Regulation of tristetraprolin during differentiation of 3T3-L1 preadipocytes Nien-Yi Lin1, Chung-Tien Lin1, Yu-Ling Chen2 and Ching-Jin Chang2,3
1 Department and Graduate Institute of Veterinary Medicine, College of Bio-Resources and Agriculture, National Taiwan University, Taipei,
Taiwan
2 Graduate Institute of Biochemical Sciences, College of Life Science, National Taiwan University, Taipei, Taiwan 3 Institute of Biological Chemistry, Academia Sinica, Taipei, Taiwan
Keywords AU-rich element; differentiation; mRNA degradation; 3T3-L1; tristetraprolin
Correspondence C.-J. Chang, Institute of Biological Chemistry, Academia Sinica, and Graduate Institute of Biochemical Sciences, National Taiwan University, No. 1 Sec. 4 Roosevelt Road, Taipei 106, Taiwan Fax: +886 2 23635038 Tel: +886 2 23620261 ext. 4131 E-mail: chingjin@gate.sinica.edu.tw C.-T. Lin, Department and Graduate Institute of Veterinary Medicine, College of Bio- resources and Agriculture, National Taiwan University, No. 1, Section 4, Roosevelt Road, Taipei 106, Taiwan Fax: +886 2 7359931 Tel: +886 2 7396828 ext. 2010 E-mail: ctlin@ntu.edu.tw
Tristetraprolin is a zinc-finger-containing RNA-binding protein. Tristetra- prolin binds to AU-rich elements of target mRNAs such as proto-onco- genes, cytokines and growth factors, and then induces mRNA rapid degradation. It was observed as an immediate-early gene that was induced in response to several kinds of stimulus, such as insulin and other growth factors and stimulators of innate immunity such as lipopolysaccharides. We observed that tristetraprolin was briefly expressed during a 1–8 h per- iod after induction of differentiation in 3T3-L1 preadipocytes. Detailed analysis showed that tristetraprolin mRNA expression was stimulated by fetal bovine serum and differentiation inducers, and was followed by rapid degradation. The 3¢UTR of tristetraprolin mRNAs contain adenine- and uridine-rich elements. Biochemical analyses using RNA pull-down, RNA immunoprecipitation and gel shift experiments demonstrated that adenine- and uridine-rich element-binding proteins, HuR and tristetraprolin itself, were associated with tristetraprolin adenine- and uridine-rich elements. Functional characterization confirmed that tristetraprolin negatively regula- ted its own expression. Thus, our results indicated that the tight autoregu- lation of tristetraprolin expression correlated with its critical functional role in 3T3-L1 differentiation.
(Received 6 November 2006, revised 6 December 2006, accepted 7 December 2006)
doi:10.1111/j.1742-4658.2007.05632.x
Post-transcriptional processes such as RNA splicing, turnover and translation, are and mRNA export, important mechanisms of gene regulation in mamma- lian cells. The mRNAs of many regulatory proteins, including proto-oncoproteins, cytokines and growth factors, bear adenine- and uridine-rich elements (AU- rich elements, or AREs) in their 3¢UTR in order to govern their half-life and translation rate [1–5]. AREs
vary in size, generally contain one or more copies of the pentameric sequence AUUUA, and have been divided into classes I, II, and III, according to their sequence characteristics [6]. To date, many ARE-bind- ing proteins have been shown to be involved in regulating mRNA turnover and translation in vivo, such as the ARE- and poly(U)-binding and degrada- tion factor AUF1 ⁄ hnRNP D [7], tristetraprolin (TTP)
Abbreviations ARE, adenine- and uridine-rich element; GST, glutathione-S-transferase; MDI, 1-methyl-3-isobutylmethylxanthine, dexamethasone and insulin; MIX, 1-methyl-3-isobutylmethylxanthine; REMSA, RNA electrophoretic mobility shift assay; TNF-a, tumor necrosis factor-a; TTP, tristetraprolin.
FEBS Journal 274 (2007) 867–878 ª 2007 The Authors Journal compilation ª 2007 FEBS
867
N.-Y. Lin et al.
Tristetraprolin regulation
repressor
the
embryonic
coordinately to cause terminal differentiation. C ⁄ EBPb, C ⁄ EBPd and ADD-1 ⁄ SREBP-1 are active early during the differentiation process [36,37]. These earlier events are followed by the accumulation of PPARc and C ⁄ EBPa, which causes cell division to stop [38,39]. This triggers the expression of adipocyte-specific genes, giving rise to the adipocyte phenotype and increased delivery of energy to the cells.
[14,15].
Recently, C ⁄ EBPb was reported to be a ligand for HuR, and the depletion of HuR by small interfering RNA (siRNA) attenuated the differentiation process in 3T3-L1 cells [40]. The other ARE-binding protein, TTP, was briefly induced in 3T3-L1 after adipogenic induction [24]. In the current study, we showed that TTP could be induced during 3T3-L1 differentiation and that its expression was controlled by negative autoregulation.
Results
TTP expression during 3T3-L1 differentiation
rapid degradation of
[22]
for
[8], HuR [9], and T-cell-restricted intracellular antigen 1 [10]. T-cell-restricted intracellular antigen 1 has been observed to act as a translational in response to environmental stress agents [11]. HuR is lethal a ubiquitous member of abnormal vision family of RNA-binding proteins [12]. Overexpression of HuR in transiently transfected mammalian cells can stabilize short-lived ARE-con- taining mRNAs [13] or can induce the translation silencing of In specific mRNA targets contrast, TTP is important for the destabilization of tumor necrosis factor-a (TNF-a) and granulocyte– macrophage colony-stimulating factor mRNAs, as shown in knockout mice [8,16] and in tissue culture by ectopic-overexpression studies [17]. TTP, also named G0S24, Nup475, TIS11, or Zfp36, is an RNA- binding protein containing two CCCH zinc fingers and three tetraproline motifs. It binds AREs of target mRNAs and induces deadenylation [17,18], or directs them to the exosome [19–21], or associates with the RNA-induced silencing complex (RISC)–microRNA target complexes mRNAs. It was observed as an immediate-early gene that was induced in response to several kinds of sti- mulus, such as growth factors and mitogens [23,24]. The serum-responsive elements have been identified in the 5¢-regulatory region of the TTP gene [25,26]. In macrophages, the expression of TTP and TNF-a can both be activated by lipopolysaccharide, and the feed- in turn, downregulates the back inhibition of TTP, production of TNF-a [27]. In addition to its involve- ment in post-transcriptional regulation in the immune system, TTP was found to regulate cellular metabo- lism during iron deficiency [28] and to respond to muscle damage [29].
includes cAMP,
To study post-transcriptional regulation during 3T3-L1 differentiation, 3T3-L1 preadipocytes were treated with a cocktail of fetal bovine serum, 1-methyl-3- (MIX), dexamethasone and isobutylmethylxanthine insulin (MDI) to induce their differentiation. Light microscopy observations showed that massive amounts of triglyceride accumulated in the cytoplasm, indica- ting that the 3T3-L1 cells differentiated normally (data not shown). RNAs were isolated for semiquantitative RT-PCR analysis. After hormone stimulation, the expression level of TTP mRNA did not change signifi- cantly from day 1 to day 9 when compared to the lev- els of the internal control, actin mRNA (Fig. 1A). Because the TTP gene was an immediate-early gene, we investigated whether it could be rapidly induced in 3T3-L1 cells. Both semiquantitative PCR and real-time PCR showed that its mRNAs reached their highest level at 1 h and then decreased dramatically (Fig. 1B). TTP protein was expressed only in the cytoplasm, reaching its highest levels 4 h after induction of differ- entiation, and then gradually returning to its original level (Fig. 1C). The multiple bands of TTP proteins on SDS ⁄ PAGE were caused by protein phosphorylation (data not shown). Another ARE-binding protein, HuR, was detected in both the nucleus and cytosolic fractions, and its expression level was consistent in the period of early differentiation.
To further verify which components in the hormone cocktail directly trigger the expression of TTP, we monitored the effect of each component. Quantitative PCR demonstrated that the TTP mRNA expression
White adipose tissue is mainly composed of adipo- cytes, which are cells that store energy in the form of in times of nutritional adequacy and triglycerides release free fatty acids during nutritional deprivation. The established preadipocyte cell line 3T3-L1 has been used to examine the process of adipogenesis in vitro [30–32]. When treated with an empirically derived pro- insulin differentiative regimen that and glucocorticoids in the presence of fetal bovine serum, the cells undergo differentiation to mature fat cells over a 4–6 day period. Numerous investigators have demonstrated that, during adipocyte differenti- ation, many genes are regulated in a differentiation- dependent manner. The first step in the process of adipogenesis is the re-entry of growth-arrested preadi- pocytes into the cell cycle and the completion of sev- eral rounds of cell division known as clonal expansion [33–35]. Several transcriptional factors are expressed
FEBS Journal 274 (2007) 867–878 ª 2007 The Authors Journal compilation ª 2007 FEBS
868
N.-Y. Lin et al.
Tristetraprolin regulation
A
M D0 D1 D2 D3 D4 D5 D6 D7 D8 D9
TTP
Actin
B
h after inducers
0 1 2 4 8 16
TTP
Actin
C
NE
CE
inducers
0
1
2
4
8
16
0
1
2
4
8
16
h
*
TTP
HuR
tubulin
hnRNP C1/C2
Fig. 1. Expression of TTP mRNA and protein during differentiation of 3T3-L1 preadipo- cytes. (A) Semiquantitative RT-PCR of TTP. Two-day postconfluent 3T3-L1 preadipo- cytes were induced to differentiate with MDI and 10% fetal bovine serum. RNAs were prepared at day 0 to day 9 at 1-day intervals, and RT-PCR was performed with TTP-specific and actin-specific (internal con- trol) primers. (B) 3T3-L1 cells were induced to differentiate for 0, 1, 2, 4, 8 and 16 h, and RNAs were isolated for semiquantitative RT-PCR (upper) and real-time PCR (lower). (C) Cytosolic and nuclear proteins were iso- lated for western blotting using TTP- and HuR-specific antibodies; tubulin- and hnRNP C1 ⁄ C1 antibodies served as markers of cytosolic and nuclear fractions, respectively. The star sign indicates the nonspecific band recognized by anti-TTP serum.
mRNAs. The half-life of TTP mRNAs was determined after hormone induction for 0.5, 1 and 2 h (Fig. 3). Intriguingly, the results showed that the mRNA half-life was more than 30 min at 30 min of induction and that it was less than 15 min at 1 h and 2 h of induction. TTP mRNA expression thus appeared to be short-lived. Thus, TTP mRNA expression in 3T3-L1 differentiation was controlled by rapid RNA degradation.
level after 1 h of treatment with either one of dexa- methasone, MIX or insulin in the presence of fetal bovine serum was lower than after treatment with all three combined (Fig. 2A). Without fetal bovine serum, the MDI mixture induced TTP mRNA expression 7.5- fold, but the TTP protein levels were very low under these conditions (Fig. 2B). Maximum induction of TTP mRNA and protein required the presence of MDI and fetal bovine serum. This result indicates that fetal bovine serum and each of the MDI components contribute to TTP mRNA expression.
Negative autoregulation of TTP expression in 3T3-L1 differentiation
Rapid degradation of TTP mRNAs
TTP expression in response to 3T3-L1 differentiation rapidly increased and then rapidly decreased. We were interested in the post-transcriptional regulation of TTP
AREs could be found in the 3¢UTR of TTP mRNAs [41,42] (Fig. 4A). To investigate the mechanism of its rapid degradation during 3T3-L1 differentiation, we ana- lyzed proteins that were possibly associated with TTP AREs. The biotinylated TTP AREs were incubated with
FEBS Journal 274 (2007) 867–878 ª 2007 The Authors Journal compilation ª 2007 FEBS
869
N.-Y. Lin et al.
Tristetraprolin regulation
A
FBS+MDI
FBS
B
0
1
2
4
8
16
1
2
4
8
16
h
TTP
HuR
tubulin
MDI
FBS+Mix
0
1
2
4
8
16
1
2
4
8
16
h
TTP
HuR
tubulin
FBS+Dex
FBS+Ins
0
1
2
4
8
16
1
2
4
8
16
h
TTP
HuR
tubulin
Fig. 2. mRNA and protein expression of TTP in 3T3-L1 cells. (A) Two-day postconfluent 3T3-L1 preadipocytes were treated with MDI, fetal bovine serum, fetal bovine serum + MIX, fetal bovine serum + dexa- methasone, fetal bovine serum + insulin or fetal bovine serum + MDI for 1 h, and RNAs were isolated for quantitative real-time RT-PCR using TTP-specific and actin-specific primers. (B) Treatments were similar to those in (A) for 0, 1, 2, 4, 8 and 16 h, and cytosolic extracts were isolated for western blotting using TTP-, HuR- and tubulin speci- fic antibodies.
cytoplasmic extracts from untreated 3T3-L1 or hor- mone-stimulated 3T3-L1 cells to precipitate the ARE- interacting proteins. After identification by western blotting using antibodies against HuR, TTP and hnRNP A1, the known ARE-binding proteins, it was observed that TTP and HuR could be precipitated by TTP AREs (Fig. 4B). HuR was consistently bound to TTP AREs either predifferentiation or postdifferentia- tion, whereas TTP was expressed and bound to TTP AREs only after stimulation. The other ARE-binding
protein, hnRNP A1, was not precipitated by TTP AREs in our experiment (data not shown). Figure 4C shows that antibodies to HuR and TTP could also pre- cipitate TTP mRNAs. Furthermore, in vitro transcribed TTP AREs were incubated with recombinant glutathi- one-S-transferase (GST)–HuR or GST–TTP for gel shift assay (Fig. 4D). The lowest dose of HuR totally occupied the ARE probe. When increasing amounts of the GST–TTP were incubated with ARE probes, larger RNA–protein complexes
gradually became
FEBS Journal 274 (2007) 867–878 ª 2007 The Authors Journal compilation ª 2007 FEBS
870
N.-Y. Lin et al.
Tristetraprolin regulation
0.5 h
1 h
2 h
A inducers
Act. D
M
0 10 20 30
0 10 20 30
0 10
20 30 min
TTP
Actin
B
140
120
100
80
0.5h 1h
%
60
2h
40
20
0
0
10
20
30
min after Act D.
Fig. 3. Half-life determination of TTP mRNAs. Two-day postconfluent 3T3-L1 preadipocytes were treated with MDI and 10% fetal bovine serum for 0.5, 1 and 2 h. Transcription was then stopped by adding 10 lgÆmL)1 of actinomycin D (Act. D) for 10, 20 and 30 min. The total RNAs were isolated and reverse-transcribed to produce cDNAs for semiquantitative PCR and quanti- tative PCR. (A) Semiquantitative RT-PCR with specific primers for TTP and actin. (B) Quantitative result of real-time PCR. Levels of TTP RNAs were normalized to those of actin in each sample, and then were plotted as a percentage of the initial value against Act. D incubating time.
left,
left,
the
in that
its production during sion through AREs to limit 3T3-L1 differentiation. Analysis of RNA using nor- thern blot gave similar results to those shown in Fig. 5A, expression of TTP protein decreased the mRNA level of the TTP ARE-containing reporter (Fig. 5D). Taken together, these results suggest that the TTP AREs may modulate gene expression post-transcriptionally, and that the binding of TTP pro- tein destabilized the mRNA, resulting in downregula- tion of reporter activity.
lanes 5–7). The addition of increasing (Fig. 4D, levels of TTP in the presence of a constant HuR con- centration led to the formation of larger complexes in the gel shift assay (Fig. 4D, lanes 8–10). This observation suggests that TTP and HuR could bind to TTP AREs simultaneously. The TTP AREs contain three potential HuR- or TTP-binding sites (Fig. 4A, underlined sequence). The RNA electrophoretic mobi- lity shift assay (REMSA) showed that the mutated TTP AREs could not bind to recombinant TTP or HuR (Fig. 4D, right panel).
Discussion
Our results showed that the RNA-binding protein TTP could be induced by fetal bovine serum and MDI during 3T3-L1 differentiation. TTP mRNA was briefly expressed because of its short half-life. The AREs in the 3¢UTR of TTP mRNAs could regulate its gene expression post-transcriptionally. Moreover, the phys- ical interactions in the RNA pull-down assay, RNA immunoprecipitation assay and REMSA showed that TTP and HuR protein associated with wild-type TTP AREs but not with mutated AREs. The ectopic expression of TTP decreased the ARE-mediated luci- ferase mRNA level and the reporter activity. These results indicate that TTP may bind to its AREs to destabilize the mRNA and downregulate its own pro- tein expression during 3T3-L1 early differentiation.
To further explore the functional effects of HuR and TTP binding on TTP AREs, we constructed a luciferase reporter containing TTP AREs for reporter assays. Figure 5A,B shows the results when 293T cells were co- transfected with increasing amounts of TTP or HuR expression plasmids, and a reporter encoding luciferase was fused to TTP AREs. When compared to the control luciferase reporter, HuR had almost no effect on the TTP ARE-containing luciferase activity. In contrast, TTP diminished the ARE-containing reporter activity. In the presence of HuR, TTP also had suppressive activ- ity (Fig. 5C). Although the activities of both the control reporter and the TTP ARE-containing reporter in the absence of expression plasmid were represented as 100, the control reporter actually had 10-fold higher activity than the TTP ARE-containing reporter. This result implied that TTP could downregulate its own expres-
FEBS Journal 274 (2007) 867–878 ª 2007 The Authors Journal compilation ª 2007 FEBS
871
N.-Y. Lin et al.
Tristetraprolin regulation
A
B
C
D
Fig. 4. Interaction between TTP and HuR proteins and TTP AREs. (A) Nucleotide sequences of TTP AREs. The potential AREs are underlined. (B) RNA pull-down assay. The biotinylated TTP ARE or control 18S RNA was incubated with cytoplasmic extracts from 3T3-L1 cells treated (+) or not treated (–) with MDI and fetal bovine serum. The RNA–protein complexes were precipita- ted with streptavidin Sepharose and subjected to SDS ⁄ PAGE for western blot- ting. TTP- and HuR-specific antibodies were used. The amount of protein in the lanes with direct loading was 1 ⁄ 10 of the protein used in the pull-down assay. (C) RNA immu- noprecipitation analysis. The cytoplasmic extracts from MDI and fetal bovine serum- treated (+) or nontreated (–) 3T3-L1 cells were immunoprecipitated using preimmune serum, or anti-TTP or anti-HuR sera After extensive washes, the protein-associated RNAs were extracted for RT-PCR with TTP specific primers. (D) REMSA. The ribo- probes were generated as described in Experimental procedures. Left panel: 1 pmol of radiolabeled TTP ARE (nucleotides 1529– 1715) was incubated with increasing amounts of GST–HuR (lanes 2–4, 1, 2 and 4 pmol) or GST–TTP (lanes 5–7), or 2 pmol of GST–HuR and increasing amounts of GST–TTP (lanes 8–10). Right panel: radio- labeled mutated TTP ARE was incubated with GST–HuR (lane 2) or GST–TTP (lane 3). Controls were wild-type TTP ARE (nucleo- tides1557–1621) incubated with GST (lane 5) or GST–HuR (lane 6).
exposure to the differentiation stimulus. The binding assay showed that HuR and TTP could occupy TTP AREs concurrently. The functional reporter assay also showed that the ectopic expression of HuR did not have a prominent effect on TTP ARE-mediated lucif- erase mRNA expression and protein activity. As shown in Fig. 5A,C, either in the absence or presence of HuR expression vector, the low dosage of TTP could result in a decrease of reporter gene expression. These results may be explained by the existence of high amounts of endogenous HuR.
In addition to TTP itself, HuR was seen to bind to TTP AREs (Fig. 5). HuR is predominantly localized in the nucleus and shuttles between the nucleus and cyto- plasm by means of a nuclear-cytoplasmic shuttling sequence in HuR (HNS) [43]. It could serve as an adaptor for mRNA export through the CRM1 route or through transportin-2 [44,45]. Thus, the functional role of HuR in TTP expression may be to enhance TTP mRNA export from the nucleus to the cytoplasm. Some extracellular stimuli have been reported that could cause the redistribution of HuR between the nucleus and cytoplasm [46–48]. Gantt et al. reported that, within 30 min of initiation of 3T3-L1 differenti- ation, the HuR cytosolic content increased by 30% [40]. In our experiments, HuR was consistently detec- ted in both the nucleus and cytoplasm of 3T3-L1 cells, with no significant alteration in the distribution after
Our results showed that small amounts of TTP could mediate a significant decrease in TTP ARE-dependent luciferase expression, and the higher doses of TTP did not lead to a greater inhibitory effect. In previous reports, the higher expression levels of TTP appeared to cause a slight increase in TNF-a ARE-mediated gene
FEBS Journal 274 (2007) 867–878 ª 2007 The Authors Journal compilation ª 2007 FEBS
872
N.-Y. Lin et al.
Tristetraprolin regulation
A
B
C
D
Fig. 5. Functional characterization of TTP- and HuR-mediated ARE-containing TTP mRNA expression. 293T cells were cotrans- fected with 0, 0.1, 0.2, 0.5 and 1 lg of pCMV-Flag-TTP (A) or pCMV-Flag-HuR (B) and in the presence of 0.2 lg of pCMV-Flag- HuR (C) together with 0.5 lg of reporter pLuc-TTP-ARE or control vector pLuc and 1 lg of pSV-b-galactosidase. The results are presented with the percentage of luciferase activity normalized with b-galactosidase activity. The activity of the reporter alone is shown as 100%. The lower panel shows the amounts of transfected Flag-TTP and Flag-HuR expressed in each experiment. (D) Northern blot analysis of experiment (A) targeting luciferase mRNA. glyceraldehyde- 3-phosphate dehydrogenase mRNAs served as internal control.
expression [17,49]. Our protein-binding assay provided a possible explanation: TTP at a high dose could form a large protein complex with TTP ARE, which could
block TTP interactions with other proteins that are essential for facilitating post-transcriptional regulation. The other explanation is that TTP was highly phosphor-
FEBS Journal 274 (2007) 867–878 ª 2007 The Authors Journal compilation ª 2007 FEBS
873
N.-Y. Lin et al.
Tristetraprolin regulation
ation will be investigated to improve our understanding of the onset of adipogenesis through regulation of some ARE-containing transcripts.
Experimental procedures
Cell culture
ylated during the high-level protein expression and this may cause alteration of its function. Recent reports demonstrated that TTP phosphorylation by the p38 MAPK pathway could lead to increased TTP protein stability but reduced ARE affinity [50,51]. Our study also showed that TTP could differentially regulate cytokine mRNA expression by phosphorylation [52]. The effect of the p38 MAPK pathway on TTP negative autoregulation will be investigated further.
Plasmid constructs and protein purification
TTP mRNA expression was activated by fetal bovine serum and the components of MDI. Insulin and serum have been reported to activate TTP expres- sion transcriptionally [23,25]. Some DNA elements that responded to MIX and dexamethasone were also found in the TTP promoter. Interestingly, without fetal bovine serum, TTP protein expression appeared to be blocked. The possible mechanisms are that fetal bovine serum triggers TTP protein synthesis or enhances TTP protein stability. During adipogenesis, replacement of fetal bovine serum with calf serum markedly retarded and decreased the extent of differentiation (data not shown) [53]. Thus, fetal bovine serum is required for the rapid and complete acquisition of adipocyte char- acteristics, and this might be due to the requirement for fetal bovine serum-mediated TTP expression.
3T3-L1 cells were grown in DMEM (Gibco-BRL, Grand Island, NY, USA) containing 1.5 gÆL)1 NaHCO3 and serum (Gibco-BRL), supplemented with 10% bovine 100 UÆmL)1 penicillin, and 100 mgÆmL)1 streptomycin (Gibco-BRL) in a 5% CO2 humidified atmosphere (37 (cid:2)C). Two-day postconfluent cells (day 0) were stimulated to dif- ferentiate by changing to fresh medium containing 10% fetal bovine serum (Characterized; Hyclone Laboratories, Logan, UT, USA) and addition of hormone cocktail [5 lm dexamethasone (Sigma-Aldrich, St Louis, MO, USA), 1.7 lm insulin (bovine; Sigma-Aldrich), and 0.5 mm MIX (Sigma-Aldrich)].
and
RNA isolation and RT-PCR
The cDNAs of HuR and TTP were PCR synthesized by using primers 5¢-ATGTCTAATGGTTATGAAGAC-3¢ and 5¢-ATGAGCGAGTTATTTGTGGG-3¢ for HuR, primers 5¢-CTCAGAGACAGAGATACGATTG-3¢ 5¢-ATG GATCTCGCCATCTAC-3¢ for TTP, and the 2 h LPS-trea- ted RAW264.7 cDNA as templates. The PCR fragments were ligated into pGEM-Teazy vector (Promega, Madison, WI, USA). After DNA sequence confirmation, the EcoRI fragment was further cloned into both bacterial expression vector pGEX (Amersham Pharmacia, Uppsala, Sweden) and mammalian cell expression vector pCMV-Tag2 (Strata- gene, La Jolla, CA, USA). The 3¢-ARE of TTP (from cDNA nucleotides 1529–1715) was PCR cloned by using primers 5¢-TTGCCAAATCCCTTCTC-3¢ and 5¢-TAGACT TGTACGGTAGC-3¢. The PCR fragment was cloned into pGEM-Teazy vector (Promega) to prepare the riboprobe. For the heterologous 3¢UTR assay, this ARE fragment was inserted into the 3¢-end of the cytomegalovirus (CMV)-dri- ven luciferase gene (Stratagene). The GST fusion proteins were induced and purified followed the manufacture’s pro- cedure (Amersham Pharmacia).
Extracellular stimuli regulate a spectrum of cellular events, such as cell growth, differentiation and death, by altering the gene expression profile. The resulting induc- tion of immediate-early genes then triggers subsequent expression cascades. TTP is induced as an immediate- early gene in 3T3-L1 preadipocytes, and little is known about its biological function in adipogenesis. To demon- strate the implication of endogenous TTP in adipogene- sis, we knocked down its expression in 3T3-L1 preadipocytes using siRNA, and observed a 40% reduc- tion of TTP expression, associated with partial inhibi- tion of adipogenesis (Fig. 1). According to the timing of TTP expression during adipogenesis, we predict that TTP may control the gene expression profile that is involved in cell cycle progression in order to regulate mitotic clonal expansion. Retinoblastoma protein and transcription factor E2F have been reported to be involved in this cell cycle progression [54]. Many cell cycle-associated proteins, such as cyclin-dependent kinases (CDKs) and their inhibitors, p18, p21 and p27, also play crucial roles during cell cycle progression [39,55], and some of these cell cycle-associated proteins are encoded by ARE-containing mRNAs. Compared to the plentiful knowledge of transcriptional regulation accumulated through the study of differentiation of 3T3-L1 preadipocytes, our understanding of post-tran- scriptional control during adipogenesis is very poor. The mRNA targets of TTP during 3T3-L1 differenti-
FEBS Journal 274 (2007) 867–878 ª 2007 The Authors Journal compilation ª 2007 FEBS
874
Total RNAs were extracted from the cell cultures by using Blue extract reagent (LTK, Inc., Taoyuan, Taiwan), follow- ing the procedures recommended by the manufacturer. Five micrograms of total RNAs extracted from 3T3-L1 cells trea- ted with differentiation inducers for different time intervals was reverse-transcribed to produce cDNA using reverse tran- scriptase and oligo dT (Promega) as a primer. The specific
N.-Y. Lin et al.
Tristetraprolin regulation
(Sigma-Aldrich), HuR-
Immunopreciptation assays
dithiothreitol, 1 lgÆmL)1 leupeptin, 1 lgÆmL)1 papstatin A, 100 lgÆmL)1 phenylmethanesulfonyl fluoride, and phospha- tase inhibitors) and rocked on ice for 20 min. After centrif- ugation using Heraeus Biofuge fresco fixed-angle rotor 7500 3325 (Kendro Laboratory Products) at top speed for 10 min, the supernatant was collected as a nuclear extract. The samples were then aliquoted and stored at ) 80 (cid:2)C for further assays. The proteins separated by SDS ⁄ PAGE were transferred to poly(vinylidene fluoride) membranes (Milli- pore, Billerica, MA, USA), and western blotting was done using Flag- (Santa Cruz, Santa Cruz, CA, USA), TTP- and a-tubulin-specific antibodies [52].
Real-time PCR
cDNA was amplified using 5% of the reverse transcription reaction mixture in 20 lL containing 10 pmol of forward primer, 10 pmol of reverse primer, and lypholized Taq DNA polymerase, buffer and dNTPs (LTK, Inc.). The sequences of the primers used for TTP and actin were: 5¢-CTCAGAGACAGAGATACGATTG-3¢ and 5¢-ATGG ATCTCGCCATCTAC-3¢ for TTP; and 5¢-TCCTTCCTG GGCATGGAGTC-3¢ and 5¢-ACTCATCATACTCCTGCT TG-3¢ for actin. The expected size of the PCR product was 957 bp for TTP and 300 bp for actin. The semiquantitative PCR was performed in a Robocycler gradient 96 PCR thermal machine (Stratagene), using the following condi- tions: 94 (cid:2)C (3 min) for one cycle, 94 (cid:2)C (40 s), 55 (cid:2)C (40 s), 72 (cid:2)C (depending on the product length, 1 min per 1 kb) for 20–25 cycles, and a final incubation at 72 (cid:2)C for 3 min. The PCR products were separated in agarose gel and quantitated by UVP (Upland, CA, USA) labwork 4.5 software.
times with NT2 buffer
RNA pull-down assay
Cytoplasmic extracts (1 mg) from 3T3-L1 cells in 25 mm Hepes were adjusted to 25 mm Hepes (pH 7.5), 150 mm NaCl, 1.5 mm MgCl2, 0.2 mm EDTA, 0.1% Triton X-100, 0.5 mm dithiothreitol and 1 UÆlL)1 of RNase inhibitor (Promega), and were precleaned with protein A Sepharose for 1 h. After centrifugation at (Amershan Pharmacia) 8000 g for 1 min using Heraeus fresco fixed-angle rotor 7500 3325 (Kendro Laboratory Products), the supernatants were added with preimmune serum or HuR or TTP sera and protein A Sepharose at 4 (cid:2)C rotated for 2 h. Beads (50 mm were washed three Tris ⁄ HCl, pH 7.4, 150 mm NaCl, 1 mm MgCl2, 0.05% NP- 40) [56]. The beads were then incubated with 100 lL NT2 buffer containing 5 U of RNase-free Dnase I (Ambion, Austin, TX, USA) for 15 min at 30 (cid:2)C, washed with NT2 buffer, and further incubated in 100 lL of NT2 buffer con- taining 0.1% SDS and 0.5 mgÆmL)1 proteinase K at 55 (cid:2)C for 15 min. RNA was extracted with blue extract reagent as described above for RT-PCR analysis.
Preparation of cytoplasmic and nuclear extracts and western blotting assay
Real-time PCR was performed with the Applied Biosystems 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) in a total volume of 25 lL. Expression of TTP was analyzed using FastStart TaqMan Probe Master (Rox) (Roche Molecular Biochemicals, Mannheim, Germany) containing 50 ng of cDNA, 100 nm probe (Uni- versal Probelibrary probe no. 58, 5¢-CTCCATCC-3¢, Roche) and 200 nm both forward and reverse primers (5¢-GGAT CTCTCTGCCATCTACGA-3¢ and 5¢-CAGTCAGGCGA GAGGTGAC-3¢ respectively). Expression of actin was ana- lyzed using SYBR Green PCR Master Mix (Applied Biosystems) containing 50 ng of cDNA and 160 nm each pri- mer (the primers were identical to those used in semiquantita- tive RT-PCR). The real-time PCR amplification conditions were 40 cycles of 95 (cid:2)C for 15 s and 60 (cid:2)C for 1 min. The real-time PCR data were analyzed using the 2–DDCT relative quantitation method, according to the manufacturer’s direc- tions.
(0.1 UÆlL)1) and yeast
FEBS Journal 274 (2007) 867–878 ª 2007 The Authors Journal compilation ª 2007 FEBS
875
Cytoplasmic extracts from 107 3T3-L1 cells were precleaned by centrifugation, and the potassium acetate concentration was adjusted to 90 mm. After addition of RNase inhibitor tRNA (20 lgÆmL)1) (Promega) (Ambion), cytoplasmic extracts were absorbed with hep- arin-agarose (Sigma-Aldrich) at 4 (cid:2)C for 15 min. After cen- trifugation at 8000 g for 1 min using Heraeus fresco fixed- angle rotor 7500 3325 (Kendro Laboratory Products), the supernatant was further cleaned with 20 lL of streptavidin Sepharose (Invitrogen, San Diego, CA, USA) for 1 h at 4 (cid:2)C with rotation. After centrifugation at 8000 g for 1 min using Heraeus fresco fixed-angle rotor 7500 3325 (Kendro Laboratory Products), the supernatants were added with 4 lg of in vitro transcribed biotinylated TTP ARE or con- trol 18S RNA (T7-MEGA shortscriptTM, Ambion) was added to the supernatant and the mixture was incubated for 1 h at 4 (cid:2)C. The protein and biotinylated RNA To prepare the cell extract, 5 · 106 cells were resuspended in 400 lL of buffer A (10 mm Hepes, pH 7.9, 10 mm KCl, 1.5 mm MgCl2, 1 mm dithiothreitol, 1 lgÆmL)1 leupeptin, 1 lgÆmL)1 papstatin A, 100 lgÆmL)1 phenylmethanesulfo- nyl fluoride, and phosphatase inhibitors). The cell suspen- sion was kept on ice for 15 min, and then 25 lL of 10% NP-40 was added; this was followed by vortexing for 10 s. After centrifugation at 10 000 g for 30 s using Heraeus Bio- fuge fresco fixed-angle rotor 7500 3325 (Kendro Laboratory Products, Hanau, Germany), the supernatant was collected as a cytoplasmic extract. The nuclear pellets were resus- pended in 100 lL of buffer C (20 mm Hepes, pH 7.9, 1 mm 400 mm NaCl, 1 mm EDTA, 1 mm EGTA,
N.-Y. Lin et al.
Tristetraprolin regulation
REMSA
complexes were recovered by addition of 12 lL of strept- avidin Sepharose at 4 (cid:2)C for 2 h with rotation. The precipi- tated complexes were washed five times with binding buffer (10 mm Hepes, pH 7.5, 90 mm potassium acetate, 1.5 mm MgCl2, 2.5 mm dithiothreitol, 0.05% NP40, protease and phosphatase inhibitor cocktail, 0.5 mm phenylmethanesulfo- nyl fluoride), boiled in SDS ⁄ PAGE sample buffer, and resolved by gel electrophoresis followed by western blotting with anti-HuR and anti-TTP sera.
USA) with Promega luciferin as substrate. b-galactosidase activity was determined with a standard colorimetric assay using 2-nitrophenyl b)d-galactopyranoside (Sigma-Aldrich) as substrate. The luciferase assay results were normalized to b-galactosidase activity to correct for variations in transfec- tion efficiency. Each treatment group contained duplicate cultures, and each experiment was repeated three times. Relative luciferase activity, defined as luciferase light units ⁄ b-galactosidase activity, is presented as means ± SE. After digestion by RNase-free DNaseI, the isolated RNAs were subjected to 1.4% formaldehyde agarose gel electro- phoresis and then capillary-transferred onto a nylon mem- brane (Hybond-N; Amersham Pharmacia).32 P-Labeled cDNA probes against the luciferase and glyceraldehyde-3- phosphate dehydrogenase coding regions were synthesized using Ready-to-Go DNA labeling Beads (Amersham Bio- sciences). After hybridization, the membranes were visual- ized and quantified by phosphoimaging (BAS-1000 and Image Gauge; Fuji, Tokyo, Japan).
Acknowledgements
This work was supported by Academia Sinica and the National Science Council (grant NSC 95-2311-B-001– 054).
References
1 Guhaniyogi J & Brewer G (2001) Regulation of mRNA stability in mammalian cells. Gene 265, 11–23. 2 Bevilacqua A, Ceriani MC, Capaccioli S & Nicolin A
(2003) Post-transcriptional regulation of gene expression by degradation of messenger RNAs. J Cell Physiol 195, 356–372.
3 Kracht M & Saklatvala J (2002) Transcriptional and post-transcriptional control of gene expression in inflammation. Cytokine 20, 91–106. 4 Zhang T, Kruys V, Huez G & Gueydan C (2002)
Transfection, luciferase and b-galactosidase assay, northern blotting
TTP ARE (nucleotides 1529–1715) in pGEM-Teazy was linea- rized with SalI and in vitro transcribed by T7 RNA polym- erase in the presence of [a-32P]UTP for REMSA (Fig. 4D, left panel). To generate the wild-type and mutant TTP ARE probes, antisense oligonucleotides containing a T7 promoter were synthesized: 5¢-CCCAATATATATAAATACTATAAA ATCTTAATACAATAAATAAAGTCGTCATAAATAA AGGGCCCTATAGTGAGTCGTATTA-3¢ for the wild-type (nucleotides 1557–1621); and 5¢-CCCAATATATATCCCT ACTATAAAATCTTAATACAATCCCTAAAGTCGTC ATCCCTAAAGGGCCCTATAGTGAGTCGTATTA-3¢ for the mutant (underlining indicates the mutation introduced). These oligonucleotides were hybridized with a sense T7 pri- mer (5¢-TAATACGACTCACTATAG-3¢) and extended to fill-in the probes by PCR (95 (cid:2)C for 40 s, 55 (cid:2)C for 40 s, 72 (cid:2)C for 40 s, 35 cycles). PCR fragments of 0.5 lg were in vitro transcribed by T7 RNA polymerase in the presence of [a-32P]UTP. Radiolabeled probe (1 pmol) was incubated with the indicated recombinant proteins at room temperature for 40 min in a final volume of 10 lL containing 15 mm Hepes (pH 7.9), 10 mm KCl, 5 mm MgCl2, 10% glycerol, 0.2 mm dithiothreitol, 0.5 lg heparin sulfate, and 5 lg of yeast total RNA. Binding mixtures were then loaded onto native 5% polyacryamide gel (acryl ⁄ bis ¼ 40 : 1) containing 2.5% glycerol in 0.25 · Tris ⁄ borate ⁄ EDTA buffer. After electrophoresis at 15 VÆcm)1 for 60 min, the gel was dried and exposed to Kodak XAR film (Rochester, NY, USA) at ) 70 (cid:2)C for the appropriate time. AU-rich element-mediated translational control: com- plexity and multiple activities of trans-activating factors. Biochem Soc Trans 30, 952–958. 5 Espel E (2005) The role of the AU-rich elements of
mRNAs in controlling translation. Semin Cell Dev Biol 16, 59–67. 6 Chen CY & Shyu AB (1995) AU-rich elements: charac-
terization and importance in mRNA degradation. Trends Biochem Sci 20, 465–470. 7 Zhang W, Wagner BJ, Ehrenman K, Schaefer AW,
FEBS Journal 274 (2007) 867–878 ª 2007 The Authors Journal compilation ª 2007 FEBS
876
DeMaria CT, Crater D, DeHaven K, Long L & Brewer G (1993) Purification, characterization and cDNA clon- ing of an AU-rich element RNA-binding protein, AUF1. Mol Cell Biol 13, 7652–7665. 8 Carballo E, Lai WS & Blackshear PJ (2000) Evidence that tristetraprolin is a physiological regulator of The HEK293T cells (2 · 105) were seeded in each well of a six-well plastic culture plate. Cells were transfected using the calcium phosphate precipitation method with 0.5 lg of the indicated luciferase constructs, 1 lg of SV40–b-galac- tosidase plasmid (Promega), and TTP or HuR expression vector. After 24 h, cells were harvested, and the cell lysates were assayed for luciferase and b-galactosidase activity, and western blotting of ectopic expressed proteins was per- formed, or RNAs were isolated 12 h after transfection for northern blotting analysis. Luciferase activity was deter- mined in a luminometer (Packard, Downers Grove, IL,
N.-Y. Lin et al.
Tristetraprolin regulation
granulocyte–macrophage colony stimulating factor messenger RNA deadenylation and stability. Blood 95, 1891–1899. 21 Lykke-Andersen J & Wagner E (2005) Recruitment and activation of mRNA decay enzymes by two ARE- mediated decay activation domains in the proteins TTP and BRF-1. Genes Dev 19, 351–361. 22 Jing Q, Huang S, Guth S, Zarubin T, Motoyama A,
9 Ma WJ, Cheng S, Campbell C, Wright A & Furneaux H (1996) Cloning and characterization of HuR, a ubi- quitously expressed Elav-like protein. J Biol Chem 271, 8144–8151. 10 Dember LM, Kim ND, Liu K-Q & Anderson P (1996) Chen J, Padiva FD, Lin S-C, Gram H & Han J (2005) Involvement of microRNA in AU-rich element- mediated mRNA instability. Cell 120, 623–634. 23 Lai WS, Stumpo DJ & Blackshear PJ (1990) Rapid
Individual RNA recognition motifs of TIA-1 and TIAR have differential RNA binding specificities. J Biol Chem 271, 2783–2788.
11 Piecyk M, Wax S, Beck AR, Kedersha N, Gupta M, Maritim B, Chen S, Gueydan C, Kruys V, Streuli M et al. (2000) TIA-1 is a translational silencer that selec- tively regulates the expression of TNFa. EMBO J 19, 4154–4163. insulin-stimulated accumulation of an mRNA encoding a proline-rich protein. J Biol Chem 265, 16556–16563. 24 Inuzuka H, Nanbu-Wakao R, Masuho Y, Muramatsu M, Tojo H & Wakao H (1999) Differential regulation of immediate early gene expression in preadipocyte cells through multiple signaling pathways. Biochem Biophys Res Commun 265, 664–668. 25 Lai WS, Thompson MJ, Taylor GA, Liu Y & Black-
12 Keene JD (1999) Why is Hu where? Shuttling of early- response-gene messenger RNA subsets. Proc Natl Acad Sci USA 96, 5–7. 13 Peng SS, Chen CY, Xu N & Shyu AB (1998) RNA shear PJ (1995) Promoter analysis of Zfp-36, the mito- gen-inducible gene encoding the zinc finger protein tristetraprolin. J Biol Chem 270, 25266–25272. 26 Lai WS, Thompson MJ & Blackshear PJ (1998) Charac-
stabilization by the AU-rich element binding protein, HuR, an ELAV protein. EMBO J 17, 3461–3470. 14 Katsanou V, Papadaki O, Milatos S, Blacksheer PJ, teristics of the intron involvement in the mitogen- induced expression of Zfp-36. J Biol Chem 273, 506–517.
Anderson P, Kollias G & Kontoyiannis DL (2005) HuR as a negative posttranscriptional modulator in inflam- mation. Mol Cell 19, 777–789.
27 Carballo E, Lai WS & Blackshear PJ (1998) Feedback inhibition of macrophage tumor necrosis factor-a pro- duction by tristetraprolin. Science 281, 1001–1005. 28 Puig S, Askeland E & Thiele DJ (2005) Coordinated
remodeling of cellular metabolism during iron deficiency through targeted mRNA degradation. Cell 120, 99–110. 15 Kawai T, Lal A, Yang X, Galban S, Mazan-Mamczarz K & Gorospe M (2006) Translational control of cyto- chrome c by RNA-binding proteins TIA1 and HuR. Mol Cell Biol 26, 3295–3307.
29 Sachidanandan C, Sambasivan R & Dhawan J (2002) Tristetraprolin and LPS-inducible CXC chemokine are rapidly induced in presumptive satellite cells in response to skeletal muscle injury. J Cell Sci 115, 2701–2712. 30 Green H & Kehinds O (1974) Sublines of mouse 3T3 cells that accumulate lipid. Cell 1, 113–116. 16 Taylor GA, Carballo E, Lee DM, Lai WS, Thompson MJ, Patel DD, Schenkman DI, Gilkeson GS, Broxme- yer HE, Haynes BF et al. (1996) A pathogenic role for TNF alpha in the syndrome of cachexia, arthritis, and autoimmunity resulting from tristetraprolin (TTP) defi- ciency. Immunity 4, 445–454.
31 Green H & Kehinds O (1975) An established cell line and its differentiation in culture II. Factors affecting adipose conversion. Cell 5, 19–27. 32 Green H & Kehinds O (1976) Spontaneous heritable 17 Lai WS, Carballo E, Strum JR, Kennington EA, Philips RS & Blackshear PJ (1999) Evidence that tristetraprolin binds to AU-rich elements and promotes the deadenyla- tion and destabilization of tumor necrosis factor alpha mRNA. Mol Cell Biol 19, 4311–4323. 18 Lai WS & Blackshear PJ (2001) Interactions of CCCH changes leading to increased adipose conversion in 3T3 cells. Cell 7, 105–113. 33 MacDougald OA & Lane MD (1995) Transcriptional
regulation of gene expression during adipocyte differen- tiation. Annu Rev Biochem 64, 345–373. 34 Rosen ED & Spiegelman BM (2000) Molecular zinc finger protein with mRNA: tristetraprolin-mediated AU-rich element-dependent mRNA degradation can occur in the absence of a poly(A) tail. J Biol Chem 276, 23144–23154.
regulation of adipogenesis. Annu Rev Cell Dev Biol 16, 145–171.
19 Chen CY, Gherzi R, Ong SE, Chan EL, Raijmakers R, Pruijn GJM, Stoecklin G, Moroni C, Mann M & Karin M (2001) AU binding proteins recruit the exosome to degrade ARE-containing mRNAs. Cell 107, 451–464. 20 Mukherjee D, Gao M, O’Connor JP, Raijmakers R, 35 Rosen ED, Walkey CJ, Puigserver P & Spiegelman BM (2000) Transcriptional regulation of adipogenesis. Genes Dev 14, 1293–1307. 36 Darlington GJ, Ross SE & MacDougald OA (1998)
FEBS Journal 274 (2007) 867–878 ª 2007 The Authors Journal compilation ª 2007 FEBS
877
The role of C ⁄ EBP genes in adipocyte differentiation. J Biol Chem 273, 30057–30060. Pruijn G, Lutz CS & Wilusz J (2002) The mammalian exosome mediates the efficient degradation of mRNAs that contain AU-rich elements. EMBO J 21, 165–174.
N.-Y. Lin et al.
Tristetraprolin regulation
37 Kim JB & Spiegelman BM (1996) ADD1 ⁄ SREBP1 pro- motes adipocyte differentiation and gene expression linked to fatty acid metabolism. Genes Dev 10, 1096– 1107. tion analysis of tristetraprolin (TTP): p38 stress- activated protein kinase and lipopolysaccharide stimulation do not alter TTP function. J Immun 174, 7883–7893.
38 Shao D & Lazar MA (1997) Peroxisome proliferator activated receptor gamma, CCAAT ⁄ enhancer-binding protein alpha, and cell cycle status regulate the commit- ment to adipocyte differentiation. J Biol Chem 272, 21473–21478. 39 Morrison RF & Farmer SR (1999) Role of PPARc in 50 Brook M, Tchen CR, Santalucia T, McIlrath J, Arthur JS, Saklatvala J & Clark AR (2006) Posttranslational regulation of tristetraprolin subcellular localization and protein stability by p38 mitogen-activated protein kinase and extracellular signal-regulated kinase pathways. Mol Cell Biol 26, 2408–2418.
51 Hitti E, Iakovleva T, Brook M, Deppenmeier S, Gruber AD, Radzioch D, Clark AR, Blackshear PJ, Kotlyarov A & Gaestel M (2006) Mitogen-activated protein kinase-activated protein kinase 2 regulates tumor necro- sis factor mRNA stability and translation mainly by altering tristetraprolin expression, stability, and binding to adenine ⁄ uridine-rich element. Mol Cell Biol 26, 2399–2407. regulating a cascade expression of cyclin-dependent kin- ase inhibitors, p18 (INK4c), and p21 (Waf1 ⁄ Cip1), dur- ing adipogenesis. J Biol Chem 274, 17088–17097. 40 Gantt K, Cherry J, Tenney R, Karschner V & Pekala PH (2005) An early event in adipogenesis, the nuclear selection of the CCAAT enhancer-binding protein b (C ⁄ EBPb) mRNA by HuR and its translocation to the cytosol. J Biol Chem 280, 24768–24774.
52 Chen YL, Huang YL, Lin NY, Chen HC, Chiu WC & Chang CJ (2006) Differential regulation of ARE- mediated TNFa and IL-1b mRNA stability by lipopoly- saccharide in RAW264.7 cells. Biochem Biophys Res Commun 346, 160–168. 41 Brooks SA, Connolly JE & Rigby WF (2004) The role of mRNA turnover in the regulation of tristetraprolin expression: evidence for an extracellular signal-regulated kinase-specific, AU-rich element-dependent. Autoregula- tory pathway. J Immun 172, 7264–7271.
53 Huang H, Lane MD & Tang QQ (2005) Effect of serum on the down-regulation of CHOP-10 during differentia- tion of 3T3-L1 preadipocytes. Biochem Biophys Res Commun 338, 1185–1188. 42 Tchen CR, Brook M, Saklatvala J & Clark AR (2004) The stability of tristetraprolin mRNA is regulated by mitogen-activated protein kinase p38 by tristetraprolin itself. J Biol Chem 279, 32393–32400.
54 Rinchon VM, Lyle RE & McGehee RE Jr (1997) Regu- lation and expression of retinoblastoma proteins p107 and p130 during 3T3-L1 adipocyte differentiation. J Biol Chem 272, 10117–10124. 43 Fan XC & Steitz JA (1998) Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J 17, 3448–3460.
44 Brennan CM, Gallouzi IE & Steitz JA (2000) Protein ligands to HuR modulate its interaction with target mRNAs in vivo. J Cell Biol 151, 1–14.
55 Reichert M & Eick D (1999) Analysis of cell cycle arrest in adipocyte differentiation. Oncogene 18, 459–466. 56 Lal A, Mazan-Mamczarz K, Kawai T, Yang X, Martin- dale JL & Gorospe M (2004) Concurrent versus indivi- dual binding of HuR and AUF1 to common labile target mRNAs. EMBO J 23, 3092–3102. 45 Gallouzi IE & Steitz JA (2001) Delineation of mRNA export pathways by the use of cell permeable peptides. Science 294, 1895–1901. 46 Atasoy U, Watson J, Patel D & Keene JD (1998)
Supplementary material
is available
The following supplementary material online: Fig. S1. RNA interference with TTP expression dur- ing 3T3-L1 differentiation.
This material is available as part of the online article
ELAV protein HuA (HuR) can redistribute between nucleus and cytoplasm and is upregulated during serum stimulation and T cell activation. J Cell Sci 111, 3145– 3156.
from http://www.blackwell-synergy.com
47 Wang W, Furneaux H, Cheng H, Caldwell MC, Hunter D, Liu Y, Holbrook NJ & Gorospe M (2000) HuR regulates p21 mRNA stabilization by UV light. Mol Cell Biol 20, 760–769. 48 Li H, Park S, Kilburn B, Jelinek MA, Henschen-Edman
Please note: Blackwell Publishing is not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the corres- ponding author for the article.
A, Aswad DW, Stallcup MR & Laird-Offringa IA (2002) Lipopolysaccharide-induced methylation of HuR, an mRNA-stabilizing protein, by CARM1. J Biol Chem 277, 44623–44630.
FEBS Journal 274 (2007) 867–878 ª 2007 The Authors Journal compilation ª 2007 FEBS
878
49 Rigby WFC, Roy K, Collins J, Rigby S, Connolly JE, Bloch DB & Brooks SA (2005) Structure ⁄ func-
