Báo cáo khoa học: Gene expression in response to endoplasmic reticulum stress in Arabidopsis thaliana

Gene expression in response to endoplasmic reticulum stress in Arabidopsis thaliana Shinya Kamauchi, Hiromi Nakatani, Chiharu Nakano and Reiko Urade

Graduate School of Agriculture, Kyoto University, Uji, Japan

Keywords endoplasmic reticulum; fluid microarray; gene expression; tunicamycin; unfolded protein response

Correspondence R. Urade, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011, Japan Fax: +81 774 38 3758 Tel: +81 774 38 3757 E-mail: urade@kais.kyoto-u.ac.jp

Database The nucleotide sequence data for soybean SEL-1L are available in the DDBJ ⁄ EMBL ⁄ GenBank databases under accession number AB197676.

(Received 15 March 2005, revised 11 May 2005, accepted 16 May 2005)

Eukaryotic cells respond to the accumulation of unfolded proteins in the endoplasmic reticulum (ER). In this case, so-called unfolded protein response (UPR) genes are induced. We determined the transcriptional expression of Arabidopsis thaliana UPR genes by fluid microarray analysis of tunicamycin-treated plantlets. Two hundred and fifteen up-regulated genes and 17 down-regulated ones were identified. These genes were reana- lyzed with functional DNA microarrays, using DNA fragments cloned through fluid microarray analysis. Finally, 36 up-regulated and two down- regulated genes were recognized as UPR genes. Among them, the up-regu- lation of genes related to protein degradation (HRD1, SEL-1L ⁄ HRD3 and DER1), regulation of translation (P58IPK), and apoptosis (BAX inhibitor-1) was reconfirmed by real-time reverse transcriptase-PCR. The induction of SEL-1L protein in an Arabidopsis membrane fraction on tunicamycin-treat- ment was demonstrated. Phosphorylation of initiation factor-2a, which was inhibited by P58IPK, was decreased in tunicamycin-treated plantlets. How- ever, regulatory changes in translation caused by ER stress were not detec- ted in Arabidopsis. Plant cells appeared to have a strategy for overcoming ER stress through enhancement of protein folding activity, degradation of unfolded proteins, and regulation of apoptosis, but not regulation of trans- lation.

Ire 1p

protein

kinase ⁄ riboendonuclease

is

reticulum (ER)

related to folding,

synthesized on the rough A nascent polypeptide endoplasmic translocated and folded with the assistance of molecular chaperones and other folding factors such as glycosylation ⁄ modi- fication enzymes and disulfide oxidoreductases within the ER. However, the folding of nascent polypep- tides occasionally does not occur, resulting in the accumulation of unfolded or misfolded proteins in the ER (ER stress). To solve this problem, eukaryotic cells sense ER stress and induce a set of genes called unfolded protein response (UPR) genes. In the bud- ding yeast Saccharomyces cerevisiae, ER transmem-

brane is activated by ER stress [1,2], and nonconventionally splices mRNA of basic leucine zipper transcription factor Hac 1p [3–5]. Hac 1p is translated from the spliced mRNA and induces the UPR genes, having a UPR cis-acting regulatory element [6–8]. On DNA microarray analysis, 381 genes have been identified as UPR ones induced by both tunicamycin (TM) and dithiothreitol [9]. These comprise (cid:1) 6% of the total yeast genes encoding 173 unknown proteins and 208 proteins glycosyla- tion ⁄ modification, translocation, protein degradation,

doi:10.1111/j.1742-4658.2005.04770.x

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3461

Abbreviations AARE, amino acid response element; ATF6, activating transcription factor 6; AZC, L-azetidine-2-carboxylic acid; BI-1, Bax inhibitor-1; eIF2a, initiation factor-2a; Endo H, endoglycosidase H; ER, endoplasmic reticulum; ERAD, ER-associated protein degradation; ERSE, ER stress response element; MS, Murashige and Skoog medium; PDI, protein disulfide isomerase; PKR, double stranded RNA-activated protein kinase; P-UPRE, plant-specific UPR element; RAMP4, ribosomal-associated membrane protein 4; TM, tunicamycin; UPR, unfolded protein response; UPRE, UPR cis-acting regulatory element; XBP-1, X-box binding factor.

vesicle trafficking ⁄ transport, vacuolar protein sorting, cell wall biogenesis, and lipid ⁄ inositol metabolism.

identified among 8297 genes of the (cid:1) 27 000 protein- coding genes of Arabidopsis with an Affimetrix Gene- Chips [32].

In this paper, we present a list of the UPR genes of Arabidopsis identified among all the protein-coding genes. In order to increase the accuracy of the list, the genes selected on fluid microarray analysis were reana- lyzed by functional DNA microarray analysis. In addi- related to protein folding and tion to the genes degradation, genes related to protein translation and apoptosis are also included in the list.

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

Results

isomerase

protein 4

Fluid microarray analysis of gene expression on TM-treatment

In comparison with those of yeast, the UPR genes of mammalian cells are induced through a much more complicated mechanism, which has been shown to be triggered by at least three transcription factors, X-box binding factor (XBP-1), activating transcription fac- tor 6 (ATF6), and ATF4 [10]. The mammalian paralog of yeast Ire 1p is activated by ER stress and splices the invalid mRNA into mature mRNA encoding 371- amino acid XBP-1 [11,12]. XBP-1 translated from the spliced mRNA is translocated to the nucleus [13], where it binds to its target sequence in the regulatory regions of the P58IPK, ERdj4, HEDJ, EDEM, protein (PDI)-P5, disulfide ribosomal-associated (RAMP4), DnaJ ⁄ HSP40-like membrane genes, etc. [14]. ATF6 is an ER transmembrane protein that senses ER stress through its luminal domain, and then moves to Golgi bodies to be cleaved by site-1 and site-2 proteases [15–17]. The cleaved ATF6 cytoplasmic domain is released from Golgi membranes into the nucleus, where it induces, in the presence of nuclear factor Y, ER chaperone genes including BIP, GRP94, Calreticulin and ORP150, which have an ER stress response element (ERSE) in their regulatory regions [18,19]. PERK is an interferone-induced double stran- ded RNA-activated protein kinase (PKR)-related pro- tein that senses ER stress through its luminal domain and then phosphorylates initiation factor-2a (eIF2a), resulting in inhibition of bulk protein translation [20,21] and stimulation of translation of ATF4 [22]. ATF4 is a basic leucine zipper transcription factor that induces the transcription of many amino acid synthetic enzymes and amino acid transporters by binding to the amino acid response element (AARE) in the regu- latory regions of these genes [23]. ATF4 has also been shown to stimulate the transcription of CHOP, which is important for apoptotic cell death [24].

To identify UPR genes among all the genes expressed in Arabidopsis, we adopted the fluid microarray method, by which target genes can be cloned from selected fluid microarray beads. The fluid microarray beads and probes for array analysis were prepared using the mRNA from plantlets treated with or with- out TM for 6 h. BiP mRNA, a representative UPR gene, in TM-treated plantlets, was shown to increase 5.7 times compared to the level in untreated plantlets on real-time RT-PCR analysis. For the control experi- ment, competitive hybridization and sorting of the beads with a cell sorter were performed on 4 · 104 beads with a 1 : 1 mixture of the probes, which had been prepared from noninduced plantlets, and differen- tially labeled with Cy5 and fluorescein. In the control experiment, almost all of the beads after the control hybridization were sorted in the diagonal line region, the fluorescence intensities for fluorescein and Cy5 being the same (Fig. 1A). Based on the distribution of beads in this experiment, we set three gates to collect beads, i.e., for ones more heavily labeled with Cy5 (U1 and U2) and fluorescein (D). For differential gene expression analysis, probes from TM-treated plantlets were labeled with Cy5. Probes from nontreated plant- lets were labeled with fluorescein. Then 4 · 105 beads were hybridized with a 1 : 1 mixture of the two types of probes. For analysis of differential gene expression, 1473 and 1703 beads were collected in fractions U1 and U2 of the up-regulated genes, and 3550 beads in fraction D of the down-regulated genes (Figs 1B and 2A). The DNA fragments on beads in these fractions were amplified by PCR and then sequenced. In the up-regulated fractions, 215 genes (Table S1) were found as clusters of clones, which were identified on more than two beads, and 412 as singlet clones, which were identified on single beads (Table S2). For the

In contrast to the UPR mechanism(s) in yeast and animal cells, that of plant cells is not well understood. Putative plant paralogs of yeast Ire1p have been found in Arabidopsis thaliana and Oryza sativa [25,26]. Their N-terminal luminal domains have each been shown to function as a sensor for ER stress in yeast. However, neither target mRNAs of transcription factors for plant Ire1p nor target genes induced by this system have been identified. On the other hand, the mRNAs of BiP, calreticulin, calnexin and PDI have been shown to be induced on treatment with TM and dithiothreitol in Arabidopsis, Zea mays, Phaseolus vulgalis, Glycine max and Nicotiana tabacum on northern analysis [27– 31]. The 21 UPR genes up-regulated by the stress induced by both TM and dithiothreitol have been

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3462

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

A

B

down-regulated fraction, 10% of the total beads were analyzed to reveal 17 genes as clusters of clones (Table 1) and 34 as singlet clones (Table S2).

Analysis with functional DNA microarrays

these genes

conditions, because

SEL-1L ⁄ HRD3-like, DER1-like,

variation was obtained by means of a self ⁄ self hybridi- zation experiment with Cy5 or Cy3-labeled target DNA fragments prepared from nontreated plantlet mRNA. Thus, the expression difference between selec- ted genes was regarded as being significant below a probability of error of 5%. Thirty-six genes were con- firmed to be induced under the three different induct- ive satisfied this criterion (Fig. 2B and Table 2). These genes com- prised 30 for which some functional information was available and six for which no information was avail- able. Among them, 27 genes were putative paralogs that have been reported to be UPR genes in yeast and ⁄ or mammalian cells. The functional categories comprise protein folding (13 genes), translocation (six genes), ER-associated protein degradation (ERAD) (three genes; HRD1-like, SEL-1L ⁄ HRD3-like, and DER1-like), protein glycosylation and modification (two genes), regulation of translation (P58IPK) [34], and vesicle trafficking (two genes). The induction of HRD1-like, and P58IPK mRNA was confirmed by real-time RT-PCR analysis (Fig. 3). In addition, we found that an anti- apoptosis protein, Bax inhibitor-1 (BI-1) [35,36], was also included in the list of up-regulated UPR genes. Induction of this paralog by ER stress in organisms other than plants has not been reported. The induc- tion of BI-1 mRNA by ER stress in Arabidopsis was confirmed by real-time RT-PCR analysis (Fig. 3). Furthermore, the induction (1.5-fold variation) of Homo sapiens BI-1 by TM-treatment for 24 h was confirmed in Hep G2 cells, a cell line derived from a human hepatoma, by real-time RT-PCR (data not shown).

In order to increase the accuracy of the list of UPR genes, we reanalyzed the genes selected on fluid micro- array analysis with functional DNA microarrays. The functional DNA microarrays were prepared by spot- ting PCR fragments from the 215 up-regulated cluster genes (Table S1) and the 17 down-regulated cluster genes (Table 1) cloned on fluid microarray analysis. Singlet genes were omitted from the functional DNA microarray analysis, because the list of singlet genes was predicted to contain missorted non-UPR genes at a high frequency. Functional DNA microarray analyses were performed with mRNA preparations from plantlets treated with or without TM, dithio- threitol or l-azetidine-2-carboxylic acid (AZC). AZC is a proline analog that is incorporated in nascent polypeptides instead of proline and prevents the fold- ing of the polypeptides [33]. Induction of BiP mRNA (3 h or 17 h, by dithiothreitol- or AZC-treatment respectively) was confirmed to be 3.4 or 22-times higher than that in untreated plantlets on real-time RT-PCR analysis. To identify the up-regulated UPR it was required that candidate UPR genes genes, show a mean fold variation of greater than 1.2-fold with all the treatments with TM, dithiothreitol and AZC. In addition, from the list, we eliminated the genes in which the degree of variation was lower than the sum of the background variation and twice the standard deviation. The degree of background

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3463

Fig. 1. Competitive hybridization on fluid microarrays. (A) Control hybridization: 4 · 104 beads were hybridized with a 1 : 1 mixture of differ- entially labeled probes from noninduced plantlets. (B) Competitive hybridization: 4 · 105 beads were hybridized with a 1 : 1 mixture of cDNA probes prepared from induced (Cy5) and noninduced plantlets (fluorescein) as described under Experimental procedures. After hybridization, beads that went to gates U1, U2 and D were collected and subjected to gene analysis as described under Experimental procedures.

Putative cis-acting regulatory element of UPR genes

In yeast, ER stress activates Ire1p, which triggers the nonconventional splicing of HAC1 mRNA [3–5]. Hac1p produced from the spliced mRNA induces the transcription of UPR genes by binding to their UPR cis-acting regulatory element (UPRE), CAGCGTG [6–8]. In mammals, four kinds of cis-acting regulatory elements, which respond to ER stress, are known. Mammalian UPRE (TGACGTG-T ⁄ G) has been shown to be the specific cis-acting regulatory element for XBP1 and is referred to as the XBP1 binding site [39,40]. ERSE (CCAAT-N9-CCACG) has been found to be recognized by both ATF6 and XBP1 in vitro [41]. ERSEII (ATTGG-N-CCACG) has also been demonstrated to be a target of ATF6 [42]. Binding of ATF6 to these cis-acting regulatory elements occurs in collaboration with general transcription factor nuclear factor-Y [43,44]. AARE (C ⁄ EBT-ATF) (TT-G ⁄ T-CATCA), which was discovered in the CHOP pro- moter, is recognized by ATF4, translation of which is accelerated by ER stress [24]. In plants, a plant-specific UPR element (P-UPRE) (ATTGGTCCACGTCATC), which contains two mammalian UPR cis-acting regula- tory elements such as ERSEII and XBP1 binding sequences, was found in the 5¢ upstream regions of the BiP and calnexin genes [45]. Furthermore, complement- ary sequences to the mammalian ERSE and XBP1 binding sequences have been found in the 5¢ upstream regions of several genes that are induced by TM- or dithiothreitol-treatment [32,45]. Therefore, we searched for P-UPRE, the XBP1 binding sequence, ERSE, AARE, or complementary sequences in the 5¢ upstream regions (up to 1000 nucleotides) of the UPR genes. Sin- gle or plural putative cis-acting regulatory elements were found in the 5¢ upstream regions of 28 of the 36 up-regulated genes (Fig. 2C and Table 3). No cis-acting regulatory element found in the 5¢ sequence was upstream regions of the two down-regulated genes.

Increase in putative SEL-1L due to ER stress in Arabidopsis

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

To identify the down-regulated UPR genes, we required that candidate UPR genes show a mean fold variation of lower than 0.8-fold with all the treatments with TM, dithiothreitol and AZC. Two genes encoding vegetative storage proteins, Vsp1 and Vsp2 [37,38], sat- isfied this criterion. Vsp2-beads comprised 58% of the beads collected and were analyzed at gate D.

In yeast and mammalian cells, the HRD1 ⁄ HRD3 (SEL-1L) ubiquitination system coupled to protein is known to be degradation by 26S proteasomes induced to remove unfolded proteins under ER stress [9,46]. Plant paralogs of these genes have not been identified yet. In this study, the transcriptional induc- tion of genes homologous to mammalian HRD1 and SEL-1L [47–49] was observed (Fig. 3). Then, HRD1- and SEL-1L-like cDNAs were cloned with mRNA of

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3464

Fig. 2. Overview of the fluid microarray and functional microarray analyses. (A) Gene selection by fluid microarray analysis. Gates, U1, U2 and D were set as shown in Fig. 1B. Singlet, a gene identi- fied on a single bead. Cluster, a gene identified on more than two beads. (B) Analysis with functional DNA microarrays. The genes selected in (A) were analyzed. Two hundred and thirty-two genes (215 up-regulated cluster and 17 down-regulated cluster genes) were spotted on functional DNA microarrays. The functional DNA microarray analysis was carried out with target DNA fragments pre- pared from the mRNA of control plantlets or plantlets treated with tunicamycin (TM), dithiothreitol (DTT) or L-azetidine-2-carboxylic acid (AZC) as described under Experimental procedures. The numbers are the numbers of genes that showed an expression difference between control plantlets and plantlets treated with TM, DTT or AZC. The numbers in the ‘Overlap’ row are the numbers of overlap- ping up-regulated genes or down-regulated genes upon treatments with the three reagents. (C) Venn diagram of the numbers of over- lapping and nonoverlapping putative UPR cis-acting regulatory ele- ments of the 36 up-regulated genes selected in (B). The numbers in parentheses are the numbers of genes that have a cis-acting reg- ulatory element. Bold letters are the numbers of overlapping genes. ERSE, CCAAT-N9-(A ⁄ C)CACG; XbpI, TGACGTG(G ⁄ T); P-UPRE, ATTGG(T ⁄ G)CCACGTCAT; AARE, TT(G ⁄ T)CATCA.

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

Table 1. Genes recovered at gate D and functional DNA microarray analysis of them. Tunicamycin (TM), dithiothreitol (DTT) and L-azetidine- 2-carboxylic acid (AZC) values are means for six experiments. Control ratio obtained on competitive hybridization with Cy5- and Cy3-labeled control mRNA; values are means for six experiments. SD, standard deviation; n.d., not determined.

Fluid microbead array (number of beads) Functional DNA microarray (fold variation)

U1 U2 D TM DTT AZC Control (SD) AGI gene Description

‘The Arabidopsis

two N-glycosylation consensus

band decreased to 70 kDa on endoglycosidase H (Endo H) digestion. On the other hand, the 70 kDa band was insensitive to Endo H (Fig. 4B). From these results, the 70 kDa protein was thought to be a non- glycosylated form of At SEL-1L. On cell fractionation, At SEL-1L was assumed to be a membrane protein, as judging from the existence of a putative membrane spanning region (Fig. 4C). The 70 kDa band of plant- lets treated with TM for 24 or 48 h was denser than the 74 kDa band of the control plantlets (Fig. 4B). Thus, it was suggested that At SEL-1L polypeptides were synthesized from the At SEL-1L mRNA induced by ER stress, but that N-glycosylation of newly syn- thesized At SEL-1L molecules was inhibited by TM.

ER stress and phosphorylation of eIF2a

In this study, we found that the mRNA of P58IPK was induced by ER stress (Table 2 and Fig. 3). P58IPK was first identified as an inhibitor of interferon-induced PKR in mammalian cells [50]. The PKR family responds to different stress signals and attenuates translation by phosphorylating the specific serine resi- due of eIF2a [51] to protect cells from the stress. P58IPK inhibits PKR-mediated translational arrest by inactivating the kinase by binding to the domain of PKR family members. In mammals, ER stress also causes translational arrest through phosphorylation of eIF2a by PKR-like ER kinase, PERK [20,52].

Arabidopsis plantlets by RT-PCR. Their nucleotide sequences coincided with those presented in the data- base of Information Resource’ (http://www.arabidopsis.org/). The putative amino acid sequence of an HRD1-like protein contained an N-ter- minal signal sequence and five membrane-spanning regions (data not shown). The recombinant luminal domain of the HRD1-like protein was expressed in Escherichia coli and purified. Unfortunately, autoubiq- uitination activity was not detected for the recombin- ant HRD1-like protein. On the other hand, the putative amino acid sequence of Arabidopsis SEL-1L (At SEL-1L) contained an N-terminal signal sequence seq- (Met1–Glu20), uences, and a membrane-spanning region (Phe623– Arg643) near the C-terminus (data not shown). The amino acid sequence of a soybean paralog of SEL-1L, which was deduced from the nucleotide sequence of cDNA cloned from young leaves by RT-PCR, was clo- sely similar to Arabidopsis ones (data not shown). Anti-(At SEL-1L) serum was prepared with the recom- binant luminal domain (Phe21–Val622) of At SEL-1L, which was expressed in E. coli and isolated. The anti- serum only immunoreacted with a 74 kDa protein of control plantlets on western blotting analysis (Fig. 4A). With TM-treatment, the 74 kDa protein gradually decreased and a 70 kDa band began to appear at 4 h after the treatment. During the next 24 h, the 70 kDa band significantly increased. The size of the 74 kDa

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3465

0.99 (0.04) 0.98 (0.05) 1.10 (0.05) 0.93 (0.08) 1.01 (0.03) 1.01 (0.03) 1.09 (0.14) 0.94 (0.04) 3.89 (6.12) 1.03 (0.03) 1.09 (0.06) 0.89 (0.08) 1.30 (0.15) 1.10 (0.09) 1.04 (0.07) 0.93 (0.06) At5g24770 At5g24780 At2g39330 At5g50960 At3g04120 At5g64120 At4g34490 At4g37410 At5g04140 At4g22470 At5g47930 At1g01060 At2g07671 At4g32610 At2g07707 At3g02200 At5g51190 Vegetative storage protein Vsp2 Vegetative storage protein Vsp1 Putative mylosinase-binding protein Nucleotide-binding protein Glyceraldehyde-3-phosphate dehydrogenase C subunit Peroxidase Adenylyl cyclase-associated protein CAP2 Cytochrome P450 Ferredoxin-dependent glutamate synthase Extensin-like protein Ribosomal protein S27 Similar to DNA binding protein CCA1 Unknown Unknown Unknown Unknown Unknown 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 182 12 15 4 2 2 2 2 5 5 3 2 31 2 12 4 8 0.20 0.19 0.36 0.97 0.68 n.d. 0.94 0.28 0.83 0.27 1.15 0.24 0.21 0.92 0.28 0.99 1.12 0.78 0.79 1.10 1.20 0.99 n.d. 0.94 1.03 0.97 0.91 0.95 0.82 0.93 0.96 0.90 1.00 0.99 0.38 0.12 n.d. 5.64 0.98 0.05 0.02 0.84 n.d. 0.02 0.69 0.01 6.56 0.74 2.16 0.32 2.95 18.08 (0)

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

Table 2. Genes up-regulated by ER stress. Tunicamycin (TM), dithiothreitol (DTT) and L-azetidine-2-carboxylic acid (AZC) values are means for six experiments. Control ratio obtained on competitive hybridization with Cy5- and Cy3-labeled control mRNA; values are means for six experiments. SD, standard deviation.

Fluid microbead array (number of beads) Functional DNA microarray (fold variation)

U1 U2 TM DTT AZC Control (SD) AGI gene Description

BiP-likea,b BiPa,b BiP Calnexin 1a,b Calnexin 2a,b Calreticulin 1 Calreticulin 2a,b AtHsp90-7a,b Similar to PDIa Similar to PDI Similar to PDIa Similar to PDI AtCYP20-1 (cyclophilin ROC7) 0 302 140 82 0 0 16 34 5 30 2 1 0 2 91 26 12 7 22 44 3 54 2 0 1 3 38.24 3.81 4.12 3.42 2.37 2.16 2.43 3.86 2.11 3.82 2.46 3.22 1.43 38.35 4.06 4.09 2.63 2.34 2.07 2.02 2.65 2.28 2.68 2.50 3.00 1.34 508.73 36.22 53.67 25.26 10.48 1.94 1.51 6.88 3.53 11.98 10.30 10.46 2.13 3.13 (0.33) 1.14 (0.14) 1.21 (0.10) 0.27 (0) 0.97 (0.09) 1.02 (0.15) 0.95 (0.05) 1.05 (0.12) 1.05 (0.19) 0.91 (0.07) 1.01 (0.08) 0.95 (0.13) 1.01 (0.08)

PROTEIN FOLDING At1g09080 At5g28540 At5g42420 At5g61790 At5g07340 At1g56340 At1g09210 At4g24190 At2g47470 At1g77510 At2g32920 At1g04980 At5g58710 GLYCOSYLATION ⁄ MODIFICATION At2g02810 2 3 3.53 2.08 21.95 0.94 (0.04)

At2g41490 UDP-glucose ⁄ UDP-galactose transportera,b UDP-GlcNac:dolichol phosphate 0 2 1.55 1.53 6.67 1.01 (0.09)

N-acetyl-glucosamine-1-phosphate transferasea

SEC61 gamma subunit Similar to SEC61 alpha subunit Similar to SEC61 alpha subunit Similar to SERP1 ⁄ RAMP4 Similar to SERP1 ⁄ RAMP4a,b Similar to ER chaperone SIL 1 2 0 0 203 0 2 22 4 2 120 13 34 1.94 1.5 1.27 2.42 2.05 2.39 1.66 1.61 1.38 1.82 1.72 3.00 5.54 11.89 2.11 13.48 10.61 52.88 1.07 (0.13) 0.97 (0.10) 0.96 (0.07) 0.98 (0.04) 1.08 (0.19) 0.98 (0.12)

7 0 0 11 7 3 3.36 1.67 1.54 2.33 1.59 1.54 6.48 4.23 9.16 0.99 (0.07) 1.09 (0.07) 0.96 (0.11) Similar to HRD1 Similar to DER1a,b Similar to SEL-1L ⁄ HRD3

2 14 2.06 1.76 10.76 0.94 (0.11)

Similar to Emp24p Similar to NEM-sensitive fusion protein 0 0 4 3 1.47 7.52 1.29 9.68 2.73 688.38 0.98 (0.05) 1.05 (0.19)

BI-1 0 2 2.30 1.73 86.70 0.99 (0.07)

TRANSLOCATION At5g50460 At1g29310 At2g34250 At1g27330 At1g27350 At3g51980 PROTEIN DEGRADATION At1g65040 At4g21810 At1g18260 TRANSLATION P58IPK At5g03160 VESICLE TRAFFICKING At3g07680 At4g21730 ANTI-APOPTOSIS At5g47120 UNCLASSIFIED At2g25110 At5g09410 Similar to stroma cell-derived factora Similar to anther ethylene-up-regulated 0 1 3 1 2.14 1.20 2.08 1.20 9.17 3.59 0.93 (0.03) 0.89 (0.05) calmodulin-binding protein ER1

a Gene identified by Martı`nez and Chrispeels [32]. b Genes identified by Noh et al. [54].

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3466

UNKNOWN At5g18090 At1g56580 At5g64510 At5g14890 At3g22235 At1g29060 2 5 8 1 0 0 3 70 3 7 4 3 1.20 1.95 12.74 3.60 1.51 1.79 1.25 1.98 5.87 5.60 2.49 1.78 14.31 9.66 181.56 46.17 1.28 33.69 0.90 (0.06) 1.04 (0.02) 1.29 (0.32) 1.05 (0.05) 1.11 (0.09) 1.02 (0.07)

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

Mammalian P58IPK has been shown to be induced at a later phase of ER stress [53]. Deletion of P58IPK has been reported to result in an increase in phosphory- lated eIF2a. Hence P58IPK is thought to function as a feedback regulator for translational regulation in the later phase of ER stress. The phosphorylated Ser51 of eIF2a in plantlets was examined during ER stress by western blot analysis (Fig. 5A). The level of phosphor- ylated eIF2a (Ser51) in the plantlets treated with TM was lower than that in untreated plantlets. The phos- phorylated eIF2a increased again on removal of TM from the medium after 6 h of treatment. However, the protein synthesis in plantlets, which was assayed as the incorporation of [35S]-labeled Met and Cys into nas- cent proteins, was not affected by TM-treatment (Fig. 5B).

Fig. 3. Confirmation of transcriptional induction of six genes by real-time RT-PCR analysis. The amounts of actin, BiP, HRD1, SEL- 1L, DER1, p58IPK and BI-1 mRNAs in total RNA from Arabidopsis plantlets treated with TM (black bars), DTT (hatched bars), or AZC (white bars) for 2 h were determined by real-time RT-PCR as des- cribed under Experimental procedures. The value for each mRNA was standardized to the value for actin mRNA in the corresponding total RNA preparation. Fold expression change was calculated as the ratio of mRNA in the plantlets treated and untreated with a stress reagent. Each value represents the mean for two experi- ments.

Discussion

beads included a large number with highly expressed housekeeping genes, some of them might be missorted at the gates, which would expand the list of genes. Of the beads collected at gates U1 and D on fluid micro- array analysis, 89 and 87% were regarded as up-regu- lated and down-regulated genes on functional DNA microarray analysis, respectively. On the other hand, 38% of the beads collected at gate U2 were regarded as up-regulated genes on functional DNA microarray analysis. This suggests that the discrepancy between the values obtained in the two analyses is mainly due to the beads missorted at gate U2. However, of the rest, the 50 genes that showed no up-regulated signal for the plantlets treated with TM showed an up-regula- ted signal in the plantlets treated with dithiothreitol and ⁄ or AZC. In addition, 23 of the genes that showed no difference in expression on DNA microarray analy- sis between plantlets treated and untreated with TM had putative UPR cis-acting regulatory elements in their upstream regions. Furthermore, 27 of the 63 genes were eliminated on functional DNA microarray analysis from the list by setting some criteria. There- fore, the remaining 36 genes, which satisfied these criteria, were considered to be reliable up-regulated UPR genes. Among these 36 genes, 12 coincided with up-regulated UPR genes previously identified on ana- lysis with an Affimetrix GeneChips loaded with 8297 Arabidopsis probe sets [32,54]. Two down-regulated genes, Vsp1 and Vsp2, which satisfied all the criteria, are known to be for temporary nitrogen-storage pro- teins [38], and are subject to regulation by sugars, light, phosphates, nitrogen, wounding, auxins, jasmo- nates and oxidative-stress [55]. The down-regulation of Vsp1 and Vsp2 may result in an increase in the intra- cellular amino acid pool, which may play an important role in the recovery from ER stress. In mammalian cells, ER stress affects cellular amino acid metabolism via the PERK ⁄ ATF4-mediated signaling pathway, which induces some amino acid synthesis- and trans- port-related genes [23]. No putative UPR cis-acting regulatory element was found in the 5¢ upstream regions of Arabidopsis Vsp1 and Vsp2. Therefore, it is not clear whether these genes are directly regulated by the UPR system or down-regulated by a metabolic dis- order caused by ER stress.

In this study, we tried to make a list of the UPR genes in Arabidopsis. In total, 215 up-regulated and 17 down-regulated cluster genes were cloned from mRNA of Arabidopsis plantlets treated with TM on fluid microarray analysis. A functional DNA array was pre- pared by using the cloned gene fragments, and then used for analysis. Among the 215 up-regulated cluster genes, only 63 showed statistically positive signals on functional DNA array analysis, showing differences in the expression of target mRNA of the plantlets treated with or without TM. Because the fluid microarray

Thirteen genes, which encode six protein families responsible for protein folding, are included in the UPR gene list. Among them, BiP (three genes), calnex- in (two genes), calreticulin (two genes), and AtHSP 90- 7 (one gene) have been shown to be induced by ER stress on northern blotting [25,54]. Four genes enco- ding PDI families are also included in the list. PDI and its family members are characterized by the pres-

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3467

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

Table 3. Putative cis-acting regulatory elements of genes up-regulated by ER stress. Position designated from the 5¢ terminus of the ATG initiation codon. Lowercase letters in sequences correspond to N9 in ERSE-like sequence CCAAT-N9-(A/C) CACG.

cis-Acting regulatory element

Motif-like Position AGI gene Description

At1g09080 BiP-like

At5g28540 At5g42420 BiP BiP

At5g61790 Calnexin 1

At5g07340 At1g56340 At1g09210 At4g24190 Calnexin 2 Calreticulin 1 Calreticulin 2 AtHsp90-7

CGTGTcaagaagtgATTGG(142–124) CGTGTctgcttgtgATTGG(220–202) ATTGGTCCACGTCAT(168–154) CCACGTCA(187–180) ATTGGACCACGTCAT(193–179) CGTGGcctgttatgATTGG(237–219) TGACGTGG(240–233) ATTGGGCCCAGGTCA(290–274) CGTGTatttaactaATTGG(147–129) CGTGTcggttacctACCGG(178–160) CCAATacaaaactaCCACG(229–211) CCACGTCA(253–246) CCACGTCA(139–132) CCAATgaaaactctCCACG(158–140)

At2g47470 At1g77510 At2g32920 At1g04980 Similar to PDI Similar to PDI Similar to PDI Similar to PDI

At5g58710 AtCYP20-1 (cyclophilin ROC7) CGTGTgacaatatcATTGG(128–110) TGACGTGT(131–124) TGACGTGG(83–76) CCAATtacaattgtACACG(134–116) ERSE-like ERSE-like P-UPRE Xbp1 binding-like P-UPRE ERSE-like Xbp1 binding-like P-UPRE ERSE-like ERSE-like ERSE-like Xbp1 binding-like Xbp1 binding-like ERSE-like – ERSE-like Xbp1 binding-like Xbp1 binding-like ERSE-like – At2g02810 At2g41490 Similar to UDP-glucose ⁄ UDP-galactose transporter UDP-GlcNac:dolichol phosphate N-acetylglucosamine- 1-phosphate transferase CGTGGcaaatccttATTGG(128–110)

At5g50460 SEC61 gamma subunit

TGACGTGT(171–164) TGACGTGT(322–315) CGTGTatccgtattATTGG(439–420)

Similar to SEC61 alpha subunit Similar to SEC61 alpha subunit Similar to SERP1 ⁄ RAMP4 Similar to SERP1 ⁄ RAMP4 Similar to ER chaperone SIL 1 At1g29310 At2g34250 At1g27330 At1g27350 At3g51980

CCAATcactgaccgCCACG(223–205) CCAATtatagacggCCACG(269–251) TGACGTGT(149–142) CGTGTaataatataATTGG(146–128) CGTGTcgttatatcATTGG(338–320)

Similar to HRD1 Similar to DER1 Similar to SEL-1L ⁄ HRD3 P58IPK At1g65040 At4g21810 At1g18260 At5g03160

At3g07680 Similar to Emp24p

CGTGGccggttactATTGG(176–158) CGTGGgtcataacgATTGG(244–226) CGTGTttaattatcATTGG(304–286) CCAATgatataacgCCACG(437–419) TGACGTGG(477–470) ACACGTCA(609–602)

CGTGGatgattcttATTGG(298–280) ERSE-like – Xbp1 binding-like Xbp1 binding-like ERSE-like – ERSE-like ERSE-like Xbp1 binding-like ERSE-like ERSE-like – ERSE-like ERSE-like ERSE-like ERSE-like Xbp1 binding-like Xbp1 binding-like – ERSE-like – At4g21730 At5g47120 At2g25110 At5g09410 Similar to NEM-sensitive fusion protein BI-1 Similar to stroma cell-derived factor Similar to anther ethylene-up-regulated calmodulin- binding protein ER1

CGTGTcggaggtttATTGG(271–253) TGACGTGG(396–389) TTTCATCA(154–161) TTTCATCA(271–278)

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3468

Unknown Unknown Unknown Unknown Unknown Unknown At5g18090 At1g56580 At5g64510 At5g14890 At3g22235 At1g29060 ERSE-like Xbp1 binding-like AARE-like AARE-like – – – ERSE-like CCAATattaaaacgCCACG(233–215)

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

A

A

B

B

C

Increase in At SEL-1L in the membranes of Arabidopsis Fig. 4. plantlets on TM-treatment. (A) Plantlets were incubated in the pres- ence (lanes 7–12) or absence of TM (lanes 1–6) for the indicated times. Proteins were extracted and then subjected to SDS ⁄ PAGE. At SEL-1L was stained by western blotting with antiserum as des- cribed under Experimental procedures. (B) Plantlets were incubated in the presence (lanes 3 and 4) or absence of TM (lanes 1 and 2) for 48 h. Proteins were extracted, digested with (lanes 2 and 4) or without (lanes 1 and 3) Endo H, and then subjected to SDS ⁄ PAGE. At SEL-1L was stained by western blotting with antiserum as des- cribed under Experimental procedures. (C) The total (lane 1), super- natant (lane 2), and membrane (lane 3) fractions obtained from the plantlets treated with TM for 48 h on centrifugation at 100 000 g were subjected to SDS ⁄ PAGE, and At SEL-1L was stained by western blotting with antiserum as described under Experimental procedures.

confirmed to be induced by ER stress. A gene enco- ding cyclophilin family protein ATCYP20-1 was identi- fied as a UPR gene. Twenty-nine genes encoding cyclophilin family members were found in the Arabi- dopsis genome [62]. Among them, five gene products are assumed to be targeted to the ER lumen with N-terminal signal peptides. Among them, ATCYP20-1 has the amino acid sequence RFWH, which is an essential sequence for peptidyl prolyl cis, trans iso- merase activity. Hence, it is suggested that ATCYP20-1 may participate in the folding of proteins in the ER.

The genes of six translocation-related proteins were found to be induced. In mammalian cells and yeast, translocon subunit proteins are thought to be induced to enhance retrotranslocation of unfolded proteins from the ER to the cytosol [63]. The retrotranslocated proteins are degraded by 26S proteasomes. Recently, in tobacco, a GFP-fusion protein containing the P region of calreticulin, which is a model of a misfolded

ence of one or two thioredoxin homologous motifs per molecule. Yeast and mammalian PDIs are known as multifunctional folding catalysts and molecular chaper- ones, which catalyze the formation and rearrangement of disulfide bonds between correct pairs of cysteine residues in nascent polypeptide chains in the ER [56]. Mammalian PDI functions not only as a catalytic enzyme but also as a subunit of microsome triacylglyc- erol transfer protein [57] and prolylhydroxylase [58]. Mammalian PDI family ER-60 ⁄ ERp57, which also exhibits protein oxidoreductase activity, interacts and cooperates with calnexin or calreticulin for oxidative folding of N-glycosylated proteins [59–61]. The genes of these PDI families are UPR genes [41]. In the Ara- bidopsis genome, 13 genes encoding putative PDI-rela- ted proteins, i.e. At1g04980 (NP 171990), At1g07960 (NP172274), At1g15020 (NP 172955), At1g35620 (NP 564462), At1g21750 173594), At1g52260 (NP (NP 175636), At1g77510 (NP 177875), At2g01270 (NP 180851), At2g47470 (NP 565258), At2g32920 (NP182269), At3g54960 (NP 191056), At3g16110 (NP 188232), and At5g60640 (NP 568926), were found. Identification and characterization of these PDI family proteins were not carried out. However, they were sup- posed to play important roles in protein folding, as four PDI-related genes among the above 13 genes were

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3469

Fig. 5. Effect of TM-treatment on phosphorylation of eIF2a. Plant- lets were incubated in the medium with TM for 6 h (lane 2), 7 h (lane 3), or 9 h (lane 4), or without TM for 9 h (lane 1) as described under Experimental procedures. In other experiments, plantlets were incubated in the medium with TM for 6 h and then incubated in the medium without TM for an additional 1 h (lane 5) or 2 h (lane 6). (A) After the incubation, the proteins were extracted from the plantlets and subjected to SDS ⁄ PAGE. Phosphorylated Ser51 of eIF2a was determined by western blot analysis as described under Experimental procedures. (B) After the incubation, proteins of the plantlets were metabolically labeled with [35S]Met and [35S]Cys for 20 min at 25 (cid:1)C. Then, the proteins were extracted and subjected to SDS ⁄ PAGE. Labeled proteins were determined by fluorography as described under Experimental procedures.

ATF4 mRNA, which have four and two upstream open reading frames in the 5¢ noncoding portion, respectively [67,68]. Induction of Arabidopsis P58IPK followed by a decrease in the phosphorylation of eIF2a (Ser51) may increase the translational efficiency for unidentified gene(s).

the degradation and ubiquitination of

It is unclear whether apoptosis may function as a UPR in plants, although inhibition of ER-type IIA Ca2+-pumps has been reported to induce ER stress and apoptosis in soybean cells [69]. In this study, we identified apoptosis-related gene BI-1 as a UPR gene. BI-1 is an evolutionarily conserved integral membrane protein localized in the ER [35,36]. In mammalian cells, BI-1 affords protection from apoptosis induced by ER stress by inhibiting BAX activation and translo- cation to mitochondria, by preserving the mitochond- rial membrane potential, and by suppressing caspase activation [70]. BAX and Bcl2, and their relatives were not found in plants. However, in rice and barley, BI-1 has been shown to suppress fungal elicitor-induced apoptosis [71,72].

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

Experimental procedures

Plant materials and treatments

protein in the ER, was shown to be retrotranslocated to the cytosol, ubiquitinated, and then degraded [64]. The induction of translocon subunits by ER stress in Arabidopsis suggests that an ERAD system similar to those of yeast or mammalian cells may remove mis- folded proteins produced in the ER of plant cells. This is supported by our finding that the genes encoding putative plant DER1, HRD1 and SEL-1L ⁄ HRD3 were also induced by ER stress. DER1 is a hydrophobic protein that is localized to the ER. In yeast, deletion of DER1 prevents degradation of unfolded proteins, suggesting that the function of DER1 may be specific- ally required for ERAD [65]. Yeast HRD1 is an ER- membrane-anchored ubiquitin ligase, which is required for several ERAD substrates, and is associated with relevant ubiquitin-conjugating enzymes [46]. At HRD1, which has the same nucleotide sequence as that registered in ‘The Arabidopsis Information Resource’, was cloned by RT-PCR with mRNA from Arabidopsis. Six trans- membrane regions and a RING-H2 domain of Arabi- dopsis HRD1 (At HRD1) showed high sequence homology with those of yeast and human HRD1s. Unfortunately, it is unclear whether or not At HRD1 functions as an ubiquitin ligase, as the cytosolic domain of At HRD1, which was expressed in E. coli and isolated, showed no self-ubiquitination activity with an in vitro assay system involving commercial human E1 and yeast E2 (UbCH5c). Yeast HRD3 is an ER-resident glycoprotein with a single span near the C-terminus, which stabilizes HRD1 and regulates the cytosolic HRD1 RING-H2 domain through interac- tion with the HRD1 transmembrane domain [66]. We showed that At SEL-1L was a membrane-anchored glycoprotein and that it increased under ER stress. In order to clarify the details of the mechanism of plant ERAD, functional characterization of these proteins must be performed.

Sterile seeds of Arabidopsis thaliana (Columbia) were germi- nated in 0.5· Murashige and Skoog medium [73] containing 1% (w ⁄ v) sucrose (MS), and cultured for two weeks. To prepare a cDNA tagged library and probes for transcrip- tome analysis with fluid microarrays or functional DNA microarrays, whole plantlets were treated by immersing their roots in MS containing 5 lgÆmL)1 TM, 1 mm dithio- threitol or 50 mm AZC for the indicated times. For the control experiment, plantlets were treated with MS without stress reagents. For relative quantification of mRNA by real-time RT-PCR, and pulse-labeling experiments with [35S]Met and [35S]Cys, the upper parts of plants were cut off from their roots and immersed in MS with a stress rea- gent.

Real-time RT-PCR analysis

Total RNA was isolated with an RNeasy Plant Mini kit (Qiagen, Valencia, CA) from plant tissues treated with or without TM for 6 h. Relative quantification of mRNA was carried out by the real-time RT-PCR method with an ABI PRISM 7000 Sequence Detection System (Applied Biosys- tems, Foster City, CA). Forward primers, 5¢-AAGTCGT TGCACCTCCTGAGA-3¢, 5¢-TCAAGGACGCTGTTGT CACTGT-3¢, 5¢-ACACGGCAAATAACGTTCATCTCTA- 5¢-TCTCT 3¢, 5¢-GGACTGCTTTCATCTGGCTTGT-3¢, GTTGGGTTTATCTCTTTGGTT-3¢, 5¢-TGATGGAAGA AGCAGTGGATGA-3¢ and 5¢-CGTAGAAGAGTGGTA

In mammalian cells, ER stress responses are com- posed of three steps, i.e., enhancement of the refolding and degradation of unfolded proteins, attenuation of translation [20,21], and apoptosis [24]. ER stress has not been found to cause attenuation of translation in plants. In this study, we found that the P58IPK gene was up-regulated by ER stress. Mammalian P58IPK is induced at a later phase of ER stress and inhibits PKR-mediated translational arrest by binding to the kinase domain of the PKR family [53]. However, bulk protein translation of Arabidopsis was not affected by ER stress, even though the phosphorylation of eIF2a (Ser51) was partially inhibited by ER stress. The phos- phorylation of eIF2a (Ser51) increases the translational efficiency of yeast GCN4 mRNA and mammalian

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3470

Fluid microarray analysis

the CAAGCAGATG-3¢, were used for detection of mRNAs of actin, BiP, P58IPK, BI-1, At HRD1, At SEL-1L or Arabidopsis DER1 (At DER1), respectively.

Reverse primers, 5¢-ATCGACGGGCCTGACTCAT-3¢, 5¢-CAACATTGAGCCCAGCAATAAC-3¢, 5¢-CAGCTAT TTAAGCCGTCTTTTCCA-3¢, 5¢-GATAGATGCAGAGC CACCAAAGA-3¢, 5¢-CGGACATGAGAGAGCAAAGT CA-3¢, 5¢-CAGCTGCAAATTATGGTGAAG-3¢ and 5¢- ACCCGACGGTGGTGACTACA-3¢, were used for detec- tion of the mRNAs of actin, BiP, P58IPK, BI-1, At HRD1, At SEL-1L and At DER1, respectively.

TaqMan probes

(Applied Biosystems), 5¢-VIC-CAG TACCTTCCAGCAGATGTGGATCGC-TAMRA-3¢, 5¢- FAM-CCAGCTTACTTACTTCAATGATGCTCAAAGG C-TAMRA-3¢, 5¢-FAM-CTATGCAAGGTCTCAGTCAG GCTCGGC-TAMRA-3¢, 5¢-FAM-ATGCTAATGTGGC TCCAGTTTGCCTCT-TAMRA-3¢, 5¢-FAM-TCCACTCT 5¢-FAM-AA CTTTTGAGCCATCCAATGC-TAMRA-3¢, CGACTTGCTTTTGCTCTTCTCTCGC-TAMRA-3¢ and 5¢-FAM-ATTATAACCCGGTCGTATCTCACGGC-TAM RA-3¢, were used for detection of the mRNAs of actin, BiP, P58IPK, BI-1, At HRD1, At SEL-1L and At DER1, respectively.

Preparation of fluid microarrays

For analysis of differentially expressed mRNA in Arabidopsis treated with or without TM, fluid microarray analysis was performed. Probes for competitive hybridization on the fluid microrrays were prepared from the same mRNA sources as those used for the preparation of the cDNA tagged library. In brief, mRNA was converted to cDNA using a flanking oligo dT primer carrying a T7 promoter sequence for first strand synthesis. The probes were synthesized from cDNA derived from control or TM-treated plantlets by T7 RNA polymerase reaction in the presence of fluorescein-UTP or Cy5-UTP. A mixture of probes was then hybridized with a mixture of 4 · 105 fluid microarray beads prepared from the control or TM-treated plantlets at 50 (cid:1)C overnight. Labeled fluid microarray beads were washed in 1· NaCl ⁄ Cit (0.15 m NaCl, 0.015 m sodium citrate, pH 7) ⁄ 0.1% (w ⁄ v) SDS and 0.1· NaCl ⁄ Cit ⁄ 0.1% (w ⁄ v) SDS at 65 (cid:1)C for 15 min [75]. The distribution of microbeads in Fig. 1A allowed us to set gates for collecting microbeads that were more heavily labe- led with Cy5 or fluorscein (Fig. 1B). The polygons in Fig. 1B represent the gates at which microbeads carrying up-regula- ted or down-regulated clones (D) were collected. The up- regulated clone fraction was further separated at two gates (U1 and U2) to divide the beads fraction into two. DNA fragments on the sorted beads were amplified by PCR, sub- cloned into pT7Blue-2 (Novagen, Darmstadt, Germany), and then sequenced by the Dye Terminator method. Sequences of more than 300 nucleotides were adopted as use- ful data from the sequence data obtained. Filtering of sequence data and trimming of the vector sequence were car- ried out with the Paracel Filtering Package (Paracel, Inc., Pasadena, CA). The obtained sequence was searched for the sequence data in ‘The Arabidopsis Information Resource’ (http://www.arabidopsis.org/index.jsp). Then, clustering of the sequence was performed with the Paracel Clustering Package (Paracel, Inc.).

A cDNA tagged library was constructed according to Bren- ner’s method [74]. In brief, mRNA was extracted from plant tissues, except roots, treated with or without TM for 6 h. A total of 2.5 lg of mRNA from plants treated with or without TM was combined and converted to cDNA with a 5¢-biotin-conjugated anchored (dT19) primer containing a BsmBI restriction sequence as a primer and a dNTP mix- ture containing 5-methyl dCTP as a substrate. The DNA fragments were digested with DpnII and BsmBI, and then ligated into a tag vector (tag library plasmid) (Takara Bio Co. Ltd, Kyoto, Japan).

Functional DNA microarray analysis

SDS,

Functional DNA microarrays were prepared by spotting the PCR fragments derived from the genes selected as up- or down-regulated genes on fluid microarray analysis. The PCR fragments were amplified using the cDNA fragments subcloned into pT7Blue-2 as a template. Each fragment was spotted at two sites on a slide glass. Target DNA frag- ments were synthesized by in vitro reverse transcription reaction using Cy3-dUTP or Cy5-dUTP from 1.5 lg of mRNA of control plantlets or plantlets treated with TM, dithiothreitol or AZC for 6 h, 3 h or 17 h. The labeled tar- gets were hybridized to a functional DNA microarray in 6· NaCl ⁄ Cit ⁄ 0.2% (w ⁄ v) SDS ⁄ 5· Denhardt’s solution ⁄ carrier DNA at 65 (cid:1)C for 14 h [75], and then washed in 1.2· NaCl ⁄ Cit ⁄ 0.2% (w ⁄ v) 2.2· NaCl ⁄ Cit ⁄ 0.2% (w ⁄ v) SDS and then 3.2· NaCl ⁄ Cit ⁄ 0.2% (w ⁄ v) SDS at

DNA fragments for loading onto antitag microbeads were prepared by PCR using the tagged library as a tem- plate and a 6-carboxyl-fluorescein-labeled reverse primer (BD Biosciences Clontech, Palo Alto, CA). The DNA frag- ments were digested with PacI and then treated with T4 DNA polymerase in the presence of dGTP to expose the tags as single strands. The DNA fragments were loaded onto antitag microbeads. Microbeads combined with cDNA were selected with a cell sorter, MoFloTM (DacoCytoma- tion, Glostrup, Denmark), and then treated with T4 DNA polymerase and T4 DNA ligase to fill the gap between the cDNA and the tag. 6-Carboxyl-fluorescein was removed by DpnII digestion. Then the antisense strand of cDNA on the microbeads was labeled by ligation with an adaptor carry- ing 3¢-6-carboxyl-fluorescein and removed by treatment with 150 mm NaOH. The microbeads that carried antisense strands were removed from the microbeads that carried sense strands using the cell sorter.

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3471

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

site,

55 (cid:1)C for 5 min. The functional DNA microarray was rin- sed once with 0.05· NaCl ⁄ Cit. The fluorescence was scanned with a GeneChip(cid:2) Scanner 428 (Affymetrix, Inc., Santa Clara, CA). The same experiments were carried out using three functional DNA microarrays. The data were analysed using BioDiscovery imagene Ver. 4.2 (BioDiscov- ery, El Segundo, CA). The mean Cy5 : Cy3 ratio values were calculated as the Cy5 value divided by both the correction value and the raw Cy3 value. Calculation of the correction value was carried out as described below:

the histidine

fusion of

the

vector, two kinds of DNA fragments were amplified by PCR with two sets of primers. One set comprised a forward primer as the DNA sequence encoding the N-terminus of the luminal domain of At SEL-1L containing an NdeI 5¢-ACGTCTGACATATGTTTGGCGT restriction TCACGCTCGTCCC-3¢, and a reverse primer correspond- ing to the sequence containing a XhoI restriction site in At SEL-1L, 5¢-AAATCTTCATCCTCCTCGCCTCGAG-3¢. The other set comprised a forward primer corresponding to the sequence containing a XhoI restriction site in At SEL- 1L, 5¢-AAAGGTGCTCTAAGGAAATCTCGAG-3¢, and a reversed primer as the DNA sequence encoding the C-ter- minus of the luminal domain of At SEL-1L containing a XhoI restriction site, GTGGTGCTCGAGCACCACATT CTCTATCCAAGTCTC-3¢. The former or latter PCR frag- ments produced were digested with NdeI and XhoI, or XhoI, respectively, and then cloned into pET-30Xa ⁄ LIC digested with NdeI and XhoI. Expression vector pET-30 ⁄ At SEL-1L allows tag LEHHHHHH to the C-terminus of a recombinant protein.

(a) Spots were selected according to the following criteria: [signal mean] ) [background mean] more than 60 000, and [signal mean] more than [background mean] + 2 · [back- ground standard deviation (SD)]; (b) Log (Cy5 : Cy3) of the spots selected in (a) was calculated; (c) Mean value I SD of (b) was calculated; (d) Spots were selected according to the following criteria: Log (Cy5 : Cy3) ranged within the mean values I SD obtained in (c); (e) Mean Log (Cy5 : Cy3) of the spots selected in (d) was calculated; (f) Mean Log (Cy5 : Cy3) in (e) was converted to a natural value, which corresponds to the correction value.

Expression and purification of the recombinant luminal domain of At SEL-1L BL21(DE3) cells were transformed with pET-30/At SEL-1L

Control experiments (self ⁄ self hybridization) to obtain a spot-specific background Cy5 : Cy3 ratio for judgment of significant differences in the Cy5 : Cy3 ratio were carried out. Target DNA fragments were synthesized using Cy3-dUTP or Cy5-dUTP from the mRNA of control plant- lets, and then hybridized competitively to a functional DNA microarray under the same conditions as for the comparative experiments. Mean control Cy5 : Cy3 ratios and their SD were calculated from the six values obtained in triplicate control experiments on two spots on functional DNA microarray the background assays. Most of [Cy5 : Cy3 I SD] values were in the range of 1.2–0.8. Hence, it was judged as a significant difference when the Cy5 : Cy3 ratio was more than 1.2 and also more than [background Cy5 : Cy3 ratio + 2 · SD], or less than 0.8 and also less than [background mean] + 2 · [background standard deviation (SD)].

Construction of an expression vector for the putative luminal domain of At SEL-1L

The expression of the putative luminal domain of At SEL-1L was induced by the addition of 0.4 mm isopropyl thio-b-d-galactoside for 4 h. The recombinant protein was produced as inclusion bodies in E. coli. The cells from 2 L culture broth were collected by centrifugation, disrupted by sonication in 40 mL of 20 mm Tris ⁄ HCl buffer, pH 7.9, containing 5 mm imidazole, 0.5 m NaCl and 1 mm CaCl2 (binding buffer), and then centrifuged at 10 000 g for 30 min at 4 (cid:1)C. The pellet was suspended in the bind- ing buffer containing 6 m urea and 5 mm 2-mercaptoetha- nol (urea-binding buffer) by sonication, and dissolved by adjusting the pH to 9 with 1 m NaOH and then readjust- ing it to 8 with 1 m HCl. A sample was applied to a His- Bind quick cartridge (Novagen) equilibrated with the urea-binding buffer. After washing the cartridge with the urea-binding buffer, the luminal domain of At SEL-1L was eluted with the urea-binding buffer containing 1 m imidazole, and then concentrated with a Centriprep-10 (Millipore, Billerica, MA). The purified luminal domain of At SEL-1L was used for the preparation of rabbit anti- serum. The recombinant protein was confirmed to have an initial methionine residue by N-terminal sequencing.

Analysis of At SEL-1L in Arabidopsis

Plantlets treated with TM for the indicated times were fro- zen in liquid nitrogen and then ground into a fine powder with a micropestle SK-100 (Tokken, Inc., Chiba, Japan). Proteins were extracted from 100 mg of the tissue with

The cDNA encoding At SEL-1L was cloned by RT-PCR with a forward primer, 5¢-ACGTCGCTGCAGCGATCT GATCACTGAGAAAC-3¢, and a reverse primer, 5¢-AAA GCCGGTACCCTCTGCTATTACAATGACGAAAACGAT TATC-3¢, using mRNA from Arabidopsis plantlets treated with TM for 6 h. The obtained fragments were digested with PstI and KpnI, and then cloned into pBluescript (Stratagene, La Jolla, CA) digested with PstI and KpnI. The insert in the vector was sequenced by the fluorescence dideoxy chain termination method (Applied Biosystems). An expression vector for the putative luminal domain of At SEL-1L, which corresponds to residues 21–621, was con- structed as described below. For cloning into an expression

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3472

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

Protein measurement

The concentrations of proteins were measured using an RC DC protein assay kit (Bio-Rad Laboratories, Hercules, CA), with c-immunoglobulin as an internal standard.

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

Acknowledgements

supernatant obtained was

We greatly thank Dr Makoto Kito, Emeritus Professor of Kyoto University, for the critical reading of the manuscript, valuable advice and warm encouragement. This study was supported by a Grant for the Program for Promotion of Basic Research Activities for Innova- tive Biosciences.

References

1 Cox JS, Shamu CE & Walter P (1993) Transcriptional

induction of genes encoding endoplasmic reticulum resi- dent-proteins requires a transmembrane protein kinase. Cell 73, 1197–1206.

2 Mori K, Ma W, Gething M-J & Sambrook JF (1993) A transmembrane protein with cdc2+ ⁄ CDC28-related kin- ase activity is required for signaling from the ER to the nucleus. Cell 74, 743–756.

80 lL of Laemmli’s SDS ⁄ PAGE buffer [76] containing a 1% (v ⁄ v) cocktail of protease inhibitors (Sigma, Inc., St. Louı` s, MO) by boiling for 5 min. For Endo H treat- ment, 300 mg of plant tissue was ground, suspended in 800 lL of 100 mm tricine ⁄ KOH buffer, pH 7.5, containing 0.5 m sucrose, 1 mm EDTA and a 1% (v ⁄ v) cocktail of protease inhibitors, and then filtered through a cell strai- ner (BD Biosciences, Bedford, MA). The filtrate was cen- trifuged at 1000 g for 10 min at 4 (cid:1)C to remove tissue debris. The centrifuged at 100 000 g for 1 h at 4 (cid:1)C. The pellet was dissolved in 16 lL 0.1 m phosphate buffer, pH 5.5, containing 0.2% (w ⁄ v) SDS and 0.5% (v ⁄ v) 2-mercaptoethanol by boiling for 5 min. The resulting solution was diluted with four volumes of 0.1 m phosphate buffer and then digested with 15 mU Endo H (Sigma, Inc.) at 37 (cid:1)C overnight. After digestion, proteins were treated with the SDS ⁄ PAGE buf- fer. For cell fraction analysis, the supernatant and pellet fraction obtained on centrifugation at 100 000 g were trea- ted with the SDS ⁄ PAGE buffer. Twenty-five micrograms of protein was subjected to SDS ⁄ PAGE and then blotted onto a poly(vinylidene difluoride) membrane. The At SEL-1L protein was then immunostained with 1 : 1000- diluted anti-At SEL-1L serum and horseradish peroxidase- conjugated rabbit Ig antiserum (Promega, Madison, WI) as secondary antibodies, using Western Lightning Chemi- luminescence Reagent (PerkinElmer Life Sciences, Boston, MA).

3 Cox JS & Walter P (1996) A novel mechanism for regu- lating the activity of a transcription factor that controls the unfolded protein response. Cell 87, 391–404.

Pulse labeling of proteins

4 Mori K, Kawahara T, Yoshida H, Yanagi H & Yura T (1996) Signalling from the endoplasmic reticulum to the nucleus: transcription factor with a basic-leucine zipper motif is required for the unfolded protein-response pathway. Genes Cells 1, 803–817.

5 Nikawa J, Akiyoshi M, Hirata S & Fukuda T (1996) Saccharomyces cerevisiae IRE2 ⁄ HAC1 is involved in IRE1-mediated KAR2 expression. Nucleic Acids Res 24, 4222–4226.

6 Kohno K, Normington K, Sambrook J, Gething M-J & Mori K (1993) The promoter region of the yeast KAR2 (BiP) gene contains a regulatory domain that responds to the presence of unfolded proteins in the endoplasmic reticulum. Mol Cell Biol 13, 877–890.

For pulse labeling of proteins, plant tissues cut from the roots were treated with or without TM for the indicated times, and then incubated in 1 mL of MS containing 50 lCi (1850 kBq) each of [35S]Met and [35S]Cys (NEN Life Science Products, Inc., Boston, MA) for 20 min at 25 (cid:1)C. The labeled plant tissues were rinsed with MS, frozen with liquid nitrogen, and then ground with an electrical homo- genizer, S-203, equipped with a spindle (Inouchi-Seieidou Ltd, Osaka, Japan). The disrupted sample was boiled for 2 min in SDS ⁄ PAGE buffer containing a 10% (v ⁄ v) cock- tail of protease inhibitors. Then, 35 lg of protein was sub- jected to SDS ⁄ PAGE. [35S]Met and [35S]Cys in the gel were detected by fluorography with Enlightning (NEN Life Sci- ence Products, Inc.).

7 Mori K, Ogawa N, Kawahara T, Yanagi H & Yura T (1998) Palindrome with a spacer of one nucleotide is characteristic of the cis-acting unfolded protein response element in Saccharomyces cerevisiae. J Biol Chem 273, 9912–9920.

Detection of phosphorylated Ser51 of eIF2a

8 Mori K, Sant A, Kohno K, Normington K, Gething

MJ & Sambrook JF (1992) A 22 bp cis-acting element is necessary and sufficient for the induction of the yeast KAR2 (BiP) gene by unfolded proteins. EMBO J 11, 2583–2593.

9 Travers KJ, Patil CK, Wodicka L, Lockhart DJ, Weiss- man JS & Walter P (2000) Functional and genomic

Plant tissues cut off from the roots were treated as des- cribed above with or without TM for the indicated times. Plant proteins (30 lg of proteins) were separated by SDS ⁄ PAGE and then blotted onto poly(vinylidene difluo- ride) membranes. Phosphorylated Ser51 of eIF2a was im- munostained with rabbit eIF2a phospho-specific polyclonal antibodies (Biosource International, Camarillo, CA).

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3473

analyses reveal essential coordination between the unfolded protein response and ER-associated degrada- tion. Cell 101, 249–258.

10 Mori K (2000) Tripartite management of unfolded pro- teins in the endoplasmic reticulum. Cell 101, 451–454.

11 Calfon M, Zeng H, Urano F, Till JH, Hubbard SR,

22 Harding HP, Zhang Y, Zeng H, Novoa I, Lu PD, Cal- fon M, Sadri N, Yun C, Popko B, Paules R, Stojdl DF, Bell JC, Hettmann T, Leiden JM & Ron D (2003) An integrated stress response regulates amino acid metabo- lism and resistance to oxidative stress. Mol Cell 11, 619–633.

23 Barbosa-Tessmann IP, Chen C, Zhong C, Schuster SM,

Harding HP, Clark SG & Ron D (2002) IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature 415, 92–96.

Nick HS & Kilberg MS (1999) Activation of the unfolded protein response pathway induces human asparagine synthetase gene expression. J Biol Chem 274, 31139–31144.

12 Tirasophon W, Welihinda AA & Kaufman RJ (1998) A stress response pathway from the endoplasmic reticulum to the nucleus requires a novel bifunctional protein kinase ⁄ endoribonuclease (Ire1p) in mammalian cells. Genes Dev 12, 1812–1824.

24 Bruhat A, Averous J, Carraro V, Zhong C, Reimold AM, Kilberg MS & Fafournoux P (2002) Differences in the molecular mechanisms involved in the transcriptional activation of the CHOP and asparagine synthetase genes in response to amino acid deprivation or activation of the unfolded protein response. J Biol Chem 277, 48107– 48114.

13 Yoshida H, Matsui T, Yamamoto A, Okada T & Mori K (2001) XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107, 881–891.

14 Lee AH, Iwakoshi NN & Glimcher LH (2003) XBP-1 regulates a subset of endoplasmic reticulum-resident chaperone genes in the unfolded protein response. Mol Cell Biol 23, 7448–7459.

15 Haze K, Yoshida H, Yanagi H, Yura T & Mori K

25 Koizumi N, Martı` nez IM, Kimata Y, Kohno K, Sano H & Chrispeels MJ (2001) Molecular characterization of two Arabidopsis Ire1 homologs, endoplasmic reticulum- located transmembrane protein kinases. Plant Physiol 127, 949–962.

(1999) Mammalian transcription factor ATF6 is synthe- sized as a transmembrane protein and activated by pro- teolysis in response to endoplasmic reticulum stress. Mol Biol Cell 10, 3787–3799.

26 Okushima Y, Koizumi N, Yamaguchi Y, Kimata Y, Kohno K & Sano H (2002) Isolation and character- ization of a putative transducer of endoplasmic reticu- lum stress in Oryza sativa. Plant Cell Physiol 43, 532– 539.

16 Okada T, Haze K, Nadanaka S, Yoshida H, Seidah NG, Hirano Y, Sato R, Negishi M & Mori K (2003) A serine protease inhibitor prevents endoplasmic reticulum stress- induced cleavage but not transport of the membrane- bound transcription factor ATF6. J Biol Chem 278, 31024–31032.

27 D’Amico L, Valsasina B, Daminati MG, Fabbrini MS, Nitti G, Bollini R, Ceriotti A & Vitale A (1992) Bean homologs of the mammalian glucose-regulated proteins: induction by tunicamycin and interaction with newly synthesized seed storage proteins in the endoplasmic reticulum. Plant J 2, 443–455.

28 Fontes EBP, Shank BB, Wrobel RL, Moose SPO,

17 Ye J, Rawson RB, Komuro R, Chen X, Dave´ UP, Prywes R, Brown MS & Goldstein JL (2000) ER stress induces cleavage of membrane-bound ATF6 by the same pro- teases that process SREBPs. Mol Cell 6, 1355–1364. 18 Haze K, Okada T, Yoshida H, Yanagi H, Yura T,

Brian GR, Wurtzel ET & Boston RS (1991) Characteri- zation of an immunoglobulin binding protein homolog in the maize floury-2 endosperm mutant. Plant Cell 3, 483–496.

Negishi M & Mori K (2001) Identification of the G13 (cAMP-response-element-binding protein-related pro- tein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response. Biochem J 355, 19–28. 19 Yoshida H, Okada T, Haze K, Yanagi H, Yura T,

29 Koizumi N, Ujino T, Sano H & Chrispeels MJ (1999) Overexpression of a gene that encodes the first enzyme in the biosynthesis of asparagine-linked glycans makes plants resistant to tunicamycin and obviates the tunica- mycin-induced unfolded protein response. Plant Physiol 121, 353–361.

30 Oliver SC, Venis MA, Freedman RB & Napier RM

(1995) Regulation of synthesis and turnover of maize auxin-binding protein, and observations on its passage to the plasma membrane: comparisons to maize immunoglobulin-binding protein cognate. Planta 197, 465–474.

Negishi M & Mori K (2000) ATF6 activated by proteo- lysis binds in the presence of NF-Y (CBF) directly to the cis-acting element responsible for the mammalian unfolded protein response. Mol Cell Biol 20, 6755–6767. 20 Harding HP, Zhang Y, Bertolotti A, Zeng H & Ron D (2000) Perk is essential for translational regulation and cell survival during the unfolded protein response. Mol Cell 5, 897–904.

21 Harding HP, Zhang Y & Ron D (1999) Protein transla- tion and folding are coupled by an endoplasmic-reticu- lum-resident kinase. Nature 397, 271–274.

31 Shank KJ, Su P, Brglez I, Boss WF, Dewey RE & Bos- ton RS (2001) Induction of lipid metabolic enzymes during the endoplasmic reticulum stress response in plants. Plant Physiol 126, 267–277.

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3474

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

44 Yoshida H, Okada T, Haze K, Yanagi H, Yura T,

32 Martı` nez IM & Chrispeels MJ (2003) Genomic analysis of the unfolded protein response in Arabidopsis shows its connection to important cellular processes. Plant Cell 15, 561–576.

Negishi M & Mori K (2001) Endoplasmic reticulum stress-induced formation of transcription factor complex ERSF including NF-Y (CBF), and activating transcrip- tion factors 6a and 6b that activates the mammalian unfolded protein response. Mol Cell Biol 21, 1239–1248.

33 Lee AS (1987) Coordinated regulation of a set of genes by glucose and calcium ionophores in mammalian cells. Trends Biochem Sci 12, 20–23.

45 Oh D-H, Kwon C-S, Sano H, Chung W-I & Koizumi N (2003) Conservation between animals and plants of the cis-acting element involved in the unfolded protein response. Biochem Biophys Res Commun 301, 225–230.

34 Bilgin DD, Liu Y, Schiff M & Dinesh-Kumar SP (2003) P58IPK, a plant ortholog of double-stranded RNA- dependent protein kinase PKR inhibitor, functions in viral pathogenesis. Dev Cell 4, 651–661.

35 Bolduc N, Ouellet M, Pitre F & Brisson LF (2003)

46 Bays NW, Gardner RG, Seelig LP, Joazeiro CA & Hampton RY (2001) Hrd1p ⁄ Der3p is a membrane- anchored ubiquitin ligase required for ER-associated degradation. Nat Cell Biol 3, 24–29.

Molecular characterization of two plant BI-1 homolo- gues which suppress Bax-induced apoptosis in human 293 cells. Planta 216, 377–386.

36 Kawai-Yamada M, Jin L, Yoshinaga K, Hirata A &

47 Donoviel DB, Donoviel MS, Fan E, Hadjantonakis A & Bernstein A (1998) Cloning and characterization of Sel-1l, a murine homolog of the C. elegans sel-1 gene. Mech Dev 78, 203–207.

Uchimiya H (2001) Mammalian Bax-induced plant cell death can be down-regulated by overexpression of Ara- bidopsis Bax Inhibitor-1 (AtBI-1). Proc Natl Acad Sci USA 98, 12295–12300.

37 Utsugi S, Sakamoto W, Murata M & Motoyoshi F

48 Harada Y, Ozaki K, Suzuki M, Fujiwara T, Takahashi E, Nakamura Y & Tanigami A (1999) Complete cDNA sequence and genomic organization of a human pan- creas-specific gene homologous to Caenorhabditis ele- gans Sel-1. J Hum Genet 44, 330–336.

(1998) Arabidopsis thaliana vegetative storage protein (VSP) genes: gene organization and tissue-specific expression. Plant Mol Biol 38, 565–576.

38 Utsugi S, Sakamoto W, Ogura Y, Murata M &

49 Nadav E, Shmueli A, Barr H, Gonen H, Ciechanover A & Reiss Y (2003) A novel mammalian endoplasmic reti- culum ubiquitin ligase homologous to the yeast Hrd1. Biochem Biophys Res Commun 303, 91–97.

50 Lee TG, Tang N, Thompson S, Miller J & Katze

Motoyoshi F (1996) Isolation and characterization of cDNA clones corresponding to the genes expressed pre- ferentially in floral organs of Arabidopsis thaliana. Plant Mol Biol 32, 759–765.

MG (1994) The 58,000-dalton cellular inhibitor of the interferon-induced double-stranded RNA-activated protein kinase (PKR) is a member of the tetratrico- peptide repeat family of proteins. Mol Cell Biol 14, 2331–2342.

39 Lee K, Tirasophon W, Shen X, Michalak M, Prywes R, Okada T, Yoshida H, Mori K & Kaufman RJ (2002) IRE1-mediated unconventional mRNA splicing and S2P-mediated ATF6 cleavage merge to regulate XBP1 in signaling the unfolded protein response. Genes Dev 16, 452–466.

51 Yan W, Frank CL, Korth MJ, Sopher BL, Novoa I, Ron D & Katze MG (2002) Control of PERK eIF2a kinase activity by the endoplasmic reticulum stress- induced molecular chaperone P58IPK. Proc Natl Acad Sci USA 99, 15920–15925.

52 Melville MW, Hansen WJ, Freeman BC, Welch WJ &

40 Wang Y, Shen J, Arenzana N, Tirasophon W, Kaufman RJ & Prywes R (2000) Activation of ATF6 and an ATF6 DNA binding site by the endoplasmic reticulum stress response. J Biol Chem 275, 27013–27020. 41 Yoshida H, Haze K, Yanagi H, Yura T & Mori K

Katze MG (1997) The molecular chaperone hsp40 regu- lates the activity of P58IPK, the cellular inhibitor of PKR. Proc Natl Acad Sci USA 94, 97–102.

(1998) Identification of the cis-acting endoplasmic reti- culum stress response element responsible for transcrip- tional induction of mammalian glucose-regulated proteins. Involvement of basic leucine zipper transcrip- tion factors. J Biol Chem 273, 33741–33749.

42 Kokame K, Kato H & Miyata T (2001) Identification

53 van Huizen R, Martindale JL, Gorospe M & Holbrook NJ (2003) P58IPK, a novel endoplasmic reticulum stress- inducible protein and potential negative regulator of eIF2a signaling. J Biol Chem 278, 15558–15564.

of ERSE-II, a new cis-acting element responsible for the ATF6-dependent mammalian unfolded protein response. J Biol Chem 276, 9199–9205.

54 Noh S-J, Kwon CS, Oh D-H, Moon JS & Chung W-I (2003) Expression of an evolutionarily distinct novel BiP gene during the unfolded protein response in Arabi- dopsis thaliana. Gene 311, 81–91.

55 Mira H, Martı` nez N & Pen˜ arrubia L (2002) Expression of a vegetative-storage-protein gene from Arabidopsis is regulated by copper, senescence and ozone. Planta 214, 939–946.

43 Li M, Baumeister P, Roy B, Phan T, Foti D, Luo S & Lee AS (2000) ATF6 as a transcription activator of the endoplasmic reticulum stress element: thapsigargin stress-induced changes and synergistic interactions with NF-Y and YY1. Mol Cell Biol 20, 5096–5106.

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3475

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

56 Gilbert HF (1998) Protein disulfide isomerase. Methods

Enzymol 290, 26–50.

57 Wetterau JR, Combs KA, Spinner SN & Joiner BJ

68 Vattem KM & Wek RC (2004) Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells. Proc Natl Acad Sci USA 101, 11269– 11274.

(1990) Protein disulfide isomerase is a component of the microsomal triglyceride transfer protein complex. J Biol Chem 265, 9800–9807.

69 Zuppini A, Navazio L & Mariani P (2004) Endoplasmic reticulum stress-induced programmed cell death in soy- bean cells. J Cell Sci 117, 2591–2598.

58 Tasanen K, Parkkonen T, Chow LT, Kivirikko KI & Pihlajaniemi T (1988) Characterization of the human gene for a polypeptide that acts both as the b subunit of prolyl 4-hydroxylase and as protein disulfide isom- erase. J Biol Chem 263, 16218–16224.

70 Chae H-J, Kim H-R, Xu C, Bailly-Maitre B, Krajewska M, Krajewski S, Banares S, Cui J, Digicaylioglu M, Ke N et al. (2004) BI-1 regulates an apoptosis pathway linked to endoplasmic reticulum stress. Mol Cell 15, 355–366.

59 Oliver JD, van der Wal FJ, Bulleid NJ & High S (1997) Interaction of the thiol-dependent reductase ERp57 with nascent glycoproteins. Science 275, 86–88.

71 Hu¨ ckelhoven R, Dechert C & Kogel K-H (2003) Over- expression of barley BAX inhibitor 1 induces break- down of mlo-mediated penetration resistance to Blumeria graminis. Proc Natl Acad Sci USA 100, 5555– 5560.

60 Urade R, Okudo H, Kato H, Moriyama T & Arakaki Y (2004) ER-60 domains responsible for interaction with calnexin and calreticulin. Biochemistry 43, 8858–8868. 61 Zapun A, Darby NJ, Tessier DC, Michalak M, Berger- on JJ & Thomas DY (1998) Enhanced catalysis of ribo- nuclease B folding by the interaction of calnexin or calreticulin with ERp57. J Biol Chem 273, 6009–6012. 62 Romano PG, Horton P & Gray JE (2004) The Arabi-

72 Matsumura H, Nirasawa S, Kiba A, Urasaki N, Saitoh H, Ito M, Kawai-Yamada M, Uchimiya H & Terauchi R (2003) Overexpression of Bax inhibitor suppresses the fungal elicitor-induced cell death in rice (Oryza sativa l) cells. Plant J 33, 425–434.

73 Murashige T & Skoog F (1962) A revised medium for

dopsis cyclophilin gene family. Plant Physiol 134, 1268– 1282.

rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15, 473–497.

63 Pilon M, Schekman R & Ro¨ misch K (1997) Sec61p

mediates export of a misfolded secretory protein from the endoplasmic reticulum to the cytosol for degrada- tion. EMBO J 16, 4540–4548.

74 Brenner S, Williams SR, Vermaas EH, Storck T, Moon K, McCollum C, Mao J-I, Luo S, Kirchner JJ, Eletr S et al. (2000) In vitro cloning of complex mixtures of DNA on microbeads: physical separation of differen- tially expressed cDNAs. Proc Natl Acad Sci USA 97, 1665–1670.

64 Brandizzi F, Hanton S, DaSilva LL, Boevink P, Evans D, Oparka K, Denecke J & Hawes C (2003) ER quality control can lead to retrograde transport from the ER lumen to the cytosol and the nucleoplasm in plants. Plant J 34, 269–281.

75 Sambrook J & Russell D (2001) Molecular Cloning: a Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

76 Laemmli UK (1970) Cleavage of structural proteins

65 Knop M, Finger A, Braun T, Hellmuth K & Wolf DH (1996) Der1, a novel protein specifically required for endoplasmic reticulum degradation in yeast. EMBO J 15, 753–763.

during the assembly of the head of bacteriophage T4. Nature 227, 680–685.

66 Gardner RG, Swarbrick GM, Bays NW, Cronin SR,

S. Kamauchi et al. Unfolded protein response genes in Arabidopsis

Supplementary material

Wilhovsky S, Seelig L, Kim C & Hampton RY (2000) Endoplasmic reticulum degradation requires lumen to cytosol signaling: Transmembrane control of Hrd1p by Hrd3p. J Cell Biol 151, 69–82.

The following supplementary material for this article is available online: Table S1. Up-regulated genes selected for functional DNA microarray analysis. Table S2. List of singlet genes identified on fluid microarray analysis.

67 Hinnebusch AG (2000) Mechanism and regulation of initiator methionyl-tRNA binding to ribosomes. In Translational Control of Gene Expression (Sonenberg N Hershey JWB & Mathews M, eds), pp. 185–244. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS

3476