Báo cáo khoa học: Characterization of the secreted chorismate mutase from the pathogen Mycobacterium tuberculosis

Characterization of the secreted chorismate mutase from the pathogen Mycobacterium tuberculosis Severin Sasso, Chandra Ramakrishnan, Marianne Gamper, Donald Hilvert and Peter Kast

Laboratorium fu¨ r Organische Chemie, Swiss Federal Institute of Technology, Zu¨ rich (ETH), Switzerland

Keywords chorismate mutase; Mycobacterium tuberculosis; pathogenesis; shikimate pathway; signal sequence

Correspondence P. Kast, Laboratorium fu¨ r Organische Chemie, Swiss Federal Institute of Technology, ETH Ho¨ nggerberg – HCI F333, CH-8093 Zu¨ rich, Switzerland Fax: +41 1633 1326 Tel: +41 1632 2908 E-mail: kast@org.chem.ethz.ch

(Received 12 October 2004, revised 4 November 2004, accepted 12 November 2004)

doi:10.1111/j.1742-4658.2004.04478.x

The gene encompassing ORF Rv1885c with weak sequence similarity to AroQ chorismate mutases (CMs) was cloned from the genome of Mycobac- terium tuberculosis and expressed in Escherichia coli. The gene product (*MtCM) complements a CM-deficient E. coli strain, but only if produced without the predicted N-terminal signal sequence typical of M. tuberculosis. The mature *MtCM, which was purified by exploiting its resistance to irre- versible thermal denaturation, possesses high CM activity in vitro. The enzyme follows simple Michaelis–Menten kinetics, having a kcat of 50 s)1 and a Km of 180 lm (at 30 (cid:1)C and pH 7.5). *MtCM was shown to be a dimer by analytical ultracentrifugation and size-exclusion chromatography. Secondary-structure prediction and CD spectroscopy confirmed that *MtCM is a member of the all-a-helical AroQ class of CMs, but it seems to have a topologically rearranged AroQ fold. Because CMs are normally intracellular metabolic enzymes required for the biosynthesis of phenyl- alanine and tyrosine, the existence of an exported CM in Gram-positive M. tuberculosis is puzzling. The observation that homologs of *MtCM with a predicted export sequence are generally only present in parasitic or pathogenic organisms suggests that secreted CMs may have evolved to par- ticipate in some aspect of parasitism or pathogenesis yet to be unraveled.

The intracellular shikimate pathway is essential in bac- teria, fungi, algae and plants for the synthesis of aro- matic compounds [1], but is absent from mammals and thus represents a promising target for antimicrobial or antifungal agents and herbicides. The branch point intermediate of the shikimate pathway is chorismate, and its partitioning towards the individual aromatic products is controlled by the activities of several chor- ismate-metabolizing enzymes. One of these is choris- mate mutase (CM; EC 5.4.99.5), which catalyzes the Claisen rearrangement of chorismate to prephenate, the committed step [2] in the biosynthesis of tyrosine and phenylalanine (Fig. 1A) [1].

Interestingly, two totally unrelated protein scaffolds have evolved to carry out the CM reaction with similar

efficiencies ([3,4], Fig. 1B). Enzymes of the relatively rare AroH class, including the monofunctional CMs from Bacillus subtilis (BsCM) and Thermus thermophi- lus have a trimeric pseudo a ⁄ b barrel structure [5–7]. In contrast, proteins of the a-helical AroQ class, repre- sented by the structurally characterized CM domain of the Escherichia coli chorismate mutase-prephenate dehydratase (EcCM [8]), and the CM from the yeast Saccharomyces cerevisiae [9,10], are considerably more abundant. EcCM, the prototype for an AroQ class is an intertwined dimer consisting of two member, three a-helices each ([8], Fig. 1B). The subunits of S. cerevisiae CM is a more elaborate variant of the basic AroQ fold. It is also dimeric, but each subunit, which is believed to have arisen from a duplicated

Abbreviations CM, chorismate mutase; *MtCM, secreted Mycobacterium tuberculosis CM; BsCM, Bacillus subtilis CM; EcCM, CM domain of the bifunctional Escherichia coli chorismate mutase-prephenate dehydratase; IPTG, isopropyl thio-b-D-galactoside.

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

375

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

A

B

Fig. 1. Chorismate mutase. (A) Biosynthesis of aromatic compounds via the shikimate pathway. Chorismate mutase (CM) catalyzes the com- mitted step of the branch towards phenylalanine and tyrosine. The information next to the arrows corresponding to enzymatic steps refers to already assigned genes in the M. tuberculosis genome [20] (http://genolist.pasteur.fr/TubercuList, see Discussion). (B) Ribbon diagrams of EcCM [8] and BsCM [5,6], the prototypic enzymes of the AroQ and AroH class, respectively, complexed with transition state analog 1 (as ball and stick model). The atomic coordinates for the crystal structures of EcCM and BsCM are available in the Research Collaboratory for Structural Bioinformatics Protein Databank under PDB numbers 1ECM and 2CHT, respectively.

primordial AroQ gene of the EcCM type, is made up of 12 a-helices. Each polypeptide forms a catalytic domain, which superimposes closely on the corres- ponding EcCM structure, and an additional, divergent regulatory domain for the binding of the allosteric effectors tyrosine or tryptophan at the interface of the dimer [9,10]. It is noteworthy that the active sites of AroQ and AroH CMs are similarly functionalized, indicating convergent evolution [3,11].

cytoplasm but features a more oxidizing milieu [14]. As the classical metabolic routes to tyrosine and phe- nylalanine are entirely cytoplasmic in bacteria, export of a CM does not seem to make sense. Furthermore, secreted functional *AroQ homologs have been discov- ered in nematodes, which do not even possess a shiki- mate pathway [15–17]. Although the role of exported CMs is still obscure, it is striking that the presence of an *AroQ protein in an organism correlates with its pathogenicity [4,12,13,15–19]. With the availability of

Among the AroQ CMs is a subgroup, dubbed *AroQ by Jensen and coworkers [12], whose members apparently are exported from the cytoplasm [4,12,13]. So far, *AroQ proteins have been isolated from Gram- negative bacteria, such as Erwinia herbicola, Salmonella typhimurium and Pseudomonas aeruginosa [12,13], where they are targeted to another subcellular com- partment, the periplasmic space, which surrounds the

the genomic sequence, Mycobacterium tuberculosis has become a model organism for pathogenic bacteria [20,21], and great efforts are currently being made to characterize its proteome in detail [22–24]. In this work, we report the cloning of an M. tuberculosis gene the product of which is homologous to *AroQ CMs. Expression in

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

376

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

Genetic complementation

described

E. coli demonstrates that the protein is indeed a CM, which is exported from the cytoplasm. As M. tuber- culosis is Gram-positive and thus lacks a periplasmic space, this CM is the first example of an *AroQ pro- tein that may be secreted directly into the surrounding medium and away from the bacterial cell. Further- more, this study represents the most rigorous struc- tural and functional characterization to date of a member of a topological subclass of AroQ CMs, which may be involved in the etiology of diseases such as tuberculosis [25] which claim many millions of lives every year.

Results

Cloning of an aroQ homolog from the M. tuberculosis genome

To probe whether the product of the ORF Rv1885c has CM activity in vivo, the CM-deficient E. coli KA12 ⁄ pKIMP-UAUC was provided with the *aroQ plasmids above. KA12 ⁄ pKIMP-UAUC grows on M9c ⁄ S+F minimal medium agar plates only if Tyr is added exogenously, or if the strain receives a functional and expressed CM gene [11]. Table 1 shows that transformants that produce *MtCM bearing a sig- nal sequence do not grow in the absence of Tyr. This suggests that post-translational export of (unfolded) full-length *MtCM is very efficient [29] or that unproc- essed protein present in the cytoplasm is not very act- ive. In contrast, leaderless *MtCM complemented the CM deficiency very well, provided that the sal promo- ter was switched on by salicylate. Cells producing the leaderless but untagged protein (encoded on pKTU3- HT) grew as well as those transformed with pKTU3- HCT (data not shown).

Localization of *MtCM in subcellular compart- ments and determination of the signal sequence- processing site

To obtain further experimental evidence for the func- tionality of the predicted N-terminal signal sequence, the distribution of CM activity in subcellular compart- ments of E. coli was determined for transformants car- rying pKTU1-HCW, pKTU2-HNW or pKTU3-HCT. As judged from the recovered enzymatic activities, the leaderless protein resided largely in the cytoplasm, whereas the plasmids carrying the full-length *aroQ space gene directed *MtCM to the periplasmic (Table 2).

Homology searches for aroQ genes in GenBank [26] revealed that M. tuberculosis possesses a gene (ORF Rv1885c in strain H37Rv, accession number CAB10064 in DDBJ ⁄ EMBL ⁄ GenBank [20]), encoding a putative protein with high similarity to the exported *AroQ CMs. Analysis of the primary sequence of the encoded protein (termed *MtCM) using the neural network pro- gram SignalP (http://www.cbs.dtu.dk/services/SignalP/ [27,28]), predicted a cleavable 33-amino-acid export sig- nal peptide at the N-terminus. We have cloned the gene (subsequently referred to as *aroQ) from the chromoso- mal DNA of M. tuberculosis and inserted it into several different plasmid constructs for in vivo and in vitro studies. Plasmids pKTU1-HCW and pKTU2-HNW carry the entire *aroQ gene, including the sequence for the presumed leader peptide, and in addition specify either a C-terminal or an N-terminal His tag, respect- ively. Plasmids pKTU3-HCT and pKTU3-HT encode a leaderless version of *MtCM corresponding to the mature form with and without a C-terminal His tag.

To experimentally determine the signal sequence cleavage site of *MtCM in E. coli, the protein variant produced with its native N-terminal signal sequence in

Table 1. In vivo complementation of CM deficiency. The selection strain for CM activity, E. coli KA12 ⁄ pKIMP-UAUC [11], was transformed with the plasmids listed, which carry the genes for *MtCM variants or a B. subtilis CM (BsCM; positive control) or no CM (negative control). Growth on minimal medium (M9c+F) in the absence or presence of Tyr (Y) or 0.1 mM salicylate ( ⁄ S) was evaluated after 3 days at 30 (cid:1)C. Colony sizes were scored on an arbitrary, comparative scale ranging from good (+), moderate (+ ⁄ –), weak (–) to no (0) growth.

Growth on minimal medium agar plates

Plasmid

Encoded protein

Signal peptide

His tag location

M9c+F

M9c+FY

M9c ⁄ S+F

M9c ⁄ S+FY

pKTU1-HCW pKTU2-HNW pKTU3-HCT pMG212H-W pMG212H-0

*MtCM *MtCM *MtCM BsCM None

Yes Yes No No No

C N C N None

0 0 0 +b 0

0 0 + + 0

+ + + + +

+ –a + + +

a High gene expression level appears to be toxic. b Uninduced basal sal promoter activity sufficient for complementation with BsCM.

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

377

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

Table 2. Localization of CM activity in subcellular compartments. Variants of *MtCM with and without export leader sequence were pro- duced by CM-deficient E. coli KA13 ⁄ pLysS also carrying one of the plasmids listed. No CM activity was detectable in the absence of an *aroQ gene. CM activities in the isolated fractions of the indicated compartments were determined at 50 lM chorismate and normalized to 1 mL bacterial culture.

CM activity [lM converted chorismateÆs)1Æ(mL culture))1]

Cytoplasm

Periplasm

Medium

Plasmid

Signal peptide

His tag location

pKTU1-HCW pKTU2-HNW pKTU3-HCT

Yes Yes No

C N C

140 (28%)a 270 (18%)a 54 (95%)

330 (66%) 1100 (75%) 2.6 (5%)

28 (6%) 100 (7%) 0.45 (1%)

a Residual CM activity may be an artifact from incomplete fractionation of compartments or from partial re-activation during sample prepar- ation of insoluble *MtCM originally present in inclusion bodies.

(predicted,

E. coli KA13 ⁄ pKTU1-HCW was isolated. The pro- tein preparation obtained under denaturing conditions contained the processed and uncleaved forms of *MtCM in a ratio of 10 : 1 as estimated by SDS ⁄ PAGE (not shown). The deconvoluted ESI mass spectrum showed a peak maximum at a Mr of 19 536.2. This correlates well with the calculated value for the *MtCM variant lacking the N-terminal 33 resi- dues (predicted, 19 537.4). In parallel, the leaderless *MtCM variant with the additional start methionine as specified by pKTU3-HCT was produced, purified, and subjected to ESI MS. Also in this case, the experi- mental Mr correlated well with the theoretical value derived from the 19 668.6; sequence observed 19 666).

Fig. 2. Purification of untagged, leaderless *MtCM monitored by SDS ⁄ PAGE. Lanes: 1, total cellular protein before IPTG induction of *aroQ expression; 2, after induction; 3, crude lysate (after lysozyme treatment, sonication and removal of insoluble debris); 4, fraction of crude lysate remaining soluble after 5 min at 95 (cid:1)C; 5, insoluble fraction after heating; M, LMW marker; 6–8, final purified *MtCM, loaded at different concentrations.

Overproduction and purification of *MtCM variants

step under binding conditions (pH 8.0), *MtCM was eluted as a sharp peak, affording a highly pure sample (Fig. 2). The final yield of untagged, leaderless *MtCM was 3 mg per liter of bacterial culture (His-tagged *MtCM was obtained at 10 mgÆL)1).

The apparent Mr values observed for all examined *MtCM species on denaturing polyacrylamide gels run under reducing conditions were generally significantly higher than expected from the sequence. For instance, the 167-residue untagged leaderless *MtCM has a cal- culated Mr of 18 603.5 (including the engineered initi- ator Met), in good agreement with the value of 18 602.2 from ESI MS. In contrast, it migrated as a Mr 23 000 band on SDS ⁄ PAGE (Fig. 2).

Structural characteristics

The primary sequence of the translated *aroQ gene was analyzed with the program predictprotein [31], which predicted the secondary structure of the leader-

The leaderless forms of *MtCM with and without a C-terminal His tag were overproduced in a CM-defici- ent E. coli host strain. A specific purification protocol was developed to optimize yield and purity of un- tagged *MtCM by implementing three key features. (a) The highest yields were obtained using strain KA29 (rather than KA13) as the production strain. KA29, which is deficient in thioredoxin reductase, has a more oxidative cytoplasm than wild-type E. coli strains and is therefore recommended for the cytoplasmic produc- tion of proteins with disulfide bonds [30], a probable feature of *MtCM (see Discussion). (b) Heating to 95 (cid:1)C for 5 min removed the majority of E. coli host proteins (Fig. 2). This step was added because initial thermal denaturation studies showed that most of the *MtCM protein denatured reversibly. (c) Subsequent anion-exchange chromatography under nonbinding conditions (pH 4.5; the calculated isoelectric point of *MtCM is 4.9) eliminated most of the nucleic acid im- purities. In a second anion-exchange chromatography

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

378

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

(A) Secondary-structure Fig. 3. Secondary structure of *MtCM. assignment of the *MtCM sequence [20], using the program Pre- dictProtein [31]. The six a-helices (H1 through H6) predicted for the leaderless *MtCM are indicated (L, loop; E, extended; H, helical structure). Lower case letters denote the signal sequence predicted with the program SIGNALP [27,28]. (B) CD spectrum. The concentra- tion of the leaderless, untagged protein was 0.73 lM in 20 mM potassium phosphate buffer, pH 7.5. hm,r is the mean molar ellipti- city per residue.

Fig. 4. Quaternary structure of leaderless, untagged *MtCM. (A) Analytical size-exclusion chromatography. The elution parameter Kav of each protein is plotted against the logarithm of the relative molecular mass (Mr) of the standard proteins (s), or of the Mr cal- culated from the sequence for a dimeric *MtCM (d). Inset: appar- ent oligomeric state of *MtCM as a function of the concentration of the injected sample. (B) Analytical ultracentrifugation. Shown is the concentration gradient, the computed fit to a dimer model, and the residuals to the fit for the representative sedimentation equilib- rium experiment with 11 lM *MtCM at 19 000 r.p.m. and 20 (cid:1)C.

less *MtCM to consist of six a-helices, connected by loop segments (Fig. 3A). Such a predominantly a-heli- cal structure was confirmed by CD spectroscopy (Fig. 3B) with the observed troughs at 208.0 and 220.5 nm typical of a-helical proteins [32]. The a-heli- cal content predicted from the primary sequence (67%; Fig. 3B) matches well with the 69% estimated from the CD spectrum [33].

independent of the concentration of the injected pro- tein sample (Fig. 4A, inset).

Analytical

ultracentrifugation

of

The quaternary structure of *MtCM was investi- gated by gel filtration applying protein samples in a concentration range of 1–61 lm (Fig. 4A). The average apparent Mr from five runs was 43 400 ± 3500. Divi- sion by the theoretical subunit Mr yields a ratio of for *MtCM was 2.3 ± 0.2. The

elution volume

*MtCM was carried out as a complementary experiment to gel fil- tration. Samples with three different *MtCM concen-

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

379

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

Table 3. Analytical ultracentrifugation of *MtCM. Sedimentation equilibrium experiments were carried out at three different protein concentrations at three different velocities each. Listed are the Mr values calculated from the nine data sets.

Calculated Mr at different *MtCM concentrations

Rotor velocity (r.p.m.)

1.0 lM

3.0 lM

11 lM

Table 4. Kinetic parameters of *AroQ proteins in comparison with other CMs. Abbreviations: *MtCM-C, leaderless *MtCM with C-ter- minal His tag; *StCM, *PaCM and *EhCM are the *AroQ homologs in S. typhimurium, P. aeruginosa and E. herbicola, respectively. EcCM and BsCM are cytoplasmic CMs described in the text. Assays were performed in 50 mM potassium phosphate buffer, pH 7.5, at 30 (cid:1)C, unless stated otherwise. kcat was calculated per active site. The inhibition constant Ki is listed for transition state analog 1. ND, Not determined.

Enzyme

kcat (s)1)

Km (lM)

kcat ⁄ Km )1Æs)1) (M

Ki (lM)

13 000 16 000 19 000

33 400 34 500 33 000

32 900 35 400 39 500

36 900 36 300 36 900

*MtCMa *MtCM-Ca *StCMb *PaCMb *EhCMb EcCMc BsCMc

50 ± 2 56 ± 1 8.9 6.4 9.7 64 ± 3 41 ± 2

180 ± 10 150 ± 10 142 98 169 390 ± 51 74 ± 8

3.7 ND ND ND ND 2.3 1.0

2.7 · 105 3.7 · 105 6.3 · 104 6.5 · 104 5.7 · 104 1.6 · 105 5.5 · 105

a The standard deviation indicated was calculated from duplicate measurements. b Measured at 32 (cid:1)C; data from [12]. c From [36].

trations were run at three different velocities each. A representative sedimentation equilibrium experiment is shown in Fig. 4B. The data fitted in good agreement to a dimer model. The apparent Mr values calculated from the nine data sets are summarized in Table 3. The mean value is 35 400 ± 2200, which corresponds to 1.9 ± 0.1 times the calculated Mr of the polypep- tide chain.

Kinetic studies

Thermal stability

Thermal denaturation and renaturation of *MtCM was followed between 20 and 70 (cid:1)C by measuring the ellipticity at 222 nm. The denaturation curve shows a sharp transition from the native to the denatured state (Fig. 5), with a calculated melting temperature (Tm) of 48 (cid:1)C. Upon subsequent cooling, the protein renatured easily (Fig. 5).

The CM activity of the leaderless, untagged form of *MtCM was also measured in vitro. The enzyme fol- lows Michaelis–Menten kinetics with the catalytic parameters kcat ¼ 50 s)1 and Km ¼ 180 lm (at 30 (cid:1)C and pH 7.5). As shown in Table 4, the corresponding values for the C-terminally His-tagged enzyme deviated only slightly. The kcat parameter increases slightly with increasing pH (between pH 5 and pH 8), whereas Km increases more dramatically by a factor of over 20-fold over the same range (Fig. 6A). As a consequence, the catalytic efficiency, kcat ⁄ Km, drops by two orders of magnitude between pH 5 and pH 9.

Inclusion of 1 mm tryptophan, phenylalanine or tyro- sine, or 0.5 mm salicylate in the kinetic assays did not alter CM activity by more than 10% (data not shown). Established CM transition state analog inhibitors, which include the oxabicyclic carboxylic acids 1 [34] and 2 [35,36], and adamantane-1-phosphonate 3 [37,38] (Fig. 6B), were tested for their impact on *MtCM activ- inhibit ity. Whereas compounds 2 and 3 did not *MtCM up to concentrations of 100 lm and 1 mm, respectively (data not shown), compound 1 showed competitive inhibition with a Ki of 3.7 lm (Fig. 6C).

Discussion

Fig. 5. Thermal denaturation of *MtCM. The concentration of the leaderless, untagged protein was 0.73 lM in 20 mM degassed potassium phosphate buffer, pH 7.5. The CD signal was followed at 222 nm for the same sample during heating (s) and subse- quently during cooling (h). hm,r,222 is the mean molar ellipticity per residue at 222 nm.

Our data establish that the ORF Rv1885c from the genome of M. tuberculosis encodes an exported CM. The enzyme was overproduced in E. coli and subjected to detailed structural and functional studies. Sequence

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

380

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

Fig. 7. Conservation and sequence location of presumed active-site residues in *MtCM. (A) Alignment of the sequences of *MtCM (mature form) and EcCM. Residues lining the active site in EcCM and the (presumably) homologous residues in *MtCM are shown in bold. Underlined residues indicate the a-helical regions: for EcCM, this assignment is based on the structurally resolved residues 5–95 in the crystal [8] while for *MtCM, the predicted locations are used (Fig. 3). (B) Scheme of the active site of EcCM, complexed with transition state analog 1 [8].

in 50 mM potassium phosphate buffer, pH 7.5.

Fig. 6. Kinetic investigation of leaderless, untagged *MtCM. (A) pH dependence of kcat (d), Km (j) and the catalytic efficiency kcat ⁄ Km (e). The high Km value at pH 8.7 only allowed the determination of kcat ⁄ Km because of the limitation of the maximum chorismate con- centration to 1.3 mM. (B) CM transition state analog inhibitors used in this work: 1 [34]; 2 [35]; 3, adamantane-1-phosphonate [38]. (C) Lineweaver–Burk plot [70] with inhibitor 1. Chorismate concentra- tions were varied in the CM assays at fixed inhibitor concentrations of 0 lM (d), 0.75 lM (j), 1.5 lM (r), 3.0 lM (s), 6.0 lM (h), and 12 lM (e) Inset: replot of the slopes of the Lineweaver–Burk plot.

analysis and CD spectroscopy showed that the mature (leaderless) *MtCM is an a-helical AroQ protein. The polypeptide is predicted to fold into six a-helices,

connected by loop segments (Fig. 3A). In contrast, each of the two identical subunits of EcCM adopts only three a-helices which combine to form an inter- [8]. The protein sequence twined dimer (Fig. 1B) encompassing the first three predicted helices of *MtCM aligns well with EcCM (Fig. 7A). However, the first 12 amino acids of EcCM, and thus part of the very long H1-helix which contains the active-site resi- due Arg11 (Fig. 7B), are missing from *MtCM H1. Interestingly, the sequence predicted to form the H4- helix of *MtCM (Fig. 3A) aligns reasonably well with the first part of EcCM H1 (Fig. 7A). This stretch in *MtCM includes a match (Arg134) to Arg11 of EcCM and a pattern of hydrophobic residues which are well conserved among AroQ proteins [4] and which provide helix–helix contacts in EcCM [8]. Indeed, combinato- rial mutagenesis and selection experiments have shown in *MtCM that Arg134 is

functionally essential

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

381

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

(unpublished work), as is its presumed counterpart Arg11 in EcCM [39]. These findings hint at *AroQ proteins being topologically rearranged alternatives of other typical members of the AroQ class.

and

size-exclusion

central hydrophobic,

What might be the role of helices H5 and H6? Although the melting temperature of *MtCM is only 48 (cid:1)C and significantly lower than the 63 (cid:1)C measured for its mesophilic AroQ homolog EcCM and much lower than the 88 (cid:1)C for the CM of the thermophile Methanococcus jannaschii [4], we found that *MtCM rapidly renatures after heat denaturation. Preliminary studies with reductants suggest that an intramolecular disulfide bond located in the last two helices (formed between Cys160 and Cys193) contributes to this effi- cient refolding (unpublished work), a feature that was exploited to eliminate most E. coli proteins during *MtCM purification. Thus, the two extra helices might have a stabilizing role. The results of analytical ultra- centrifugation chromatography experiments show that *MtCM is clearly a dimer. In these experiments, which were carried out over a range of protein concentrations, the ratios of observed Mr to calculated subunit Mr values were 1.9 (± 0.1) and 2.3 (± 0.2), respectively, and there was no indication of an equilibrium with other quaternary states. The slightly higher value obtained by gel filtration could be explained by an elongated shape of the a-helical dimer; similar observations were previously made for other AroQ proteins [4,40]. To our knowledge, all character- ized members of the AroQ family share a dimeric structure [4,8,9], including the isochorismate pyruvate lyase (PchB) from P. aeruginosa [40]. The permutated helix topology in *AroQ proteins will, however, require a different mode of subunit interaction from that observed in the prototype EcCM. Thus, helices H5 and H6, which are found exclusively in *AroQ subclass members, may also contribute to protein packing in the context of the alternative dimerization interface.

The biological

in a significantly higher

catalytic

steps

[20,46]

EcCM [39,41]. The allosteric CM from S. cerevisiae, the other AroQ protein for which the crystal structure is known, also has a glutamate at the homologous posi- tion, and this residue was shown to be responsible for the strong pH dependence of the CM activity [42]. It is noteworthy that *MtCM is inhibited by transition state analog 1 to the same extent as EcCM and BsCM (Table 4). In contrast, compound 2, which is known to be a 24-fold more selective inhibitor for BsCM than for EcCM [36], did not appreciably inhibit *MtCM. Taken together, these results are consistent with the active site of *MtCM being structurally and function- ally similar to that of a typical AroQ enzyme (Fig. 7B). In vivo assays in E. coli have clearly demonstrated that M. tuberculosis *aroQ can successfully complement the CM deficiency of a heterologous host. Comple- mentation was, however, only observed in constructs devoid of the leader sequence (Table 1). This can be rationalized by the fact that the normal site of action for a CM in E. coli is the cytoplasm, where the enzymes of the shikimate pathway are located. The data from the complementation assays, the cellular fractionation (Table 2), and ESI MS of the exported protein confirm that the predicted signal sequence of *MtCM is recog- nized and cleaved in E. coli. The leader sequence also possesses all of the typical features of signal peptides from M. tuberculosis [43]. The matching criteria include (a) its total length (33 residues), (b) the length of its N-terminal, and C-terminal regions (encompassing nine, 15, and nine residues, respectively), (c) the presence of alanines at the ante- penultimate and last positions (AXA motif), and (d) the fact that the mature protein starts with aspartate [43]. From the combined experimental and signal pep- tide prediction data available, we presume that *MtCM is exported by M. tuberculosis, too. As this bacterium is Gram-positive, any transfer of a nonmembrane protein from the cytoplasm must occur directly into the sur- rounding medium rather than into the periplasmic space, the target compartment of the *AroQ homologs from E. herbicola [13], S. typhimurium and P. aeruginosa [12]. significance of an exported CM remains mysterious, however. M. tuberculosis is able to grow in minimal medium lacking aromatic amino acids [44,45]. In its genome, all seven genes corres- ponding to the biosynthetic leading from d-erythrose 4-phosphate and phosphoenolpyruvate to chorismate have been identified. Most steps from chor- ismate to the aromatic amino acids were also assigned (see Fig. 1A), including genes for a cytoplasmic pre- cytoplasmic phenate dehydratase and a putative prephenate (http://genolist. dehydrogenase pasteur.fr/TubercuList). Although no gene encoding

Kinetic studies show that *MtCM is a very active CM. Its catalytic parameters are comparable to those of the well-established cytoplasmic enzymes EcCM and BsCM. Moreover, the kcat of *MtCM is fivefold to eightfold higher than kcat of three previously character- ized *AroQ homologs, which results (at similar Km val- ues) efficiency (Table 4). As shown in Fig. 7, residues that line the active site in EcCM are in general well conserved in *MtCM. The fact that the Km significantly increases between pH 5 and 9 is consistent with *MtCM having a glutamate (Glu109) at the position corresponding to Gln88 of EcCM (Fig. 7). An analogous pH dependence of Km has been reported for the Gln88Glu variant of

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

382

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

sequence similarity searches

growth of dormant M. tuberculosis cells [52], which might subsequently lead to open tuberculosis.

a cytoplasmic CM in M. tuberculosis has yet been assigned, [26,47] have revealed a candidate (Rv0948c) which is currently being examined. Moreover, the secreted *MtCM des- cribed in this work appears unsuitable to close the gap between chorismate made by the cytoplasmic shiki- mate pathway and the terminal (cytoplasmic) branches from prephenate towards Phe and Tyr. Interestingly, Jensen and coworkers found evidence for a mini bio- synthetic pathway from chorismate to phenylalanine in the periplasm of some bacterial species, which utilizes an *AroQ CM and periplasmic versions of prephenate dehydratase (or cyclohexadienyl dehydratase, *PheC) and aromatic amino-acid aminotransferase (*Aat) [12]. However, the absence of *PheC and *Aat homologs from M. tuberculosis argues against a contemporary role for *MtCM in such extracellular Phe biosynthesis, the biological significance of which is also still obscure [12].

the

a membrane

dehydrogenase,

In

There are also hints that *AroQ proteins themselves could be pathogenicity factors. For instance, even though animals are believed to lack the shikimate path- way and need to take up essential aromatic compounds from their diet [53], an *aroQ gene encoding a secreted CM was isolated from a cDNA library prepared from the esophageal gland region of the root-knot nematode Meloidogyne javanica [15]. This obligate plant parasite induces the production of giant feeder cells in the root of its host plant presumably by injecting esophageal gland secretions through its stylet. Furthermore, this CM, if produced recombinantly in soybean root cells, suppressed lateral root development and vascular tissue formation in the plant, phenotypes that are also observed during infection [54]. The *aroQ gene of Heterodera glycines, the soybean cyst nematode, was shown to be polymorphic, and this *aroQ polymorph- ism clearly correlated with the virulence of different nematode inbred lines [17]. As the nematode CMs are probably injected into the plant’s cytoplasm [15], a model was presented in which the parasitic enzyme alters the balance of metabolic fluxes within the plant cell to favor establishment of phytonematodic parasit- ism [54]. This hypothesis could also be valid for other phytopathogens found to possess *aroQ genes such as the bacteria E. herbicola [13], Pseudomonas syringae, Ralstonia solanacearum, Xantomonas campestris and Xylella fastidiosa, but not for pathogens of mammals, as their hosts do not possess the shikimate pathway.

for

It is possible that *MtCM may play some role in the pathogenesis of M. tuberculosis. In both M. tuber- culosis and M. bovis, *aroQ is the second gene in an operon consisting of seven ORFs. While no charac- terized homolog is known for fourth gene (Rv1883c), the putative intracellular or membrane- bound products of genes 5 (Rv1882c), 6 (Rv1881c) and 7 (Rv1880c) exhibit similarities to a short-chain alcohol lipoprotein (LppE) and a cytochrome P450 (Cyp140), respectively contrast (http://genolist.pasteur.fr/TubercuList). with these genes, for which information on function in Mycobacterium is still lacking, the genes immediately flanking *aroQ were experimentally investigated and are believed to be disease-related. The first gene in the operon (fbpB, Rv1886c) encodes a secreted mycolyl- transferase (FbpB), which is involved in the final assembly of the mycobacterial cell wall [48], an essen- tial barrier responsible for disease persistence and shielding of the organism from many antibiotics [49]. FbpB is also one of the predominant exported proteins and a constituent of the antigen 85 complex known for its strong fibronectin binding [50,51]. It may play a key role in the invasion of human macrophages, which then leads to intracellular bacterial multiplication or to infection by M. tuberculosis the notorious dormant that affects one third of the world’s population [25]. For these reasons, FbpB is considered an essential tar- get for the development of antimycobacterial chemo- therapeutic agents [48,51]. Immediately downstream of *aroQ is rpfC, which encodes a resuscitation-promo- ting factor that was shown to shorten the lag phase in liquid cultures of closely related mycobacterial species [52]. RpfC has thus been implicated in promoting

Apart from Mycobacterium, *aroQ genes are present in several other bacterial pathogens of mammals inclu- ding Burkholderia fungorum, P. aeruginosa, Rhodococ- cus equi, Salmonella typhi, S. typhimurium and Yersinia pestis ([12], unpublished work). Evidence that *AroQ proteins might contribute to virulence in animals was provided by a study with S. typhimurium; the *aroQ promoter was one of four promoters that were found to be induced after infection of mice [18]. In R. equi, a pulmonary pathogen of foals and humans, the *aroQ gene was found to reside in the pathogenicity island on the virulence plasmid [19]. However, the mechanism by which secreted bacterial CMs such as *MtCM may support the pathogenicity process is not known. It will be interesting to examine hypotheses about its involve- ment in the synthesis of compounds that aid in colon- izing the host, instance, by interaction or interference with coinfecting pathogens, or by engage- ment with the host’s immune system. An understand- ing of the function of *AroQ proteins may ultimately lead to better concepts for fighting diseases such as tuberculosis.

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

383

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

Experimental procedures

Materials and general procedures

pMG211 is a derivative of pKSS [65]. It features the dual- promoter system described previously [64] with a sal and T7 promoter in tandem, the latter being lac repressor- controlled and thus IPTG inducible. The nahR gene on pMG211 codes for an activator of the sal promoter and renders it salicylate inducible. Cloning of a gene into pMG211 using the XhoI site yields a protein with a tag, connected by a Leu-Glu linker. C-terminal His6 pMG211 also carries a T7 terminator and an ampicillin resistance gene. pMG211 (4690 bp) was constructed in two steps. First, the 2838 bp PshI–BsaI fragment of pMG208 [64] was ligated to the 952 bp NspI (NspI overhang blunt- ended by T4-DNA polymerase treatment)–BsaI fragment from pKSS [65], yielding pMG210. Secondly, the 2652 bp BstEII–XhoI fragment of pMG210 was ligated to the 2038 bp BstEII–XhoI fragment of pMG209 [64], resulting in pMG211.

Construction of *aroQ expression plasmids

Chromosomal DNA of M. tuberculosis strain H37Rv was obtained from R Brosch (Institut Pasteur, Paris, France). Oligonucleotides were custom-synthesized by Microsynth (Balgach, Switzerland). DNA sequencing was performed on an ABI PRIZM 310 or 3100-Avant Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) by the chain termination method [55], using the BigDye Terminator Cycle Sequencing Kit from the same company. Chorismate and transition state analogs 1 [34], 2 [35] and 3 [38] (Fig. 6B) were prepared by D Ku¨ nzler [56], R Pulido [57], A Mandal [36] and S Raillard [37], respectively, following published protocols. Cloning techniques and general media compositions were according to standard procedures [58]. For the calculation of Mr, molar absorption coefficients and isoelectric points from the primary sequence, the pro- gram package from Genetics Computer Group, Inc. (Madi- son, WI, USA) was used.

Strains and plasmid vectors

137-TUS

General cloning was carried out in E. coli strain XL1-Blue (Stratagene, La Jolla, CA, USA). The in vivo selection sys- tem KA12 ⁄ pKIMP-UAUC was described previously [11]. E. coli strain KA13 [4,59] was used for *MtCM localization experiments, and strain KA29 for protein overproduction. KA29 carries on its chromosome an isopropyl thio-b-d-gal- actoside (IPTG)-inducible gene coding for T7 RNA polym- erase [60] to allow high-level gene expression controlled by a T7 promoter. It was constructed by site-specific integra- tion of prophage kDE3 into the chromosome of E. coli strain KA25 using the kDE3 Lysogenization Kit from Nov- agen (Madison, WI, USA). KA25 was derived from E. coli strain KA19 by generalized P1 transduction to delete the recA gene employing a JC10289 ⁄ pKY102 lysate [61,62]. The construction of the precursor KA19 will be detailed elsewhere; briefly, it is derived from the thioredoxin reduc- tase-deficient E. coli strain AD494 [30,63] by chromosomal replacement of both endogenous E. coli CM genes tyrA and pheA by a fragment carrying the cat gene of pKIMP- UAUC [11] as well as its tyrA* and pheC genes, which were placed under tac promoter control. The genotype of KA29 is consequently P1–, D(srlR-recA)306::Tn10 (TetR), D(pheA– tyrA)::[tyrA*-pheC-cat (CamR)], trxB::kan (KanR), D(ara- leu)7697, araD139, DlacX74, galE, galK, rpsL (StrR), phoR, lacIq], k (DE3) thi, F¢[lac-pro, D(phoA)PvuII, DmalF3, [(lacUV5-expressed) T7-RNA-pol gene, imm21, Dnin5, Sam7(int-)].

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

384

The M. tuberculosis gene *aroQ was cloned using chromo- somal DNA as the template for PCR. Several different PCR experiments were carried out to obtain plasmids pos- sessing either the entire *aroQ gene with the native signal sequence (affix –W) or a truncated gene without this sequence but having instead an added initiator Met codon (affix –T). The encoded protein either carried a C-terminal His6 tag linked by Leu-Glu (second affix –C) or an N-ter- minal His6 tag fused to the presumed leader peptide by a Ser-Ser-Gly linker (affix –N), or no tag (no additional affix). Affix –H denotes a high-copy-number plasmid. The plasmids were assembled as follows: the 600 bp NdeI– XhoI PCR fragment with oligonucleotides 133-TUS (ACC GATGTCATATGCTTACCCGTCCACGTGAGATATA; restriction site used for cloning underlined) and 134-TUN (CGATAATCTCGAGGGCCGGCGGTAGGGCCTGGC AAT) was ligated to the 4561 bp NdeI–XhoI fragment of pMG211, yielding pKTU1-HCW (5161 bp). The 635 bp NdeI–SpeI PCR fragment with oligonucleotides 135-TUS (ACCGATGTCATATGCACCATCATCATCATCATTCTT CTGGTATGCTTACCCGTCCACGTGAGATATAC) and 136-TUN (CGATACACTAGTTATTAGGCCGGCGGTA GGGCCTGGCAAT) was ligated to the 4529 bp NdeI–SpeI fragment of pMG211, yielding pKTU2-HNW (5164 bp). The 504 bp NdeI–XhoI PCR fragment with oligonucleotides (ACCGATGTCATATGGAC 134-TUN and GGCACCAGCCAGTTAGCCGAGTT) was ligated to the 4561 bp NdeI–XhoI fragment of pMG211, yielding pKTU3- HCT (5065 bp). The 509 bp NdeI–SpeI fragment of the PCR with oligonucleotides 136-TUN and 137-TUS was ligated to the 4529 bp NdeI–SpeI fragment of pMG211, yielding pKTU3-HT (5038 bp). All plasmid segments derived from PCR were checked by DNA sequencing using oligonucleotides T7PRO2 (TAATACGACTCACTATA GGG) and 131-TERM (CCCTCAAGACCCGTTTAGA). Plasmids pMG212H-W and pMG212H-0, which were used as positive and negative controls, respectively, have been described previously [64]. Plasmid pLysS was pur- chased from Novagen. The high-copy number plasmid

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

Complementation of a CM-deficient strain

In vivo complementation assays were carried out using the previously described selection system E. coli KA12 ⁄ pKIMP- UAUC for CM activity [11]. Minimal medium M9c ⁄ S devi- ates from the previously described M9c [66] by additionally containing 0.1 mm salicylate. Selection plates M9c ⁄ S+F contained 20 lgÆmL)1 l-phenylalanine; positive control plates M9c ⁄ S+FY in addition contained 20 lgÆmL)1 l-tyro- sine. Provision of 133 lm IPTG fully induced *aroQ genes as well as the auxiliary functions on pKIMP-UAUC.

Overproduction and purification of leaderless *MtCM

taining *MtCM, which was eluted as a sharp peak at 170 mm NaCl, was dialyzed against 20 mm Tris ⁄ HCl (pH 8.0) and stored at either 4 (cid:1)C or ) 20 (cid:1)C (no loss of activity was observable after a single freeze–thaw cycle). Protein concentration was generally determined by the Micro BCA Protein Assay (Pierce, Rockford, IL, USA) with BSA as the reference. For the pH variation kinetics, *MtCM concentration was derived from UV absorption at 280 nm using a calculated molar absorption coefficient, which results in about 10% higher values than from the Micro BCA Protein Assay. Integrity and purity of the samples were confirmed by SDS ⁄ PAGE under reducing conditions using the Phast System and the LMW marker from Amersham Biosciences, and for the untagged protein additionally with ESI MS.

Fractionation of subcellular compartments

Five milliliters of Luria–Bertani medium containing 150 lgÆmL)1 sodium ampicillin were inoculated with a single colony of E. coli strain KA29 carrying pKTU3-HCT or pKTU3-HT and incubated overnight at 37 (cid:1)C. Then 500 mL Luria–Bertani medium provided with 150 lgÆmL)1 sodium ampicillin were inoculated with the fresh overnight culture and shaken at 170 r.p.m. at 37 (cid:1)C; best yields were obtained when the medium contained 2.0% (w ⁄ v) glucose. Between an attenuance at 600 nm of 0.3 and 0.5, IPTG was added to 0.5 mm, and incubation was continued overnight. The cells were chilled in an ice-water bath for 15 min, harvested by centrifugation (20 min, 4000 g, 4 (cid:1)C) and resuspended in 3 vol. sonication buffer (50 mm sodium phosphate buffer, pH 8.0, containing 300 mm NaCl). After the addition of lysozyme to 1 mgÆmL)1 and incubation on ice for 30 min, cells were ruptured by sonication. Removal of the insoluble debris by centrifugation (20 min, 10 500 g, 4 (cid:1)C) yielded the crude lysate.

to a nickel ⁄ nitrilotriacetate ⁄ agarose

Cultures of E. coli KA13 ⁄ pLysS additionally transformed with one of the plasmids pKTU1-HCW, pKTU2-HNW or pKTU3-HCT were grown in 5 mL LB + Amp medium (Luria–Bertani medium plus ampicillin) each and induced as described above. The periplasmic fraction was obtained by a modified published procedure [68]. For each mutant, 1.5 mL bacterial culture was spun down (3 min, 9000 g), and the pellet was resuspended in 150 lL sucrose buffer (200 gÆL)1 sucrose, 30 mm Tris ⁄ HCl, pH 8.0). Spheroplasts were obtained by the addition of lysozyme to 0.1 mgÆmL)1, incubation at room temperature for 2 min, addition of EDTA to 1 mm, incubation for 10 min, addition of 10 mm MgSO4 and incubation for 20 min The spheroplasts were pelleted by centrifugation at 12 000 g at 4 (cid:1)C for 20 min, and the supernatant (¼ periplasmic fraction) was removed. The pellet was resuspended in 283 lL sonication buffer (described above), and, after the addition of lysozyme to 1 mgÆmL)1, incubated on ice for 20 min. Then, 11 lL 20% Triton X-100 were added, and after 10 min on ice, the spheroplasts were broken by sonication. The supernatant after 5 min centrifugation at 10 000 g at 4 (cid:1)C represents the soluble cytoplasmic fraction. Protein tagged with a His6 tail (encoded on pKTU3- HCT) was purified by metal affinity chromatography [67]. The crude lysate was adjusted to 20 mm imidazole and applied column (Qiagen, Basel, Switzerland). The main fraction was eluted with 200 mm imidazole and subsequently dialyzed against 20 mm potassium phosphate (pH 7.5). Untagged,

Determination of the processing site of *MtCM

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

385

To experimentally determine the processing site of the sig- nal sequence of *MtCM in E. coli, the protein variants pro- duced by E. coli transformants KA13 ⁄ pKTU1-HCW and KA13 ⁄ pKTU3-HCT were purified under denaturing condi- tions from crude lysates. The sonication buffer additionally contained 8 m urea, and purification involved nickel ⁄ nitrilo- triacetate affinity chromatography as described above. *MtCM from KA13 ⁄ pKTU1-HCW was concentrated by ultrafiltration using Macrosep and Microsep centrifugal devices (Pall AG, Basel, Switzerland). Protein sizes were obtained from ESI MS experiments. leaderless *MtCM protein (encoded on pKTU3-HT) was purified by a heat shock procedure. Crude lysate was incubated at 95 (cid:1)C for 5 min and subse- quently kept at room temperature for 30 min. Denatured, precipitated proteins were removed by centrifugation (60 min, 10 500 g, 4 (cid:1)C). The supernatant was dialyzed twice at 4 (cid:1)C for at least 4 h against 20 mm N-methylpip- erazine (pH 4.5) and applied to a Mono Q 16 ⁄ 10 FPLC anion-exchange column (Amersham Biosciences, Freiburg, Germany). *MtCM was eluted with the latter buffer and subsequently dialyzed against 20 mm Tris ⁄ HCl, pH 8.0 (buffer A). The protein solution was loaded on to a second Mono Q column, which was developed with a lin- ear gradient from 0 mm to 350 mm NaCl in buffer A over 150 mL at a flow rate of 3 mLÆmin)1. The fraction con-

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

Mass spectrometry

nine data sets. Absorbance was measured at 220, 233 and 280 nm, respectively, for the three different concentrations. The calculated molar absorption coefficient of *MtCM at 280 nm, e280 ¼ 27 940 m)1Æcm)1, was used with an experi- mental absorption spectrum to determine the remaining two molar absorption coefficients e233 ¼ 94 940 m)1Æcm)1 and e220 ¼ 245 200 m)1Æcm)1. Data were collected at a radial spa- cing of 0.001 cm. Ten scans were averaged for each set up. Established methods [69] afforded a dimer model as best fit. A 500 lL portion of an (cid:1) 10 lm protein solution was desalted on a NAP-5 size-exclusion column (Amersham Biosciences), which was equilibrated and eluted with 0.1% acetic acid. ESI MS was performed on a Finnigan MAT TSQ 7000 spectrometer (Thermo Electron, Waltham, MA, USA). Standard errors of the masses obtained after decon- volution are typically £ 0.1%.

CD spectroscopy and thermal denaturation

Kinetic assays

The disappearance of the substrate chorismate was followed at 274 nm (e274 ¼ 2630 m)1Æcm)1) or 310 nm (e310 ¼ 370 m)1Æcm)1). Standard assays were performed at 30 (cid:1)C in 50 mm potassium phosphate buffer, pH 7.5. The pH depend- ence of the reaction was assessed in Universal Buffer [4] at pH 5.1, pH 5.9, pH 6.8, pH 7.6 and pH 8.7. The data were fitted to the Michaelis–Menten equation [70] with the pro- gram kaleidagraph (Synergy Software, Reading, PA, USA). [33].

Acknowledgements

Far-UV CD spectra were recorded at 25 (cid:1)C on an Aviv 202 CD spectrometer (Aviv Biomedical, Lakewood, NJ, USA). A cuvette with a path length of 1.0 cm was used. Spec- tra were obtained by averaging five scans from 260 to 200 nm in 0.5 nm steps, with a bandwidth of 1 nm and a sig- nal averaging time of 3 s. To quantify the secondary-struc- ture content from the spectra, a neural network was used (http://www.embl.de/(cid:2)andrade/k2d.html) Thermal denaturation ⁄ renaturation was followed between 20 and 70 (cid:1)C in 1 (cid:1)C steps by measuring the ellipticity at 222 nm. At each temperature, the sample was allowed to equilibrate with constant stirring for 90 s and was subsequently measured for 30 s. Data were fitted to a two-state model for a dimer [4].

Analytical size-exclusion chromatography

We thank Roland Brosch for generously providing M. tuberculosis DNA, Richard Thomas for carrying out analytical ultracentrifugation experiments, and Dominik Ku¨ nzler, Rosalino Pulido, Ajay Mandal and Stephan Raillard for provision of substrates and inhib- itors. This work was supported by Novartis Pharma, the ETH Zu¨ rich and the Schweizerischer National- fonds grant 3152A0-102211.

References

1 Haslam E (1993) Shikimic Acid: Metabolism and Metabolites. Wiley, New York, NY. 2 Kast P, Tewari YB, Wiest O, Hilvert D, Houk KN &

Goldberg RN (1997) Thermodynamics of the conversion of chorismate to prephenate: experimental results and theoretical predictions. J Phys Chem B 101, 10976– 10982. 3 Lee AY, Stewart JD, Clardy J & Ganem B (1995) New The oligomeric state of *MtCM was investigated by analyt- ical size-exclusion chromatography using a Superose 12 (10 ⁄ 30) FPLC column (Amersham Biosciences). Chroma- tography was performed at 4 (cid:1)C with phosphate-buffered saline (10 mm sodium phosphate, 160 mm NaCl, pH 7.5) as the running buffer. Protein elution was detected by measur- ing A280. A calibration curve was generated with the follow- ing proteins: aprotinin (Mr 6500), cytochrome c (Mr 12 400), RNase A (Mr 13 700), trypsinogen (Mr 24 000), carbonic anhydrase (Mr 30 000), ovalbumin (Mr 43 000) and BSA (Mr 67 000). The void volume, V0, and the total bed volume, Vt, were determined using blue dextran (Mr 2 · 106) and dithiothreitol, respectively. The elution param- eter, Kav, was calculated for each protein from its elution volume (Ve) using the equation

Kav ¼ (Ve – V0) ⁄ (Vt – V0).

Analytical ultracentrifugation

insight into the catalytic mechanism of chorismate mutases from structural studies. Chem Biol 2, 195–203. 4 MacBeath G, Kast P & Hilvert D (1998) A small, ther- mostable, and monofunctional chorismate mutase from the archaeon Methanococcus jannaschii. Biochemistry 37, 10062–10073.

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

386

5 Chook YM, Ke H & Lipscomb WN (1993) Crystal structures of the monofunctional chorismate mutase from Bacillus subtilis and its complex with a transition state analog. Proc Natl Acad Sci USA 90, 8600–8603. 6 Chook YM, Gray JV, Ke H & Lipscomb WN (1994) The monofunctional chorismate mutase from Bacillus Conventional sedimentation equilibrium experiments were performed at 20 (cid:1)C on a Beckman XL-A analytical ultracen- trifuge (Beckman Coulter, Fullerton, CA, USA). *MtCM samples were run in 20 mm potassium phosphate buffer (pH 7.5) containing 80 mm NaCl at three different protein concentrations (1.0, 3.0, 11 lm) each at three different veloci- ties (13 000, 16 000, 19 000 r.p.m.; rotor An-60 Ti) yielding

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

green fluorescent protein and two-colour flow cyto- metry. Mol Microbiol 43, 1269–1283.

subtilis: structure determination of chorismate mutase and its complexes with a transition state analog and prephenate, and implications for the mechanism of the enzymatic reaction. J Mol Biol 240, 476–500. 7 Helmstaedt K, Heinrich G, Merkl R & Braus GH

19 Takai S, Hines SA, Sekizaki T, Nicholson VM, Alperin DA, Osaki M, Takamatsu D, Nakamura M, Suzuki K, Ogino N et al. (2000) DNA sequence and comparison of virulence plasmids from Rhodococcus equi ATCC 33701 and 103. Infect Immun 68, 6840–6847. (2004) Chorismate mutase of Thermus thermophilus is a monofunctional AroH class enzyme inhibited by tyro- sine. Arch Microbiol 181, 195–203.

8 Lee AY, Karplus PA, Ganem B & Clardy J (1995) Atomic structure of the buried catalytic pocket of Escherichia coli chorismate mutase. J Am Chem Soc 117, 3627–3628. 9 Xue Y, Lipscomb WN, Graf R, Schnappauf G & 20 Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, Gordon SV, Eiglmeier K, Gas S, Barry CE, III et al. (1998) Deciphering the biology of Mycobacteri- um tuberculosis from the complete genome sequence. Nature 393, 537–544 (erratum appeared in Nature 396, 190–198).

Braus G (1994) The crystal structure of allosteric choris- mate mutase at 2.2-A˚ resolution. Proc Natl Acad Sci USA 91, 10814–10818. 21 Smith CV & Sacchettini JC (2003) Mycobacterium tuber- culosis: a model system for structural genomics. Curr Opin Struct Biol 13, 658–664. 22 Terwilliger TC, Park MS, Waldo GS, Berendzen J, 10 Stra¨ ter N, Schnappauf G, Braus G & Lipscomb WN

(1997) Mechanisms of catalysis and allosteric regulation of yeast chorismate mutase from crystal structures. Structure 5, 1437–1452. 11 Kast P, Asif-Ullah M, Jiang N & Hilvert D (1996) Hung L-W, Kim C-Y, Smith CV, Sacchettini JC, Bellin- zoni M, Bossi R et al. (2003) The TB structural geno- mics consortium: a resource for Mycobacterium tuberculosis biology. Tuberculosis 83, 223–249. 23 Sassetti CM, Boyd DH & Rubin EJ (2003) Genes

required for mycobacterial growth defined by high den- sity mutagenesis. Mol Microbiol 48, 77–84. Exploring the active site of chorismate mutase by com- binatorial mutagenesis and selection: the importance of electrostatic catalysis. Proc Natl Acad Sci USA 93, 5043–5048.

24 Jungblut PR, Mu¨ ller E-C, Mattow J & Kaufmann SHE (2001) Proteomics reveals open reading frames in Myco- bacterium tuberculosis H37Rv not predicted by geno- mics. Infect Immun 69, 5905–5907.

12 Calhoun DH, Bonner CA, Gu W, Xie G & Jensen RA (2001) The emerging periplasm-localized subclass of AroQ chorismate mutases, exemplified by those from Salmonella typhimurium and Pseudomonas aeruginosa. Genome Biol 2, 30.01–30.16. 25 Stewart GR, Robertson BD & Young DB (2003) Tuber- culosis: a problem with persistence. Nat Rev Microbiol 1, 97–105.

13 Xia T, Song J, Zhao G, Aldrich H & Jensen RA (1993) The aroQ-encoded monofunctional chorismate mutase (CM-F) protein is a periplasmic enzyme in Erwinia herbicola. J Bacteriol 175, 4729–4737. 26 Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J & Wheeler DL (2004) GenBank: update. Nucleic Acids Res 32, D23–D26. 14 Oliver DB (1996) Periplasm. In Escherichia coli and

27 Nielsen H, Engelbrecht J, Brunak S & von Heijne G (1997) Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng 10, 1–6. Salmonella (Neidhardt FC, Curtiss R III, Ingraham JL, Lin ECC, Low KB, Magasanik B, Reznikoff WS, Riley M, Schaechter M & Umbarger HE, eds), pp. 88–103. ASM Press, Washington DC.

15 Lambert KN, Allen KD & Sussex IM (1999) Cloning and characterization of an esophageal-gland-specific chorismate mutase from the phytoparasitic nematode Meloidogyne javanica. Mol Plant Microbe Interact 12, 328–336. 28 Nielsen H & Krogh A (1998) Prediction of signal peptides and signal anchors by a hidden Markov model. In Proceedings of the Sixth International Confer- ence on Intelligent Systems for Molecular Biology (Glasgow J, ed.), pp. 122–130. AAAI Press, Menlo Park, CA. 16 Jones JT, Furlanetto C, Bakker E, Banks B, Blok V,

29 Danese PN & Silhavy TJ (1998) Targeting and assembly of periplasmic and outer-membrane proteins in Escheri- chia coli. Annu Rev Genet 32, 59–94. Chen Q, Phillips M & Prior A (2003) Characterization of a chorismate mutase from the potato cyst nematode Globodera pallida. Mol Plant Pathol 4, 43–50. 17 Bekal S, Niblack TL & Lambert KN (2003) A choris-

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

387

mate mutase from the soybean cyst nematode Heterodera glycines shows polymorphisms that correlate with virulence. Mol Plant Microbe Interact 16, 439–446. 30 Derman AI, Prinz WA, Belin D & Beckwith J (1993) Mutations that allow disulfide bond formation in the cytoplasm of Escherichia coli. Science 262, 1744–1747. 31 Rost B & Sander C (1993) Prediction of protein second- ary structure at better than 70% accuracy. J Mol Biol 232, 584–599. 32 Johnson WC Jr (1992) Analysis of circular dichroism 18 Bumann D (2002) Examination of Salmonella gene expression in an infected mammalian host using the spectra. Methods Enzymol 210, 426–447.

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25, 3389– 3402. 33 Andrade MA, Chaco´ n P, Merelo JJ & Mora´ n F (1993) Evaluation of secondary structure of proteins from UV circular dichroism spectra using an unsupervised learn- ing neural network. Protein Eng 6, 383–390.

34 Bartlett PA & Johnson CR (1985) An inhibitor of chor- ismate mutase resembling the transition-state conforma- tion. J Am Chem Soc 107, 7792–7793. 48 Belisle JT, Vissa VD, Sievert T, Takayama K, Brennan PJ & Besra GS (1997) Role of the major antigen of Mycobacterium tuberculosis in cell wall biogenesis. Science 276, 1420–1422. 49 Brennan PJ & Nikaido H (1995) The envelope of myco- bacteria. Annu Rev Biochem 64, 29–63. 35 Kangas E & Tidor B (2001) Electrostatic complementar- ity at ligand binding sites: application to chorismate mutase. J Phys Chem B 105, 880–888.

50 Peake P, Gooley A & Britton WJ (1993) Mechanism of interaction of the 85B secreted protein of Mycobacter- ium bovis with fibronectin. Infect Immun 61, 4828–4834. 51 Ronning DR, Klabunde T, Besra GS, Vissa VD, Belisle JT & Sacchettini JC (2000) Crystal structure of the secreted form of antigen 85C reveals potential targets for mycobacterial drugs and vaccines. Nat Struct Biol 7, 141–146. 52 Mukamolova GV, Turapov OA, Young DI, Kaprely-

36 Mandal A & Hilvert D (2003) Charge optimization increases the potency and selectivity of a chorismate mutase inhibitor. J Am Chem Soc 125, 5598–5599. 37 Stetter H & Last W-D (1969) U¨ ber Verbindungen mit Urotropin-Struktur, XLIV: U¨ ber Adamantan-phos- phonsa¨ ure-(1)-dichlorid. Chem Ber 102, 3364–3366. 38 Chao HS-I & Berchtold GA (1982) Inhibition of choris- mate mutase activity of chorismate mutase-prephenate dehydrogenase from Aerobacter aerogenes. Biochemistry 21, 2778–2781. 39 Liu DR, Cload ST, Pastor RM & Schultz PG (1996) ants AS, Kell DB & Young M (2002) A family of auto- crine growth factors in Mycobacterium tuberculosis. Mol Microbiol 46, 623–635. 53 Schmid J & Amrhein N (1995) Molecular organization

Analysis of active site residues in Escherichia coli choris- mate mutase by site-directed mutagenesis. J Am Chem Soc 118, 1789–1790. of the shikimate pathway in higher plants. Phytochemis- try 39, 737–749. 40 Gaille C, Kast P & Haas D (2002) Salicylate biosynth-

54 Doyle EA & Lambert KN (2003) Meloidogyne javanica chorismate mutase 1 alters plant cell development. Mol Plant Microbe Interact 16, 123–131. 55 Sanger F, Nicklen S & Coulson AR (1977) DNA esis in Pseudomonas aeruginosa: purification and charac- terization of PchB, a novel bifunctional enzyme displaying isochorismate pyruvate-lyase and chorismate mutase activities. J Biol Chem 277, 21768–21775. sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74, 5463–5467.

41 Zhang S, Kongsaeree P, Clardy J, Wilson DB & Ganem B (1996) Site-directed mutagenesis of monofunctional chorismate mutase engineered from the E. coli P-pro- tein. Bioorg Med Chem 4, 1015–1020. 56 Grisostomi C, Kast P, Pulido R, Huynh J & Hilvert D (1997) Efficient in vivo synthesis and rapid purification of chorismic acid using an engineered Escherichia coli strain. Bioorg Chem 25, 297–305.

57 Smith WW & Bartlett PA (1993) An improved synthesis of the transition state analog inhibitor of chorismate mutase. J Org Chem 58, 7308–7309. 42 Schnappauf G, Stra¨ ter N, Lipscomb WN & Braus GH (1997) A glutamate residue in the catalytic center of the yeast chorismate mutase restricts enzyme activity to acidic conditions. Proc Natl Acad Sci USA 94, 8491– 8496. 58 Sambrook J & Russell DW (2001) Molecular Cloning: A

Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

43 Wiker HG, Wilson MA & Schoolnik GK (2000) Extra- cytoplasmic proteins of Mycobacterium tuberculosis: mature secreted proteins often start with aspartic acid and proline. Microbiology 146, 1525–1533. 44 Sauton MB (1912) Sur la nutrition mine´ rale du 59 MacBeath G & Kast P (1998) UGA read-through arti- facts: when popular gene expression systems need a pATCH. Biotechniques 24, 789–794. 60 Studier FW & Moffatt BA (1986) Use of bacteriophage bacille tuberculeux. C R Hedb Seances Acad Sci 155, 860–861.

45 Agranoff D, Monahan IM, Mangan JA, Butcher PD & Krishna S (1999) Mycobacterium tuberculosis expresses a novel pH-dependent divalent cation transporter belonging to the Nramp family. J Exp Med 190, 717– 724. T7 RNA polymerase to direct selective high-level expression of cloned genes. J Mol Biol 189, 113–130. 61 Ihara M, Oda Y & Yamamoto K (1985) Convenient construction of strains useful for transducing recA mutations with bacteriophage P1. FEMS Microbiol Lett 30, 33–35. 46 Camus J-C, Pryor MJ, Me´ digue C & Cole ST (2002)

Re-annotation of the genome sequence of Mycobacter- ium tuberculosis H37Rv. Microbiology 148, 2967–2973.

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

388

47 Altschul SF, Madden TL, Scha¨ ffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped 62 Kast P & Hennecke H (1991) Amino acid substrate spe- cificity of Escherichia coli phenylalanyl-tRNA synthetase altered by distinct mutations. J Mol Biol 222, 99–124. 63 Prinz WA, A˚ slund F, Holmgren A & Beckwith J (1997) The role of the thioredoxin and glutaredoxin pathways

S. Sasso et al.

Secreted chorismate mutase from M. tuberculosis

in reducing protein disulfide bonds in the Escherichia coli cytoplasm. J Biol Chem 272, 15661–15667. polypeptides containing an oligo-histidine domain. Gene 111, 99–104.

68 Torriani A (1966) Alkaline phosphatase from Escheri- chia coli. In Procedures in Nucleic Acid Research (Can- toni CL & Davies R, eds), pp. 224–235. Harper & Row, New York, NY. 64 Gamper M, Hilvert D & Kast P (2000) Probing the role of the C-terminus of Bacillus subtilis chorismate mutase by a novel random protein-termination strategy. Bio- chemistry 39, 14087–14094.

65 Kast P (1994) pKSS: a second-generation general pur- pose cloning vector for efficient positive selection of recombinant clones. Gene 138, 109–114.

69 Laue TM, Shah B, Ridgeway TM & Pelletier SL (1992) Computer-aided interpretation of analytical sedimenta- tion data for proteins. In Analytical Ultracentrifugation in Biochemistry and Polymer Science (Harding SE, Rowe AJ & Horton JC, eds), Royal Society of Chemi- stry, Cambridge, UK. 66 Kast P, Grisostomi C, Chen IA, Li S, Krengel U, Xue Y & Hilvert D (2000) A strategically positioned cation is crucial for efficient catalysis by chorismate mutase. J Biol Chem 275, 36832–36838.

FEBS Journal 272 (2005) 375–389 ª 2004 FEBS

389

67 Van Dyke MW, Sirito M & Sawadogo M (1992) Single-step purification of bacterially expressed 70 Segel IH (1976) Biochemical Calculations: How to Solve Mathematical Problems in General Biochemistry, 2nd edn. Wiley, New York, NY.