable of destabilizing a tran- is a script. The c-fos ARE auxiliary domain II indepen- 20 nucleotide U-rich sequence that cannot

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1338

S. Stasinopoulos et al.

PAI-2 mRNA decay requires a multicomponent ARE

Fig. 9. Multidomain structure of PAI-2 (accession no. J02685), c-fos (accession no. NM_005252), GM-CSF (accession no. M11220) and IL-8 (accession no. Y00787) AREs. Sequences of the AREs are shown with the AUUUAs underlined, and the relative positions of the core and auxiliary domains are overlined.

context

in the appropriate

(i.e. the core domain I) [33],

dently destabilize the transcript; however, when pres- immediately ent it up- or downstream of can stimulate the deadenylation rate and thereby increase the decay rate of the transcript. Moreover, domain II of c-fos also serves the essential function of buffering the effects of mutations occurring within domain I [33]. The relative

in that

the low constitutive levels of PAI-2 protein; however, the ARE can also modulate PAI-2 mRNA stability during physiological conditions that require high levels of PAI-2 gene expression and, subsequently, the contri- bution of post-transcriptional regulation to PAI-2 gene expression cannot be underestimated. The present study has focused on the characterization and ﬁne mapping of the functional destabilizing AU-rich region within the PAI-2 3¢ UTR under physiological condi- tions that result in an unstable PAI-2 mRNA tran- script. We have shown that the PAI-2 ARE is a 74 nucleotide multidomain (Fig. 9) class I element con- sisting of a destabilizing core nonameric element with activity that is supported by one of two auxiliary ele- ments. Hence, in an attempt to severely inhibit constit- utive PAI-2 gene expression, nature has evolved a functional, mutation insensitive, multidomain ARE element. We are currently determining the contribution and mechanism of this ARE, and the individual ARE domains, to PAI-2 mRNA stabilization and, subse- quently, PAI-2 gene expression.

Experimental procedures

Plasmids and mutant construction

location of a functional auxiliary domain, with respect to the core domain is ﬂexible because auxiliary domains have been identiﬁed either 5¢ or 3¢ to the core domains in class I and II AREs [28,29,33] (Fig. 9); moreover, placing the c-fos auxil- iary domain either 5¢ or 3¢ to the core domain resulted in a similar deadenylation and overall mRNA decay in rate [33]. The PAI-2 ARE is unusual addition to an auxiliary domain (Fig. 7, the atypical AU-rich ARE IV; Fig. 8) immediately 3¢ to the core, the ARE I (AUUUA) element located 5¢ to the core element (Figs 7 and 9) also behaves as a functional auxiliary domain in the presence of a mutated ARE IV (Fig. 8). Whether the two PAI-2 auxiliary domains are simultaneously active cannot be determined from the data obtained in the present study, although it does remain a plausible hypothesis. However, we suggest that, under normal physiological conditions, the destabilizing activity of the core domain is prefer- entially optimized by auxiliary domain I (Fig. 7, the atypical AU-rich ARE IV; Fig. 9) based on the high degree of homology in the equivalent sequences of other species (Fig. 7). Moreover, the addition of the second auxiliary sequence, domain I (Fig. 9), can sup- port the destabilizing activity of the core domain in the absence of domain IV (Fig. 8).

The vector pTETBBB was provided by A. B. Shyu (Univer- sity of Texas Medical School, Houston, TX, USA). This plasmid contains the gene for b-globin under the control of a tetracycline-regulated promoter that allows the transcrip- tion of this gene in the absence of tetracycline within an appropriate mammalian cell line (e.g. HT1080-TET OFF). the pTETBBB is referred to as pTETGLO throughout present study.

The PAI-2 3¢ UTR was ampliﬁed from plasmids pCMV- glo-PAI-2 3¢ UTR and pCMV-glo-PAI-2 3¢ UTR-ARE MUT [48] with primers SJS133 and SJS134, and cloned into the BglII site in the b-globin 3¢ UTR in pTETGLO, to gener- ate pTETGLOPAI)2 and pTETGLOARE II-MUT , respectively.

In summary, under normal physiological conditions, the PAI-2 mRNA transcript is unstable, which we now attribute to the presence of a multidomain AU-rich element within the 3¢ UTR (Fig. 9). ARE-mediated PAI-2 mRNA instability signiﬁcantly contributes to

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1339

S. Stasinopoulos et al.

PAI-2 mRNA decay requires a multicomponent ARE

involved seeding ﬁve 35 mm plates with experiment 5.0 · 105 cells and incubating overnight. The next day, each plate was transfected with a total of 1 lg of plasmid DNA and incubated at 37 (cid:2)C for 5 h. These cells were then trypsinized, combined and washed once with NaCl ⁄ Pi, equally seeded into ﬁve 35 mm to ensure equal transfection efﬁciency within samples and the plates were returned to the incubator for further incubation.

In vitro transcription and RNase protection assay and northern hybridization

construct digesting involved

Mutant variants of the PAI-2 3¢ UTR were generated via overlap extension PCR mutagenesis [57] using SJS133 and SJS134 as the external primers and the constructs pTET- GLOPAI)2 and pTETGLOARE II-MUT as the templates. Mutation of the ARE I-AUUUA and ARE III-AUUUA sequences used primers SJS172 and SJS173, and SJS174 and SJS175, respectively. Mutation of the atypical AU-rich sequence used primers SJS259 and SJS260, and the creation of the ARE II ⁄ ARE IV double mutant used primers SJS261 and SJS262. The mutagenesis of ARE I and III introduced HindIII restriction sites and so the creation of the pTET- GLO3¢ UTRDARE pTET- GLOARE I+III-MUT mutant with HindIII to remove the 108 bp ARE, gel purifying the larger fragment and self-liga- tion. The PAI-2 ‘extended ARE’ was ampliﬁed from plasmid pTETGLOPAI)2 using primers SJS137 and SJS138, and cloned into the BglII site in the b-globin 3¢ UTR in pTET- GLO, to generate pTETGLOEXT.ARE. The sequences of the primers used in the present study are listed in Table 1.

Cell culture and transfection

linearized pTEasy-Globin and SacII

Table 1. PCR and overlap PCR mutagenesis primers. The name, nucleotide sequence, orientation and GenBank nucleotide reference (where available) are provided. The introduced mutations are underlined,the restriction enzyme sites are italicized, and lower case indicates the T7 promoter sequence. PAI-2 cDNA (accession no. M18082), GADPH cDNA (accession no. M33197), pTETBBB plasmid sequence from Profes- sor A. B. Shyu (University of Texas Medical School, Houston, TX, USA). nt, nucleotide.

Orientation

Primer

Nucleotide sequence (5¢- to 3¢)

CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG

SJS133 SJS134 SJS137 SJS138 SJS172 SJS173 SJS174 SJS175 SJS259 SJS260 SJS261 SJS262 SJS167 SJS170 ALS030 SJS209 SJS275 SJS276

Forward (nt 1281–1298 PAI-2) Reverse (nt 1860–1843 PAI-2) Forward (nt 1491–1508 PAI-2) Reverse (nt 1620–1603 PAI-2) Forward (nt 1491–1520 PAI-2) Reverse (nt 1520–1491 PAI-2) Forward (nt 1596–1625 PAI-2) Reverse (nt 1625–1596 PAI-2) Forward (nt 1552–1585 PAI-2) Reverse (nt 1585–1552 PAI-2) Forward (nt 1552–1585 PAI-2) Reverse (nt 1585–1552 PAI-2) Forward (nt 455–474 pTETBBB) Reverse (nt 897–878 pTETBBB) Forward (nt 163–185 GAPDH) Reverse (nt 318–299 GAPDH) Reverse (nt 1620–1601 PAI-2) T7Forward (nt 1491–1508 PAI-2)

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1340

HT1080-TET OFF cells (Clontech) were maintained in DMEM supplemented with 10% fetal bovine serum and 100 lgÆmL)1 G418 (Life Technologies, Inc. Carlsbad, CA, USA). Cells were maintained at 37 (cid:2)C in the presence of 5% CO2. Transient transfections were performed via the Fugene (Roche, Basel, Switzerland) method according to the manufacturer’s instructions. A typical mRNA decay A cDNA library prepared with 1 lg of total RNA line transiently extracted from an HT1080 TET-off cell transfected with pTETBBB was used to generate the rabbit b-globin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) riboprobes. Accordingly, a 295 bp b-globin frag- ment that spans the ﬁrst intron was ampliﬁed using primers SJS167 and SJS170 and a 155 bp GAPDH fragment was ampliﬁed using primers ALS030 and SJS209; these frag- ments were then cloned into the pGEM-T Easy vector (Promega, Madison, WI, USA) generating pTEasy-Globin and pTEasy-GAPDH. For in vitro transcription, 500 ng of SpeI linearized pTEasy-GAPDH were incubated for 1 h in the presence of [a-32P]UTP (PerkinElmer Life and Analytical Sci- 50 lCi ences, Inc., Waltham, MA, USA), 10 lm UTP, 0.5 mm ATP, 0.5 mm CTP, 0.5 mm GTP, 40 U of RNase Inhibitor (Promega Corporation, Madison, WI, USA) and either

S. Stasinopoulos et al.

PAI-2 mRNA decay requires a multicomponent ARE

50 U of T7 Polymerase for pTEasy-Globin or 50 U of SP6 polymerase for pTEasy-GAPDH. The radioactive products were puriﬁed according to the RPA III kit instructions (Ambion Inc., Austin, TX, USA).

The RNase protection assay was carried out using the RPA III kit (Ambion) according to the manufacturers instructions with 7.5 lg of total RNA isolated from the transiently transfected HT1080 TET-OFF cells. The prod- (7 m urea ⁄ 5% ucts were resolved on a denaturing gel PAGE) and visualized by autoradiography. Signals were quantiﬁed using the ImageQuant, version 5 (Amersham Biosciences, Piscataway, NJ, USA) and the results were presented in graphical form after correcting for variations in GAPDH levels between time point samples.

nucleotides of the 5¢ and 3¢ ﬂanking sequence (wild-type or various mutants). Primers SJS276 and SJS275 were used to generate the various DNA fragments from plasmids pTET- GLOPAI)2, pTETGLOARE II-MUT, pTETGLOARE IV-MUT and pTETGLOARE II+IV-MUT. The unrelated 114 nucleo- tide RNA probe was derived from T7 transcribed KpnI digested pBluescript KS+. The RNA probes were puriﬁed on a 6% polyacrylamide-urea gel, eluted in a 500 mm NH4CH3COO, 1 mm EDTA solution overnight at room temperature, ethanol precipitated at –80 (cid:2)C and resus- pended in water ((cid:2)30 000 c.p.s.ÆlL)1). To prepare extracts for REMSAs, cells (80% conﬂuence) were collected by trypsinization, washed with NaCl ⁄ Pi, then lysed for 10 min on ice in 300 lL of cytoplasmic extraction buffer (10 mm Hepes, pH 7.1, 3 mm MgCl2, 14 mm KCl, 0.2% NP-40, 1 mm dithiothreitol, supplemented with protease inhibitors (complete EDTA free; Roche) and phosphatase inhibitors (Phospho-Stop; Roche). The nuclei were pelleted for 1 min at 1000 g at 4 (cid:2)C, and the supernatant containing the cyto- plasmic fraction was aliquoted, snap-frozen in liquid nitro- gen, and stored at –80 (cid:2)C. Cytoplasmic protein extracts and unlabelled RNA transcripts (for ‘extended ARE’ and unrelated RNA) for competition titration experiments were prepared as described previously [48].

Total RNA (10 lg) was resolved on a 1% formaldehyde- agarose gel and transferred to a Hybond-N nylon mem- brane (GE Healthcare, Piscataway, NJ, USA). RNA blots were stained with methylene blue to conﬁrm for equal load- ing and transfer. Hybridization was performed by the Rapid-Hyb hybridization protocol (GE Healthcare) using random primed [a-32P]dATP-labelled cDNA probes corre- sponding to rabbit b-globin and human GAPDH isolated from plasmids pTEasy-Globin and pTEasy-GAPDH. Hybridization signals were visualized and quantiﬁed with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA, USA).

Tet-off b-globin mRNA decay assay

For the binding reactions, 0.5–5 lg of protein extract was preincubated with 150 lg of heparin in a total volume of 20 lL for 10 min at room temperature in cytoplasmic extraction buffer before the addition of the RNA probe (60 000 c.p.s.). After 30 min of incubation at room temperature, samples were treated with 0.6–3.0 U of RNase T1 (Roche Molecular Biochemicals, Indianapo- lis, IN, USA) for 10 min at room temperature and then subjected to electrophoresis through a 5% native PAGE, and protein–RNA complexes were visualized by auto- radiography.

References

1 Hibino T, Matsuda Y, Takahashi T & Goetinck PF (1999) Suppression of keratinocyte proliferation by plasminogen activator inhibitor-2. J Invest Dermatol 112, 85–90. 2 Jensen PJ, Wu Q, Janowitz P, Ando Y & Schechter

HT1080-TET OFF cells were transiently transfected with the pTETGLO and various pTETGLO-PAI-2 3¢ UTR plasmids and seeded into 35 mm plates as described above. After 16 h of incubation, doxycycline was added to stop transcription from the tetracycline responsive promoter and total RNA was harvested in Trizol at the indicated times. Total RNA (7.5 lg) from each sample was analysed by RNase protection assay or by northern analysis (10 lg of total RNA) using the intron spanning 32P-labelled globin and GAPDH probes described above. The b-globin and GAPDH mRNA band intensities were visualized and quantiﬁed with a Phosphorimager Storm (Molecular Dynamics). For each sample, the hybridization intensity value of b-globin was normalized to GAPDH mRNA levels. The normalized b-globin mRNA levels at time 0 h was set to 100% and all other normalized b-globin mRNA values are plotted over time relative to the value at 0 h and the half-lives were calculated for each transfection group. NM (1995) Plasminogen activator inhibitor type 2: an intracellular keratinocyte differentiation product that is incorporated into the corniﬁed envelope. Exp Cell Res 217, 65–71.

REMSAs

3 Shafren DR, Gardner J, Mann VH, Antalis TM & Suhrbier A (1999) Picornavirus receptor down- regulation by plasminogen activator inhibitor type 2. J Virol 73, 7193–7198.

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1341

4 Yu H, Maurer F & Medcalf RL (2002) Plasminogen activator inhibitor type 2: a regulator of monocyte proliferation and differentiation. Blood 99, 2810– 2818. Radiolabelled RNAs were prepared by in vitro transcription as described above, using DNA templates generated by PCR that had an incorporated core T7 promoter region. This DNA was used to transcribe a 128 nucleotide sequence included the 108 nucleotide ARE region and ten that

S. Stasinopoulos et al.

PAI-2 mRNA decay requires a multicomponent ARE

phorbol ester-mediated differentiation of U-937 human histiocytic lymphoma cells. Mol Cell Biol 7, 4564–4567. 17 Genton C, Kruithof EK & Schleuning WD (1987)

5 Yebra M, Parry GC, Stromblad S, Mackman N, Rosenberg S, Mueller BM & Cheresh DA (1996) Requirement of receptor-bound urokinase-type plasmin- ogen activator for integrin alphavbeta5-directed cell migration. J Biol Chem 271, 29393–29399.

Phorbol ester induces the biosynthesis of glycosylated and nonglycosylated plasminogen activator inhibitor 2 in high excess over urokinase-type plasminogen activa- tor in human U-937 lymphoma cells. J Cell Biol 104, 705–712. 6 Kruithof EK, Baker MS & Bunn CL (1995) Biological and clinical aspects of plasminogen activator inhibitor type 2. Blood 86, 4007–4024.

18 Medcalf RL (1992) Cell- and gene-speciﬁc interactions between signal transduction pathways revealed by oka- daic acid. Studies on the plasminogen activating system. J Biol Chem 267, 12220–12226. 7 Gan H, Lee J, Ren F, Chen M, Kornfeld H & Remold HG (2008) Mycobacterium tuberculosis blocks crosslink- ing of annexin-1 and apoptotic envelope formation on infected macrophages to maintain virulence. Nat Immu- nol 9, 1189–1197.

8 Park JM, Greten FR, Wong A, Westrick RJ, Arthur JS, Otsu K, Hoffmann A, Montminy M & Karin M (2005) Signaling pathways and genes that inhibit pathogen-induced macrophage apoptosis–CREB and NF-kappaB as key regulators. Immunity 23, 319– 329. 19 Pytel BA, Peppel K & Baglioni C (1990) Plasminogen activator inhibitor type-2 is a major protein induced in human ﬁbroblasts and SK-MEL-109 melanoma cells by tumor necrosis factor. J Cell Physiol 144, 416–422. 20 Medcalf RL, Kruithof EK & Schleuning WD (1988) Plasminogen activator inhibitor 1 and 2 are tumor necrosis factor ⁄ cachectin-responsive genes. J Exp Med 168, 751–759.

21 Suzuki T, Hashimoto S, Toyoda N, Nagai S, Yamazaki N, Dong HY, Sakai J, Yamashita T, Nukiwa T & Matsushima K (2000) Comprehensive gene expression proﬁle of LPS-stimulated human monocytes by SAGE. Blood 96, 2584–2591. 9 Antalis TM, La Linn M, Donnan K, Mateo L, Gardner J, Dickinson JL, Buttigieg K & Suhrbier A (1998) The serine proteinase inhibitor (serpin) plasminogen activa- tion inhibitor type 2 protects against viral cytopathic effects by constitutive interferon alpha ⁄ beta priming. J Exp Med 187, 1799–1811. 10 Dickinson JL, Bates EJ, Ferrante A & Antalis TM

(1995) Plasminogen activator inhibitor type 2 inhibits tumor necrosis factor alpha-induced apoptosis. Evidence for an alternate biological function. J Biol Chem 270, 27894–27904. 11 Kumar S & Baglioni C (1991) Protection from tumor

22 Schwartz BS & Bradshaw JD (1992) Regulation of plas- minogen activator inhibitor mRNA levels in lipopolysac- charide-stimulated human monocytes. Correlation with production of the protein. J Biol Chem 267, 7089–7094. 23 Buechler C, Ullrich H, Ritter M, Porsch-Oezcueruemez M, Lackner KJ, Barlage S, Friedrich SO, Kostner GM & Schmitz G (2001) Lipoprotein (a) up-regulates the expression of the plasminogen activator inhibitor 2 in human blood monocytes. Blood 97, 981–986. necrosis factor-mediated cytolysis by overexpression of plasminogen activator inhibitor type-2. J Biol Chem 266, 20960–20964. 12 Lian X & Yang T (2004) Plasminogen activator inhibi-

tor 2: expression and role in differentiation of epidermal keratinocyte. Biol Cell 96, 109–116.

24 Maurer F & Medcalf RL (1996) Plasminogen activator inhibitor type 2 gene induction by tumor necrosis factor and phorbol ester involves transcriptional and post- transcriptional events. Identiﬁcation of a functional nonameric AU-rich motif in the 3¢-untranslated region. J Biol Chem 271, 26074–26080. 25 Niiya K, Taniguchi T, Shinbo M, Ishikawa T, Tazawa 13 Haile WB, Coleman JL & Benach JL (2006) Reciprocal upregulation of urokinase plasminogen activator and its inhibitor, PAI-2, by Borrelia burgdorferi affects bacterial penetration and host-inﬂammatory response. Cell Microbiol 8, 1349–1360.

14 Varro A, Noble PJ, Pritchard DM, Kennedy S, Hart CA, Dimaline R & Dockray GJ (2004) Helicobacter pylori induces plasminogen activator inhibitor 2 in gas- tric epithelial cells through nuclear factor-kappaB and RhoA: implications for invasion and apoptosis. Cancer Res 64, 1695–1702. S, Hayakawa Y & Sakuragawa N (1994) Different regu- lation of plasminogen activator inhibitor 2 gene expres- sion by phorbol ester and cAMP in human myeloid leukemia cell line PL-21. Thromb Haemost 72, 92–97. 26 Antalis TM & Dickinson JL (1992) Control of plasmin- ogen-activator inhibitor type 2 gene expression in the differentiation of monocytic cells. Eur J Biochem 205, 203–209. 15 Losick VP & Isberg RR (2006) NF-kappaB transloca- 27 Wilusz CJ & Wilusz J (2004) Bringing the role of

mRNA decay in the control of gene expression into focus. Trends Genet 20, 491–497.

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1342

28 Xu N, Chen CY & Shyu AB (1997) Modulation of the fate of cytoplasmic mRNA by AU-rich elements: key tion prevents host cell death after low-dose challenge by Legionella pneumophila. J Exp Med 203, 2177–2189. 16 Schleuning WD, Medcalf RL, Hession C, Rothenbuhler R, Shaw A & Kruithof EK (1987) Plasminogen activa- tor inhibitor 2: regulation of gene transcription during

S. Stasinopoulos et al.

PAI-2 mRNA decay requires a multicomponent ARE

42 Stoecklin G, Mayo T & Anderson P (2006) ARE- sequence features controlling mRNA deadenylation and decay. Mol Cell Biol 17, 4611–4621. mRNA degradation requires the 5¢-3¢ decay pathway. EMBO Rep. 7, 72–77.

43 Lykke-Andersen J & Wagner E (2005) Recruitment and activation of mRNA decay enzymes by two ARE-medi- ated decay activation domains in the proteins TTP and BRF-1. Genes Dev 19, 351–361. 29 Winzen R, Gowrishankar G, Bollig F, Redich N, Resch K & Holtmann H (2004) Distinct domains of AU-rich elements exert different functions in mRNA destabiliza- tion and stabilization by p38 mitogen-activated protein kinase or HuR. Mol Cell Biol 24, 4835–4847. 30 Bevilacqua A, Ceriani MC, Capaccioli S & Nicolin A

(2003) Post-transcriptional regulation of gene expression by degradation of messenger RNAs. J Cell Physiol 195, 356–372. 44 Fenger-Gron M, Fillman C, Norrild B & Lykke-Ander- sen J (2005) Multiple processing body factors and the ARE binding protein TTP activate mRNA decapping. Mol Cell 20, 905–915.

31 Benjamin D & Moroni C (2007) mRNA stability and cancer: an emerging link? Expert Opin Biol Ther 7, 1515–1529. 45 Murray EL & Schoenberg DR (2007) A+U-rich insta- bility elements differentially activate 5¢-3¢ and 3¢-5¢ mRNA decay. Mol Cell Biol 27, 2791–2799.

46 Bakheet T, Williams BR & Khabar KS (2006) ARED 3.0: the large and diverse AU-rich transcriptome. Nucleic Acids Res 34, D111–D114. 32 Akashi M, Shaw G, Hachiya M, Elstner E, Suzuki G & Koefﬂer P (1994) Number and location of AUUUA motifs: role in regulating transiently expressed RNAs. Blood 83, 3182–3187.

47 Khabar KS (2005) The AU-rich transcriptome: more than interferons and cytokines, and its role in disease. J Interferon Cytokine Res 25, 1–10.

48 Maurer F, Tierney M & Medcalf RL (1999) An AU-rich sequence in the 3¢-UTR of plasminogen activator inhibitor type 2 (PAI-2) mRNA promotes PAI-2 mRNA decay and provides a binding site for nuclear HuR. Nucleic Acids Res 27, 1664–1673.

49 Yu H, Stasinopoulos S, Leedman P & Medcalf RL (2003) Inherent instability of plasminogen activator inhibitor type 2 mRNA is regulated by tristetraprolin. J Biol Chem 278, 13912–13918. 33 Chen CY, Chen TM & Shyu AB (1994) Interplay of two functionally and structurally distinct domains of the c-fos AU-rich element speciﬁes its mRNA-destabi- lizing function. Mol Cell Biol 14, 416–426. 34 Lagnado CA, Brown CY & Goodall GJ (1994) AUUUA is not sufﬁcient to promote poly(A) shortening and degradation of an mRNA: the functional sequence within AU-rich elements may be UUAUUUA(U ⁄ A)(U ⁄ A). Mol Cell Biol 14, 7984–7995. 35 Chen CY & Shyu AB (1995) AU-rich elements: charac- terization and importance in mRNA degradation. Trends Biochem Sci 20, 465–470. 36 Wilson T & Treisman R (1988) Removal of poly(A)

and consequent degradation of c-fos mRNA facilitated by 3¢ AU-rich sequences. Nature 336, 396–399. 50 Xu N, Loﬂin P, Chen CY & Shyu AB (1998) A broader role for AU-rich element-mediated mRNA turnover revealed by a new transcriptional pulse strategy. Nucleic Acids Res 26, 558–565. 50a Thomson JD, Higgins DG & Gibson TJ (1994)

37 Chen CY & Shyu AB (1994) Selective degradation of early-response-gene mRNAs: functional analyses of sequence features of the AU-rich elements. Mol Cell Biol 14, 8471–8482.

CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weight- ing, position-speciﬁc gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673–4680. 51 Bystrom J, Wynn TA, Domachowske JB & Rosenberg

38 Gherzi R, Lee KY, Briata P, Wegmuller D, Moroni C, Karin M & Chen CY (2004) A KH domain RNA bind- ing protein, KSRP, promotes ARE-directed mRNA turnover by recruiting the degradation machinery. Mol Cell 14, 571–583. HF (2004) Gene microarray analysis reveals interleukin-5-dependent transcriptional targets in mouse bone marrow. Blood 103, 868–877. 52 Tierney MJ & Medcalf RL (2001) Plasminogen

39 Chen CY, Gherzi R, Ong SE, Chan EL, Raijmakers R, Pruijn GJ, Stoecklin G, Moroni C, Mann M & Karin M (2001) AU binding proteins recruit the exo- some to degrade ARE-containing mRNAs. Cell 107, 451–464. 40 Mukherjee D, Gao M, O’Connor JP, Raijmakers R, activator inhibitor type 2 contains mRNA instability elements within exon 4 of the coding region. Sequence homology to coding region instability determinants in other mRNAs. J Biol Chem 276, 13675–13684.

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1343

53 Zubiaga AM, Belasco JG & Greenberg ME (1995) The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation. Mol Cell Biol 15, 2219–2230. 54 Chen CY, Xu N & Shyu AB (1995) mRNA decay mediated by two distinct AU-rich elements from c-fos Pruijn G, Lutz CS & Wilusz J (2002) The mammalian exosome mediates the efﬁcient degradation of mRNAs that contain AU-rich elements. EMBO J 21, 165–174. 41 Franks TM & Lykke-Andersen J (2007) TTP and BRF proteins nucleate processing body formation to silence mRNAs with AU-rich elements. Genes Dev 21, 719– 735.

S. Stasinopoulos et al.

PAI-2 mRNA decay requires a multicomponent ARE

Supporting information

and granulocyte-macrophage colony-stimulating factor transcripts: different deadenylation kinetics and uncoupling from translation. Mol Cell Biol 15, 5777–5788.

The following supplementary material is available: Fig. S1. The ‘extended ARE’ provides speciﬁc binding sites for cytoplasmic proteins.

This supplementary material can be found in the

online version of this article.

55 Stoecklin G, Lu M, Rattenbacher B & Moroni C (2003) A constitutive decay element promotes tumor necrosis factor alpha mRNA degradation via an AU-rich element-independent pathway. Mol Cell Biol 23, 3506– 3515.

56 Barreau C, Paillard L & Osborne HB (2005) AU-rich elements and associated factors: are there unifying principles? Nucleic Acids Res 33, 7138–7150.

Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing ﬁles) should be addressed to the authors.

FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS

1344

57 Ho SN, Hunt HD, Horton RM, Pullen JK & Pease LR (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59.