intTypePromotion=1

Báo cáo nghiên cứu khoa học: "Sử dụng kỹ thuật PCR-RFLP trong nghiên cứu đa hình gen liên quan đến chất lượng thịt lợn"

Chia sẻ: Nguyễn Phương Hà Linh Linh | Ngày: | Loại File: PDF | Số trang:6

0
84
lượt xem
16
download

Báo cáo nghiên cứu khoa học: "Sử dụng kỹ thuật PCR-RFLP trong nghiên cứu đa hình gen liên quan đến chất lượng thịt lợn"

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Gen, gien, ren hay di tố là một đoạn DNA mang một chức năng nhất định trong quá trình truyền thông tin di truyền. Trên nhiễm sắc thể, một gen thường có một vị trí xác định và liên kết với các vùng điều hòa phiên mã và các vùng chức năng khác [1] để bảo đảm và điều khiển hoạt động của gen.

Chủ đề:
Lưu

Nội dung Text: Báo cáo nghiên cứu khoa học: "Sử dụng kỹ thuật PCR-RFLP trong nghiên cứu đa hình gen liên quan đến chất lượng thịt lợn"

  1. T P CHÍ KHOA H C, ð i h c Hu , S 64, 2011 S D NG K THU T PCR-RFLP TRONG NGHIÊN C U ðA HÌNH GEN LIÊN QUAN ð N CH T LƯ NG TH T L N H Trung Thông, H Lê Quỳnh Châu Trư ng ð i h c Nông Lâm, ð i h c Hu TÓM T T Nghiên c u này ñã ñư c th c hi n nh m xác ñ nh ña hình các ki u gen PSS và leptin liên quan ñ n ch t lư ng th t l n. Chín m u DNA t ng s c a l n Ki ng S t ñã ñư c nh n d ng ki u gen b ng k thu t RFLP-PCR v i các c p primer ñ c hi u. K t qu nghiên c u ña hình gen leptin cho th y, t n s ki u gen AA chi m t l cao nh t (77,78%), ki u gen GA và GG chi m t l th p (11,11%). Ngoài ra, phân tích ña hình gen PSS cũng ch ra r ng h u h t các m u nghiên c u ñ u có ki u gen ñ ng h p t NN, ch có 1 m u có ki u gen d h p t Nn. K t qu nghiên c u này là d li u quan tr ng trong công tác phát tri n gi ng l n Ki ng S t theo ñ nh hư ng cho ch t lư ng th t cao, ñ ng th i là cơ s ñ ñưa ra các phương án b o t n ngu n gen quý gi ng l n b n ñ a này. T khóa: ch t lư ng th t l n, ña hình gen, PCR-RFLP. 1. ð t v n ñ Theo Sellier (1998), ch t lư ng th t ch u s tác ñ ng c a nhi u nhân t như ñ c ñi m c a cơ (lo i và kích thư c s i cơ, m và mô liên k t), ñi u ki n s n xu t và môi trư ng (t c ñ sinh trư ng, dinh dư ng, tu i, các ñi u ki n trư c khi gi t m , quá trình chín sau khi m th t) và di truy n ñ ng v t (gi ng, ki u gen). Vi c nh n bi t các gen ñi u khi n ch t lư ng là hư ng ti p c n có nhi u tri n v ng trong nghiên c u c i thi n các tính tr ng ch t lư ng th t (Fávero 2002, trích d n theo Band và cs 2005). ð n nay, nhi u gen nh hư ng ñ n ch t lư ng th t ñã ñư c xác ñ nh. Gen PSS (porcine stress syndrome) hay ryr1 là m t trong nh ng v trí tính tr ng ñ u tiên l n ñư c mô t m c ñ phân t . Fujii và cs (1991) ñã ñ xu t m t test quan tr ng giúp sàng l c ch t lư ng th t l n d a vào vi c xác ñ nh ñ t bi n gây b nh trên gen PSS. Test này giúp các nhà ch n gi ng tách chính xác ba ki u gen PSS (NN, Nn và nn) và cho phép nghiên c u chi ti t hơn v tác ñ ng c a ñ t bi n gen PSS lên ch t lư ng th t. Bên c nh ñó, m i liên quan gi a ña hình gen leptin v i các tính tr ng v t c ñ sinh trư ng, t l n c và m c tiêu th th c ăn trong qu n th l n cũng ñã ñư c phát hi n (Hardge và cs 1998). K t qu phân tích m i tương quan gi a ña hình gen leptin v i tính tr ng ch t lư ng th t t 249 m u c a nhi u gi ng l n khác nhau c a Kuryl và cs (2003) cũng ñã cho th y gen leptin liên quan ñ n tính tr ng ch t lư ng th t l n và kh năng tăng tr ng. S d ng k thu t PCR-RFLP có th giúp nh n bi t chính xác các cá th mang ki u gen khác nhau 167
  2. trong th i gian ng n. Vì v y, nghiên c u này ñã ñư c th c hi n nh m xác ñ nh ña hình các ki u gen PSS và leptin trên gi ng l n Ki ng S t, làm cơ s cho vi c ch n gi ng chính xác hơn theo ñ nh hư ng nâng cao ch t lư ng th t gi ng l n b n ñ a sau này. 2. V t li u và phương pháp nghiên c u 2.1. Thu m u máu l n M u máu c a 9 con l n Ki ng S t ñư c s d ng ñ nghiên c u ña hình hai gen leptin và PSS. B m t da vùng tai l n ñư c sát trùng b ng dung d ch alcohol 70%. Sau ñó, dùng kim tiêm vô trùng l y 1 ml máu tĩnh m ch tai l n cho vào ng EDTA n p xanh (HEMATOLOGIE: NFS-FLAQ), ñ o ng vài l n ñ tr n ñ u m u máu và dung d ch ch ng ñông. M u máu ñư c gi nhi t ñ phòng trong 24 gi trư c khi ñư c s d ng ñ tách chi t DNA t ng s ho c -20oC n u chưa dùng ngay. 2.2. Tách chi t DNA t ng s DNA t ng s ñư c tách chi t t các m u máu toàn ph n b ng EzWayTM Genomic DNA kit (Koma Biotech). N ng ñ dung d ch DNA t ng s ñư c xác ñ nh trên máy quang ph (SmartSpecTM300, Biorad) bư c sóng λ260/280nm. Ch t lư ng DNA ñư c ki m tra thông qua ñi n di trên agarose gel 0,8% 100V. 2.3. Phân tích ña hình gen leptin l n Ki ng S t ðo n gen leptin (LEP) mã hóa hormone Leptin liên quan ñ n kh năng tích lũy m và ch t lư ng th t l n ñư c ti n hành phân tích ña hình gen b ng k thu t PCR- RFLP. Ph n ng khu ch ñ i DNA ñư c th c hi n d a trên c p primer ñ c hi u LEP1: 5’ CCCTGCTTGCAGTTGGTAGC 3’và LEP2: 5’ CTGCCACACAAGTCTTGCTC 3’ (Lê Th Thúy và cs, 2004), s n ph m khu ch ñ i có kích thư c 658 bp. PCR ñư c th c hi n trong 25 l g m 1,25 ñơn v Taq DNA polymerase, 10 pmol m i lo i primer, 1× ñ m PCR, 200 M dNTPs, 2 mM MgCl2 và 200 ng DNA t ng s . ði u ki n PCR: 94oC/4 phút; ti p theo là 30 chu kỳ: 94oC/1 phút, 68oC/1 phút và 72oC/1 phút; cu i cùng 72oC/10 phút. S n ph m PCR ñư c ki m tra b ng ñi n di trên agarose gel 1% 100V. S n ph m PCR c a gen leptin ñư c phân tích ña hình b ng k thu t RFLP v i Hind III (Lê Th Thúy và cs, 2004). Ph n ng ñư c th c hi n trong 25 l bao g m 1× ñ m, 5 ñơn v Hind III, 20 µl s n ph m PCR và ñư c qua ñêm 37oC, sau ñó ñi n di trên agarose gel 2% 80V. 2.4. Phân tích ña hình gen PSS l n Ki ng S t ðo n gen ryr-1 ch a ñ t bi n C → T kích ho t gen PSS ñư c khu ch ñ i b ng k thu t PCR v i c p primer PSS1: 5’-TCCAGTTTGCCACAGGTCCTACCA-3’ và PSS2: 5’-TTCACCGGAGTGGAGTCTCTGAGT-3’ (O’Brien và cs- 1993), s n ph m PCR có kích thư c 659bp. PCR ñư c th c hi n trong 25 l g m 1,25 ñơn v Taq DNA polymerase, 10 pmol m i lo i primer, 1× ñ m PCR, 200 M dNTPs, 2 mM MgCl2 và 168
  3. 200 ng DNA t ng s . ði u ki n PCR: 94oC/4 phút; ti p theo là 30 chu kỳ: 94oC/1 phút, 68oC/1 phút và 72oC/1 phút; cu i cùng 72oC/10 phút. S n ph m PCR ñư c ki m tra b ng ñi n di trên agarose gel 1% 100V. S n ph m ph n ng khu ch ñ i ñư c ti n hành phân tích ñ t bi n b ng k thu t RFLP v i BsiHKA I (Band và cs 2005). Ph n ng ñư c ti n hành trong 25 l bao g m 1× ñ m, 5 ñơn v enzyme BsiHKA I, 20 µl s n ph m PCR. H n h p dung d ch ph n ng ñư c qua ñêm 37oC, sau ñó ñi n di trên agarose gel 2% 80V. 3. K t qu và th o lu n 3.1. Khu ch ñ i PCR gen leptin và PSS Hình 1. ði n di s n ph m PCR A: gen leptin, B: gen PSS, M: thang chu n DNA (1kb), 1-9: các m u máu l n Ki ng S t. N ng ñ các thành ph n trong ph n ng PCR có vai trò r t quan tr ng, quy t ñ nh hi u qu c a ph n ng khu ch ñ i. K t qu cho th y s khu ch ñ i thành công DNA c 9 m u DNA c a l n. Trong ñó, vi c s d ng c p primer LEP1 và LEP2 ñã nhân ñư c ño n gen có kích thư c kho ng 658 bp (Hình 1A). Ngoài ra, các ño n gen kích thư c kho ng 659bp cũng ñã ñư c phát hi n trên hình nh ñi n di khi s d ng c p primer PSS1 và PSS2 (Hình 1B). 3.2. Xác ñ nh ña hình gen leptin và PSS l n b ng k thu t RFLP K t qu xác ñ nh ña hình gen leptin trên 9 m u c a l n Ki ng S t ñư c trình bày hình 2A. Ki u gen AA cho 1 băng có kích thư c 658 bp; ki u gen GG cho 2 băng có kích thư c 491 bp và 167 bp; ki u gen GA cho 3 băng có kích thư c 658 bp, 491 bp và 167 bp. Như v y, có th th y r ng trong 9 m u ñư c nghiên c u ña hình gen leptin, t n s ki u gen AA chi m t l cao nh t (77,78%), ki u gen GA và GG chi m t l th p (11,11%). Nghiên c u c a Lê Th Thúy và cs (2004) cũng cho th y 2 gi ng l n n i ñ a (l n Móng Cái và l n B n), t n s ki u gen AA là r t cao (100% ñ i v i l n B n và 85% ñ i v i l n Móng Cái), t n s ki u gen GA l n Móng Cái ch chi m 15%, ki u 169
  4. gen GG hoàn toàn không xu t hi n c 2 gi ng l n n i nói trên. Trong khi ñó, k t qu nghiên c u c a Lê Th Thúy và cs (2004) cũng ch ra r ng ki u gen GG liên quan ñ n tính tr ng ch t lư ng th t t t (t l n c cao) và kh năng tăng tr ng nhanh l n. Như v y, vi c nghiên c u ña hình gen leptin l n Ki ng S t có giá tr r t l n trong vi c phát hi n nh ng ñ i tư ng mang gen có ti m năng cho ch t lư ng th t t t, t ñó góp ph n ñ nh hư ng phát tri n ñàn gi ng l n b n ñ a ñáp ng yêu c u ngày càng cao c a ngư i tiêu dùng. Hình 2. K t qu ph n ng c t h n ch s n ph m PCR A: gen leptin, B: gen PSS, M: thang chu n DNA (1 kb), 1-9: các m u máu l n Ki ng S t. K t qu nghiên c u ña hình gen PSS trên 9 m u c a l n Ki ng S t cho th y h u h t các m u nghiên c u ñ u có ki u gen ñ ng h p t NN, ch có 1 m u có ki u gen d h p t Nn. ð c ñi m này ñư c nh n d ng thông qua k t qu ph n ng c t h n ch . V i ki u gen NN, s n ph m PCR c a gen PSS dài 659 bp ñư c enzyme BsiHKA I c t thành 2 phân ño n có kích thư c là 524 bp và 135 bp. Trong trư ng h p ki u gen PSS là Nn, s n ph m PCR s ñư c enzyme h n ch BsiHKA I c t thành 4 phân ño n có kích thư c 534 bp, 358 bp, 166 bp và 135 bp (Hình 2B). Theo Franco và cs (1998) (trích d n theo Band và cs 2005), s hi n di n c a allele n s làm tăng kh năng m t nư c cơ bán m c, làm gi m ch t lư ng th t. Ngoài ra, nghiên c u c a Lundstrom và cs (1995) cũng cho th y gen PSS gây tác ñ ng ñ n ch t lư ng c a cơ dài lưng, làm gi m ñ m m c a th t. Theo k t qu nghiên c u c a Fisher và cs (2000), th t t l n mang ki u gen Nn thư ng ít m m hơn và có màu tái hơn so v i th t c a các con l n mang ki u gen NN. Như v y, vi c s d ng các ch th phân t có th giúp ch n l c các cá th mang gen quy ñ nh các ñ c tính mong mu n. Các k t qu nghiên c u v ña hình gen leptin và PSS l n có th giúp lo i b các cá th mang ki u gen làm gi m ch t lư ng th t. T ñó các nhà ch n gi ng có cơ s ñ qu n lý, b o t n và phát tri n ñàn gi ng theo t ng m c tiêu c th , ph c v t t hơn cho ngành nông nghi p nói chung và ngành công nghi p th t nói riêng. 170
  5. 4. K t lu n ðã khu ch ñ i thành công và xác ñ nh ñư c ña hình gen leptin và PSS l n Ki ng S t. Trong 9 m u DNA t ng s c a l n Ki ng S t ñư c nghiên c u ña hình gen leptin, t n s ki u gen AA chi m t l cao nh t (77,78%), ki u gen GA và GG chi m t l th p (11,11%). Ngoài ra, k t qu phân tích ña hình gen PSS cũng cho th y h u h t các m u nghiên c u ñ u có ki u gen ñ ng h p t NN, ch có 1 m u có ki u gen d h p t Nn. K t qu nghiên c u này là d li u quan tr ng trong công tác phát tri n gi ng l n Ki ng S t theo ñ nh hư ng cho ch t lư ng th t cao, ñ ng th i là cơ s ñ ñưa ra các phương th c b o t n ngu n gen quý gi ng l n b n ñ a. TÀI LI U THAM KH O [1]. Band GO, Guimaraxes SEF, Lopes PS, Schierholt AS, Silva KM, Pires AV, Jusnior AAB, Gomide LAM, Relationship between the porcine stress symdrome gene and pork quality traits of pig F2 resulting from divergent crosses, Genetics and Molecular Biology, 28(1), (2005), 88-91. [2]. Fisher P, Mellett, FD and Hoffman LC, Halothane genotype and pork quality. 1. Carcass and meat quality traits from the three halothane genotypes, Meat Science, 54, (2000), 97-105. [3]. Fujii J, Otsu K, Zorzato F, et al, Identification of a mutation in porcine ryanodine receptor associated with malignant hyperthermia, Science, 253, (1991), 448–451. [4]. Hardge T, Kopke K, Wimmer K, Asociation between polymorphism of the Leptin gene (LEP) and performace traits in a porcine resource family and in comercial outbred population, Animal Genetic, 29, (1998), 60-74. [5]. Kuryl J, Kapela SW, Pierzchala M, Bocian M, Grajewska S, A relationship between genotypes at the GH and LEP loci and carcass meat and fat deposition in pigs, Animal Science, 21, (2003), 15-26. [6]. Lê Th Thúy, Lưu Quang Minh, Tr n Thu Th y, Nguy n Tr ng Bình, Nguy n Văn Ba, ða hình ki u gen Leptin liên quan ñ n tính tr ng kinh t c a m t s gi ng l n nuôi t i Vi t Nam, T p chí Di truy n h c và ng d ng, s 4, (2004). http://www.sinhhocvietnam.com/vn/modules.php?go=page&name=Pages1&pid=1. [7]. Lundstrom K, Andersson A, and Hansson I, Effect of the RN gene on technological and sensory meat quality in crossbred pigs with Hampshire as terminal sire, Meat Science, 42, (1996), 145-153. [8]. O’Brien PT, Shen H, Cory CR and Zhang X, Use of a DNA-based test for the mutation associated with Porcine Stress Syndrome (malignant hyperthermia) in 10,000 breeding swine, JAVMA, 203, (1993), 842-851. 171
  6. [9]. Sellier P, Genetics of meat and carcass traits, In: Rotschild MF, Ruvinsky A (eds). The Genetics of the Pig. Wallingford, UK, CAB International, (1998), 463–510. STUDY ON THE POLYMORPHISM OF PSS AND LEPTIN GENES RELATED TO PORK QUALITY Ho Trung Thong, Ho Le Quynh Chau College of Agriculture and Forestry, Hue University SUMMARY The aim of this study was to determine the polymorphism of PSS and leptin genotypes associated with pork quality. A total of nine DNA genomic samples of Kieng Sat pig breed were characterized in the genotypes by using the PCR-RFLP technique with specific primers. With regard to leptin genotype polymorphism, the highest frequency belonged to AA genotype (77,78%); the other genotypes (GA and GG) had the equal ratio with 11,11%. Besides, the result of PSS gene polymorphism indicated that the most of samples were homozygote pigs (NN genotype), only 1 carrier was Nn pig. The results will be important for the strategies of future conservation, management and uses of the genetic resource of this indigenous pig breed. Keywords: gene polymorphism, PCR-RFLP, pork quality. 172

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản