intTypePromotion=1

BÁO CÁO KHOA HỌC : MỐI QUAN HỆ GIỮA GEN HORMONE SINH TRƯỞNG VỚI TĂNG KHỐI LƯỢNG Ở LỢN MÓNG CÁI LAI

Chia sẻ: Nguyen Nhi | Ngày: | Loại File: PDF | Số trang:8

0
94
lượt xem
6
download

BÁO CÁO KHOA HỌC : MỐI QUAN HỆ GIỮA GEN HORMONE SINH TRƯỞNG VỚI TĂNG KHỐI LƯỢNG Ở LỢN MÓNG CÁI LAI

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Lợn Móng Cái (MC) là giống lợn nội được nuôi phổ biến nhất vùng đồng bằng Bắc Bộ nhờ những đặc tính tốt như: dễ nuôi, thành thục sớm, mắn đẻ, khả năng chống chịu bệnh cao, chủ yếu được sử dụng làm nái nền, lai với lợn đực nhập nội cao sản Landrace, Yorkshire (Y), Large White, Duroc, Piétrain... tạo các tổ hợp lai nuôi thịt nhằm nâng cao hiệu quả, góp phần đưa năng xuất, chất lượng đàn lợn nước ta ngày một tăng lên....

Chủ đề:
Lưu

Nội dung Text: BÁO CÁO KHOA HỌC : MỐI QUAN HỆ GIỮA GEN HORMONE SINH TRƯỞNG VỚI TĂNG KHỐI LƯỢNG Ở LỢN MÓNG CÁI LAI

  1. NGUYỄN VÂN ANH – Mối quan hệ giữa gen Hormone sinh trưởng và tăng khối lượng ở lợn … MỐI QUAN HỆ GIỮA GEN HORMONE SINH TRƯỞNG VỚI TĂNG KHỐI LƯỢNG Ở LỢN MÓNG CÁI LAI Nguyễn Vân Anh1*, Nguyễn Văn Cường2 và Nguyễn Văn Đức3 1 Đại học Sư phạm Thái Nguyên 2 Viện Công nghệ Sinh học – Viện Khoa học và Công nghệ Việt Nam 3 Viện Chăn nuôi, Bộ Nông nghiệp và PTNT *Tác giả liên hệ: Nguyễn Vân Anh - Đại học Sư phạm Thái Nguyên Tel: 0983.140.875 ; Email: nvananh1979@ gmail.com ABSTRACT Relationship between growth hormone gene and average daily gain of Mong Cai crossbred pigs The indigenous pig breed of Mong Cai (MC) has the high reproductive performance, but their growth rate is limited. The average daily gain (ADG) of Y pigs was 816.6614.34g/day, ADG of MC was 407,409,86g/day, while ADG of F1(YxMC) was 665,7429,83g/day and ADG of F2(YxMC) was 670,8331,45g/day. The role of growth hormone (GH) gene on performance traits such as growth rate (GR) has been confirmed in some pig breeds. Higher exogenous porcine GH concentration causes higher muscle mass and improves feed conversion rate (FCR) and ADG. In this paper, genetic variation of GH in MC pigs was studied using PCR- RFLP and association of their genotypes and ADG trait. Specific primer pairs, 605 bp DNA fragments of GH have been amplified. Digestion of GH with HhaI revealed point mutation at two position of +329 and +378. Genotype frequencies were 16.96%, 50.90% and 32.14% for C2C2, C2C4 and C4C4, respectively. Relationship between genotypes and ADG has been analyzed by using t’-test in MC crossbred pigs. The result showed there was no significance in ADG between animals carrying C2 allele (C2C2 and C2C4 genotype) and that no C2 allele (C4C4 genotype) was found in MCTH pigs. However, a significant difference between animals carrying C2 allele (C2C2 and C2C4 genotype) and animals without C2 allele (C4C4 genotype) in F2 (YxMC) and (YxMC) was observed (with  = 0,025). Keywords: MC crossbreds, relationship between ADG and GH, GH gene, ADG ĐẶT VẤN ĐỀ Lợn Móng Cái (MC) là giống lợn nội đ ược nuôi phổ biến nhất vùng đ ồng bằng Bắc Bộ nhờ những đặc tính tốt như: dễ nuôi, thành thục sớm, mắn đẻ, khả năng chống chịu bệnh cao, chủ yếu được sử dụng làm nái nền, lai với lợn đực nhập nội cao sản Landrace, Yorkshire (Y), Large White, Duroc, Piétrain... tạo các tổ hợp lai nuôi thịt nhằm nâng cao hiệu quả, góp phần đ ưa năng xu ất, chất lượng đ àn lợn nước ta ngày m ột tăng lên. Song, tăng khối lượng (TKL) của lợn MC rất thấp, chỉ biến động trong phạm vi 333-380 g/ngày, ngo ại trừ nhóm lợn MC cao sản MC15 và lợn MC tổng hợp (MCTH) mới được tạo chọn ra cũng chỉ đạt tới 400-410 g/ngày. Vì vậy, việc nghiên cứu xác định kiểu gen tác động đ ến khả năng sinh trưởng để giúp cho chọn lọc nhằm tăng nhanh TKL là một yêu cầu rất cấp thiết trong ngành chăn nuôi lợn ở nước ta, nhất là đối với giống MC. Các ứng cử gen liên quan đến tính trạng sinh trưởng và sản lượng thịt ở lợn đã được tiến hành nghiên cứu khá phong phú trên thế giới như hormone sinh trưởng (GH) bởi Knorr và cs (1997), Pierzchala và cs (2004); Artur và cs (2007); PIT1 bởi Yu và cs (1995); Franco và cs (2005), IGF-1 bởi Casas-Carrillo và cs (1997), Leptin (LEP) bởi Hardge (1998); Urban và cs (2002). Gen GH đ ịnh vị ở vai ngắn (p1.2  p1.5) của nhiễm sắc thể số 12 ở lợn (Yerle và cs, 1993), b ao gồm 5 exon với tổng chiều d ài phiên mã là 1,7kb (Vize và Wells, 1997). Kết quả nghiên 73
  2. VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi - Số 22-Tháng 2 - 2010 cứu của Nielsen và cs (1995) gợi ý rằng sự khác nhau trong hoạt tính sao chép giữa các biến thể gen GH làm cho hàm lượng GH trong huyết thanh cao hơn và tăng khối lượng lớn hơn. Mối tương quan giữa kiểu gen GH với một số tính trạng kinh tế như: độ dày mỡ lưng, t ỷ lệ nạc và khả năng tăng khối lượng đã được xác nhận ở thế hệ con lai giữa lợn Meishan và Piétrain (Knorr và cs, 1997), lợn Duroc, Yorkshire, TaoYoan (Cheng và cs, 2000). Nhiều nghiên cứu về đa hình gen liên quan đ ến tính trạng tăng khối lượng (TKL) ở các giống lợn đã được tiến hành ở Việt Nam như Đa hình di truyền gen Hormone sinh trưởng (GH) ở giống lợn MC (Nguyễn Thị Diệu Thúy và cs, 2004), đa hình di truyền gen Myogenin ở lợn giống MC (Nguyễn Vân Anh và cs, 2005). Để được góp phần vào việc xác định mối tương quan di truyền giữa kiểu gen GH với tính trạng TKL ở lợn đực giống Yorkshire (Y), lợn nái giống MCTH và nhóm lợn MC lai (F1 và F2), chúng tôi tiến hành đ ề tài “Xác định mối quan hệ giữa kiểu gen Hormone sinh trưởng với tính trạng tăng khối lượng ở lợn Móng Cái lai”. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN C ỨU Vật liệu nghiên cứu Bảng 1. Sơ đồ đ àn lợn thí nghiệm Thế Lợn giống Lợn vỗ b éo Tổng hệ (Con) Lợn đực Lợn nái Lợn đực Lợn cái F0 1Y 6 MCTH 2 Y, 6 MCTH 2 Y, 6 MCTH 23 F1 1 F1(Yx MCTH) 12 F1(Yx MCTH) 12 F1(Yx MCTH) 12 F1(Yx MCTH) 37 F2 36 F2(Yx MCTH) 36 F2(Yx MCTH) 72 ∑ 2 18 56 56 132 Tổng số 132 lợn thí nghiệm (Bảng 1), trong đó: đ àn lợn tham gia tạo giống gồm 1 đực giống Yorkshine (Y), 6 nái MCTH, 1 đ ực giống F1(Yx MCTH), 12 nái F1(Yx MCTH) và đ àn lợn vỗ b éo là 112 con, gồm 4 Y, 12 MCTH, 24 F1(Yx MCTH) và 72 F2(YxMCTH) với tỷ lệ đực cái là 50/50. Lợn thí nghiệm được tạo ra và nuôi dưỡng theo đúng các qui trình chăn nuôi lợn giống đực Y, nái MC và lợn vỗ béo Y, MCTH và lợn lai (ngoại x nội) F1(Yx MCTH), F2(Yx MCTH) theo quy trình nuôi vỗ béo tại các nông hộ thuộc các gia trại nuôi lợn của ông Lê Mạnh Quý ở Huyện Bảo Thắng, tỉnh Lào Cai. Phương pháp nghiên cứu Sơ đồ tạo lợn thí nghiệm: 1 đực Y phối với 6 nái MCTH tạo đ àn F1(YxMCTH). Chọn 1 đực F1(YxMCTH) phối với 12 nái F1(YxMCTH) để tạo đàn F2(YxMCTH). Tính trạng sản xuất về TKL được xác định bằng cách cân lợn lúc bắt đầu vào vố béo (75 ngày tuổi) và kết thúc vỗ béo. Thời gian vỗ béo là 90 ngày. Mẫu mô tai của các giống lợn được thu thập từ tháng 5/2007 đến tháng 5/2009. Mẫu đ ược bảo quản trong cồn 750 ở các lọ lấy mẫu. Mẫu được bảo quản ở -200C và sau đó được sử dụng để p hân tích các gen. ADN hệ gen đ ược tách từ mô qua bước thủy phân bằng Proteinase - K, làm sạch bằng Phenol, chloroform và tủa cồn (Asubel và cs, 1995). PCR được tiến hành với tổng thể tích 25 µl, bao 74
  3. NGUYỄN VÂN ANH – Mối quan hệ giữa gen Hormone sinh trưởng và tăng khối lượng ở lợn … gồm: 100 ng ADN tổng số; 10pM mồi xuôi và ngược; 0,2mM d NTP; 1,5mM MgCl2; 1U Taq polymerase và đ ệm PCR 10x. Trình tự mồi và độ lớn sản phẩm PCR trình bày ở Bảng 2. Bảng 2. Trình tự mồi và độ lớn sản phẩm PCR Tên mồi Trình tự mồi* Độ lớn sản phẩm PCR (bp) GH F: 5’-TTATCCATTAGCAACTGCCTGCCAG - 3’ 605 R: 5’- CTGGGGAGCTTACAAACTCCTT - 3’ *F: Mồi xuôi; R: Mồi ngược Chu trình nhiệt phản ứng PCR Gồm các giai đoạn Biến tính to àn bộ 940C trong 3 phút, phản ứng lặp lại 35 chu kỳ các bước: biến tính cục bộ 940C trong 45 giây, bám mồi 620C trong 1 phút; tổng hợp ở 720C trong 1 phút; hoàn thành p hản ứng tổng hợp ở 72 0C trong 10 phút và giữ mẫu ở 4 0C. Phản ứng cắt sản phẩm PCR-GH bằng enzyme hạn chế HhaI gồm các thành phần sau: 2,5µl đ ệm cắt, 20µl sản phẩm PCR, 1 µl (10 U) enzyme cắt và 1,5µl H2O. Hỗn hợp đ ược ủ qua đ êm ở 37 0C. Kết quả PCR và sản phẩm cắt enzyme hạn chế đ ược kiểm tra trên gel agarosse 2%, nhu ộm bằng Ethidium Bromide và phát hiện d ưới ánh sáng UV. Xử lý số liệu Số trung b ình bình phương nhỏ nhất (LSM) và Sai số chuẩn (SE) theo SAS (1993). Ưu thế lai đ ược xác đ ịnh theo công thức của Falconer và Mackay (1996). So sánh mức độ sai khác giữa các số trung b ình được xác định theo phương pháp Kiểm tra mức độ tin cậy số trung b ình mẫu (t) của Nguyễn Văn Đức và Lê Thanh Hải (2002). KẾT QUẢ VÀ THÁO LUẬN Tăng khối lượng của lợn Tăng khối lượng (TKL) của đàn lợn thí nghiệm tại Bảo Thắng, Lào Cai được xác định là cao: Cao nhất là giống lợn Yorkshire (816,6614,34 g/ngày và thấp nhất ở lợn MCTH, nhưng cũng đ ã đạt tới 407,409,86 g/ngày. Trong lúc đó, hai nhóm lợn MC lai F1(YxMCTH) là 665,7429,83 g/ngày và F2(YxMCTH) là 670,83 31,45g/ngày. Sự sai khác về TKL giữa các nhóm lợn có ý nghĩa thống kê rõ rệt, ngoại trừ giữa hai nhóm lợn MC lai F1(YxMCTH) và F2(YxMCTH) (p>0,05). Đối với nhóm lợn MCTH, TKL ở nghiên cứu này cao hơn kết qu ả công bố của Nguyễn Văn Đức và cs (2007); Giang Hồng Tuyến và cs (2006); Giang Hồng Tuyến (2008); Giang Hồng Tuyến và cs (2008) trên nhóm lợn MC15 và MCTH nuôi tại Hải Phòng và Lào Cai (Nguyễn Văn Đức và cs, 2009). Đối với giống lợn Y và nhóm lợn MC lai, TKL trong nghiên cứu này cao hơn kết quả công bố của Nguyễn Văn Đức (1997); Nguyễn Văn Đức (1999); Nguyễn Văn Đức (2001); Nguyễn Văn Đức và cs (2001) trên giống lợn Y, MC, MC lai F1(LRxMC) và F1(YxMC), đồng thời cao hơn nhóm lợn lai F1(PixMC) nuôi tại Đông Anh, Hà Nội (Trần Thị Minh Hoàng và cs, 2003). Kết quả này thấp hơn so với lợn lai Dx(Y  MC) và Lx(Y  MC) là 673,60 và 679,48 g/ngày (Đặng Vũ Bình và cs, 2008). 75
  4. VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi - Số 22-Tháng 2 - 2010 Phân tích PCR-RFLP gen GH bằng enzyme Hha I Kết quả nhân đo ạn gen GH bằng PCR được trình bày ở hình 1. Sản phẩm PCR là một băng rõ nét, có kích thước tương ứng là 605 bp đã đ ược nhân đặc hiệu. 1 2 3 4 5 6 7 8 M M 1 2 3 4 5 498 600 500 605 449 500 300 107 100 49 Hình 1. Sản phẩm PCR đoạn gen GH Hình 2. Kết quả cắt đoạn gen GH bằng Hha I M: Thang ADN chuẩn 100 bp M: Thang ADN chuẩn 100 bp 1-5: Sản phẩm PCR 1,7: Kiểu gen C4C4; 2,3,4: Kiểu gen C2C4; 5,6,8: Kiểu gen C2C2 Sản phẩm PCR của đoạn gen GH được cắt bởi enzyme Hha I. Vị trí cắt của enzyme cắt, độ dài đoạn cắt được trình bày ở Bảng 3. Đoạn gen GH này chứa 2 điểm đột biến tại vị trí +329 và +378, vì thế khi HhaI cắt tại các vị trí trên sẽ tạo ra các đoạn ADN có kích thước phân tử tương ứng 49, 107, 156, 449, 498 bp. Trường hợp không có đột biến nào tại 2 vị trí trên thì đoạn ADN sẽ không bị cắt nên sản phẩm cắt sẽ là đoạn ADN có kích thước 605 bp. Bảng 3. Điểm cắt của enzyme cắt hạn chế và độ dài đoạn cắt gen GH Vị trí cắt Số điểm cắt Độ d ài đo ạn cắt (bp) Allele C1 - 0 605 C2 +378 1 498/107 C3 +329 1 449/156 C4 +378, +329 2 449/107/49 Đo ạn gen GH bị cắt b ởi HhaI tạo ra 4 dạng alen C1, C2, C3, C4. Như vậy, tổ hợp của chúng sẽ có 10 kiểu gen như: C1C1, C2C2, C3C3, C4C4, C1C2, C1C3, C1C4, C2C3, C2C4, C3C4. Ảnh điện di (hình 2) cho thấy, các đoạn ADN có kích thước khác nhau phù hợp với tính toán lý thuyết. Cả 3 dạng kiểu gen xuất hiện với tần số khác nhau trong các mẫu nghiên cứu. Trong nghiên cứu này, gen GH ở giống lợn Y, MCTH và MC lai chỉ xuất hiện 2 dạng alen C2 và C4, đồng thời tạo ra 3 tổ hợp kiểu gen C2C2, C2C4 và C4C4 với tần số lần lượt là 1 6,96%; 50,90%; 32,14%. Kết quả này của chúng tôi phù hợp với kết quả khảo sát tần số alen của gen GH ở lợn MC trong nghiên cứu trước đây của Nguyễn Thị Diệu Thúy và cộng sự (2004), trong đó kiểu gen C2C2 chiếm tỷ lệ thấp nhất, chỉ có 11% và cao nhất là C2C4, với 51%. 76
  5. NGUYỄN VÂN ANH – Mối quan hệ giữa gen Hormone sinh trưởng và tăng khối lượng ở lợn … Trong khi đó, kiểu alen C1 và C3 lại xuất hiện ở các nhóm lợn Wild Boar x Piétrain với tỷ lệ kiểu gen C2C4, C3C4 và C4C4 tương ứng là 0,34%; 28,42% và 68,84%; còn ở lợn lai Meishan x Piétrain có kiểu gen là C1C4, C2C4, C3C4 và C4C4 tương ứng là 15,49%; 29,36%; 5,48% và 15,8% (Knorr và cs, 1997). Bảng 4. Tần số kiểu gen của gen GH trên đàn lợn vỗ béo Kiểu gen Thế hệ n C2C2 C2C4 C4C4 Số lượng Số lượng Số lượng % % % F0(Y) 4 0 0 3 75,00 1 25,00 F0(MCTH) 12 4 33,33 6 50,00 2 16,67 F1 24 4 16,67 12 50,00 8 33,33 F2 72 11 15,28 35 48,61 26 36,11 112 19 16,96 57 50,90 36 32,14  Mối quan hệ giữa kiểu gen Hormone sinh trưởng và tăng khối lượng Phương pháp so sánh ANOVA là phương pháp kiểm tra thống kê thường được sử dụng để so sánh các giá trị trung bình trên nhiều nhóm mẫu. Trong nghiên cứu này, chúng tôi sử dụng p hép phân tích ANOVA một nhân tố để phân tích so sánh sự khác biệt giữa tăng khối lượng trung bình của đàn lợn khi mang 3 kiểu gen C2C2, C2C4 và C4C4. Kết quả nghiên cứu của chúng tôi về TKL trung bình của 3 kiểu gen C2C2, C2C4 và C4C4 trên đàn lợn Y, MCTH và MC lai F1(YxMCTH) và F2(YxMCTH) nuôi tại Bảo Thắng, Lào Cai được trình bày tại Bảng 5. Bảng 5. Quan hệ giữa kiểu gen Hormone sinh trưởng và tăng khối lượng của đ àn lợn vỗ béo Thế Kiểu Độ lệch Sai số Giá trị Giá trị P Giá trị TKL n=112 hệ trung bình chu ẩn (SD) chu ẩn (SE) gen F F0,05 C4C4 800,00 - - 2162,82 0,00046 19 1 F0 (Y) 3 C2C4 822,22 11,11 6,41 0 C2C2 - - - C4C4 394,44 7,85 5,55 8,500 0,00844 4,25 2 F0 6 C2C4 405,55 6,08 2,48 (MCTH) 4 C2C2 416,66 6,41 3,20 C4C4 636,11 5,14 1,81 43,07 3,69E-08 3,46 8 12 F1 C2C4 669,44 18,42 5,31 4 C2C2 713,88 5,55 2,77 C4C4 640,59 12,93 2,52 93,73 2,12E-20 3,12 26 35 F2 C2C4 678,09 19,89 3,36 11 C2C2 719,19 11,21 3,38 Bảng 5 cho thấy ở lợn trong thí nghiệm này, kiểu gen liên quan với tính trạng TKL trong từng giống: Lợn mang kiểu gen C2C2 có TKL cao nhất: không xuất hiện ở lợn Y, 416,66 g/ngày ở lợn MCTH, 713,88 g/ngày ở lợn F1 và 719,19 g/ngày ở lợn F2; trong lúc đó, lợn mang kiểu gen C4C4 có TKL thấp nhất, đó là 800 g/ngày ở lợn Y, 394,44 g/ngày ở lợn MCTH, 636,11 g/ngày ở lợn F1 và 640,59 g/ngày ở lợn F2; lợn mang kiểu gen dị hợp tử C2C4 có TKL trung b ình giữa 2 kiểu gen đồng hợp tử: 822,22 g/ngày ở lợn Y, 405,55 g/ngà y ở lợn MCTH, 669,44 g/ngày ở lợn F1 và 678,43 g/ngày ở lợn F2. Như vậy, những cá thể lợn mang kiểu gen C2C2 cho TKL cao và những cá thể lợn mang kiểu gen C4C4 có TKL thấp cho phép chúng ta sử 77
  6. VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi - Số 22-Tháng 2 - 2010 dụng các kiểu gen này đ ể chọn lọc lợn ngay từ sơ sinh đ ể có thể nâng cao khả năng TKL nhằm góp phần nâng cao hiệu quả kinh tế trong chăn nuôi lợn thịt. Giá trị F thí nghiệm đều lớn hơn so với F0,05 hay các giá tr ị P tính đ ược đều nhỏ hơn rất nhiều 0,05. Như vậy, sự khác nhau về TKL giữa 3 kiểu gen trên là có ý nghĩa rất rõ rệt về mặt thống kê. Vì số lượng cá thể mang kiểu gen đồng hợp tử (C2C2) xuất hiện trong nghiên cứu với tần số thấp nên chúng tôi gộp với kiểu gen C2C4 thành một nhóm, đồng thời sử dụng phép kiểm tra t giả (t’-Test), với phép kiểm tra sử dụng đường cong chuẩn cả 2 chiều (t-Test: Two Sample Assuming unequal Variances) để kiểm tra sự khác biệt của tính trạng kiểu hình giữa nhóm mang alen C2 (kiểu gen C2C2 và C2C4) và nhóm không mang alen C2 (kiểu gen C4C4). Kết quả cụ thể được trình bày ở Bảng 6. Bảng 6. Kết quả kiểm tra t’ Chỉ tiêu Y MCTH F1 F2 C2C2/ C2C2/ C2C2/ C2C4 C4C4 C4C4 C4C4 C2C4 C4C4 C2C4 C2C4 TKL 822,22 800,00 409,99 394,44 680,55 636,11 687,92 640,59 Phuơng sai mẫu - - 67,21 61,72 650,20 26,45 641,01 167,33 Kích thước mẫu 3 1 10 2 16 8 46 26 Độ tự do 0 1 17 69 t Stat - 2,53 6,70 10,48 P(Tt-Start= 2,53 của nhóm MCTH cho thấy sự khác nhau về TKL trung bình giữa 2 nhóm mang alen C2 và không mang alen C2 không biểu hiện sự sai khác rõ rệt về mặt thống kê sinh học (p = 0,23). Ở lợn lai F1 và F2 do t’
  7. NGUYỄN VÂN ANH – Mối quan hệ giữa gen Hormone sinh trưởng và tăng khối lượng ở lợn … Kết quả so sánh ANOVA một yếu tố cho thấy sự khác nhau có ý nghĩa thống kê về tính trạng TKL giữa 3 kiểu gen C2C2, C2C4, C4C4 của lợn Y, MCTH và MC lai: F1(YxMCTH), F2(YxMCTH) với mức ý nghĩa p
  8. VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi - Số 22-Tháng 2 - 2010 Nielsen V.H., N.J. Larsen and N. Ageegaard (1995). “Association of DNA -polymorphism in the growth hormone gene with basal-plasma growth-hormone concentration and production traits in pigs”.J.Anim.Breed.Genet.112: p.205-212. Pierzchala M.,. Blicharski T and Kuryl J (2004). ”Growth race and carcass qualyti in relation to GH/MspI and GH/HaeII PCR-RFLP polymorphism in pigs”. Anim. sci. Pap. Rep. 22: p.57-64. Polonca Frajman. V.margeta and Gordana Kralic (2008). “Candidate genes for slaughter traits in pigs”. Krmiva 50. Zagreb 5: p.267-273. Nguyễn Thị Diệu Thúy, Nguyễn Thu Thúy và Nguyễn Văn Cường (2004). “Đa hình di truyền gen hormone sinh trưởng ở lợn Móng Cái”. Tạp chí Công nghệ Sinh học 2 (1) : p.19-24. Giang Hồng Tuyến, Nguyễn Văn Đức và Đinh Văn Chỉnh (2006). “Xác định tuổi giết thịt thích hợp đối với giống lợn Móng Cái F1 (Pi x MC) và F1(LWx MC)”. Tạp chí Chăn nuôi. 8: p. 4 -6. Giang Hồng Tuyến, Nguyễn Văn Đức và Đinh Văn Chỉnh (2008). “Năng suất sinh sản của nhóm lợn MC3000 và khả năng sản xuất của nhóm lợn MC15 qua 4 thế hệ chọn lọc Tạp chí KHCN Chăn nuôi. 11: p.15-19. Giang Hồng Tuyến (2008). Nghiên cứu chọn lọc nâng cao tính trạng số con sơ sinh sống/ổ đối với nhóm lợn MC3000. khả năng tăng khối lượng và tỷ lệ nạc đối với nhóm lợn MC15. Luận án TS. Nông nghiệp. Viện Chăn nuôi. Urban T; Kucienl J and Mikolásová (2002). “Polymorphism of genes encoding for Ryanodine receptor. growth hormone. leptin and MYC protooncogene protein and meat production in Duroc pigs”. J Anim. Sci. 47 (10): p.411-417. Vize P.D., Wells J.R.E (1997). “Isolation and characterization of the porcine growth hormone gene”. Gene 55: p.339-344. Yerle. M., Y. Lahbib-Mansai., P.D. Thomsen and J. Gellin (1993). “Location of porcine growth hormone gene to chromosome 12p1.2p1.5”. Anim. Genet. 24: p.129-131. Yu. TP.,. Tuggle C.K., Schmitz C.B and Rothschild M.F (1995). “Association of PIT1 polymorphisms with growth and carcass traits in pigs”. Journal of Animal Science. 73: p.1282-1288. *Người phản biện: TS. Trần Xuân Hoàn; TS.Phạm Doãn Lân Lời cảm ơn Công trình có sự hỗ trợ của Chủ nhiệm đề t ài trọng điểm cấp Bộ “Nghiên cứu tạo một số dòng lợn đặc trưng và xây dựng ch ương trình lai hiệu quả, phù hợp với điều kiện chăn nuôi khác nhau” Nguyễn Thị Viễn, Viện KHKT Nông nghiệp miền Nam; Bộ môn Di truyền Giống vật nuôi, Viện Chăn nuôi; Công ty Cổ phần Đầu t ư và PT Nông nghiệp Hải Phòng và Gia trại nuôi lợn của ông: Lê Mạnh Quý ở Bảo Thắng - Lào Cai. Nhóm tác giả xin được chân thành cám ơn các quý cơ quan, gia trại và cá nhân đã giúp đỡ. T¹p chÝ khoa häc c«ng nghÖ ch¨n nu«i , lµ c¬ quan ng«n luËn cña ViÖn ch¨n nu«i, trùc thuéc Bé N«ng nghiÖp vµ ph¸t triÓn n«ng th«n. Tõ th¸ng 8 n¨m 2006 ®· ra m¾t b¹n ®äc s è ®Çu tiªn vµ tiÕp tôc xuÊt b¶n th­êng kú 6 sè/n¨m. C¸c Tin bµi vµ ¶nh ®­îc ®¨ng trªn t¹p chÝ lµ nh÷ng c«ng tr×nh nghiªn cøu khoa häc, nh÷ng bµi viÕt trong lÜnh vùc ch¨n nu«i. chóng t«i rÊt mong nhËn ®­îc sù quan t©m, céng t¸c, ñng hé, gióp ®ì cña ®éc gi ¶ trong vµ ngoµi n­íc. t õ quý III/2009 t¹p chÝ ®­îc ph¸t hµnh qua c¸c b­u côc ®Þa ph­¬ng trong toµn quèc Trô së: ViÖn Ch¨n nu«i, Thôy Ph­¬ng - Tõ Liªm - Hµ Néi; §iÖn tho¹i: 04.37571453; Fax: 04.38389775; Email: kcc.vcn@gmail.com; Website: http//www.vcn.vnn.vn; Sè l­îng - 500 cuèn. In t¹i Nhµ xuÊt b¶n N«ng nghiÖp-Hµ Néi; sè 22/th¸ng 3-2010 - Nép l­u chiÓu th¸ng 3/2010 Gi¸ b¸n: 15.000®/cuèn 80
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2