Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling Lydie Laure1, Laurence Suel1, Carinne Roudaut1, Nathalie Bourg1, Ahmed Ouali2, Marc Bartoli1, Isabelle Richard1 and Nathalie Danie` le1
1 Ge´ ne´ thon-CNRS FRE3087, Evry, France 2 INRA de Theix, Saint Gene` s Champanelle, France
Keywords CARP; FoxO1; muscle; p21WAF1/CIP1; remodelling
Correspondence I. Richard, Ge´ ne´ thon, CNRS FRE3087, 1 bis rue de l’Internationale, 91000 Evry, France Fax: +33 0 1 60 77 86 98 Tel: +33 0 1 69 47 29 38 E-mail: richard@genethon.fr
(Received 31 July 2008, revised 20 October 2008, accepted 24 November 2008)
doi:10.1111/j.1742-4658.2008.06814.x
In an attempt to identify potential therapeutic targets for the correction of muscle wasting, the gene expression of several pivotal proteins involved in protein metabolism was investigated in experimental atrophy induced by transient or definitive denervation, as well as in four animal models of muscular dystrophies (deficient for calpain 3, dysferlin, a-sarcoglycan and dystrophin, respectively). The results showed that: (a) the components of the ubiquitin–proteasome pathway are upregulated during the very early phases of atrophy but do not greatly increase in the muscular dystrophy models; (b) forkhead box protein O1 mRNA expression is augmented in the muscles of a limb girdle muscular dystrophy 2A murine model; and (c) the expression of cardiac ankyrin repeat protein (CARP), a regulator of transcription factors, appears to be persistently upregulated in every condi- tion, suggesting that CARP could be a hub protein participating in com- mon pathological molecular pathway(s). Interestingly, the mRNA level of a cell cycle inhibitor known to be upregulated by CARP in other tissues, p21WAF1/CIP1, is consistently increased whenever CARP is upregulated. CARP overexpression in muscle fibres fails to affect their calibre, indicating that CARP per se cannot initiate atrophy. However, a switch towards fast- twitch fibres is observed, suggesting that CARP plays a role in skeletal muscle plasticity. The observation that p21WAF1/CIP1 is upregulated, put in perspective with the effects of CARP on the fibre type, fits well with the idea that the mechanisms at stake might be required to oppose muscle remodelling in skeletal muscle.
Muscle atrophy can result from disuse of the organ or be associated with ageing or severe systemic conditions such as diabetes, AIDS and cancer. It is also a feature common to many hereditary muscle diseases, including muscular dystrophies (MDs). Duchenne MD (DMD), caused by mutation in the dystrophin gene, is the most
common form of the disease and is particularly severe: skeletal and cardiac muscles are affected, and the life- span of the patients is seriously impaired [1]. Limb girdle MDs (LGMDs) represent another important subgroup of MD, grouped together on the basis of they all primarily and common clinical
features:
Abbreviations AAV2/1, adeno-associated virus 2/1; Ankrd2, ankyrin repeat domain-containing protein 2; CARP, cardiac ankyrin repeat protein; DAPI, 4¢,6-diamidino-2-phenylindole; DMD, Duchenne muscular dystrophy; EDL, extensorum digitorum longus; FoxO, forkhead box protein O; FP, fluorescent protein; LGMD, limb girdle muscular dystrophy; MAFbx, muscle atrophy F-box protein; MD, muscular dystrophy; MLC-2v, myosin light chain 2v; MLC-f, myosin light chain, fast; MuRF1, muscle RING finger protein 1; NF, neurofilament protein; NF-jB, nuclear factor-jB; qRT-PCR, quantitative RT-PCR; TA, tibialis anterior; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labelling; Ub, ubiquitin; UPS, ubiquitin–proteasome system; YFP, yellow fluorescent protein.
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
669
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
predominantly affect proximal muscles around the scapular and the pelvic girdles [2]. About 20 different forms of LGMD are currently recognized; among the most frequent are LGMD2A, LGMD2B and the sarcoglycanopathies (LGMD2C–F), caused by muta- tion in the calpain 3, dysferlin and sarcoglycan genes, respectively [2].
downregulated [10,11], depending on the atrophic situ- ation considered, and upregulated in hypertrophic con- ditions in heart [12–17] and in skeletal muscle [18–21]. From the functional point of view, in heart cells, CARP overexpression suppresses troponin C and atrial natriuretic factor expression [22], and its interaction with the transcription factor YB1 inhibits the synthesis of the ventricular-specific myosin light chain 2v (MLC- increased 2v) [23]. In vascular smooth muscle cells, CARP expression has been demonstrated to be associ- ated with upregulation of the protein p21WAF1/CIP1, an inhibitor of the cell cycle [24]. Taken as a whole, these findings suggest that CARP coordinates the expression of genes involved in cell structure and proliferation, and could play a role during muscle mass variation.
enzymes), E2
leading to muscle wasting:
specific for
the switch towards
Disuse-induced atrophy and MDs might share some molecular mechanisms that are possibly involved in skeletal muscle wasting. Muscle atrophy results from the negative balance in the ratio between protein syn- thesis and protein degradation, hence leading towards protein wasting. One of the key players in the degrada- tion of myofibrillar proteins is the ubiquitin–protea- some system (UPS) [3]. The elimination process is initiated by labelling of the targeted proteins with mul- tiple ubiquitin molecules, and requires the coordinated action of three classes of enzymes known as E1 (ubiqu- itin-activating (ubiquitin-conjugating enzymes) and E3 (ubiquitin ligases) [4]. The ubiquitin– proteasome cascade is stimulated at many levels in the several conditions expression of proteasome subunits, the hydrolytic activity, and the general substrates ubiquitination [5]. In particular, the 14 kDa ubiquitin carrier protein E2 (E2-14 kDa) and two recently identified E3s, muscle atrophy F-box protein (MAFbx; also commonly called atrogin-1) and muscle RING finger protein 1 (MuRF1; also named TRIM63), are upregulated in many skele- [5]. During atrophy, tal muscle-wasting conditions expression of MAFbx and MurF1 is stimulated by the forkhead box protein O (FoxO) family of transcription factors, through inhibition of the Akt pathway [6,7]. it was also shown that transcriptional In addition, stimulation of MuRF1 is under the control of the nuclear factor-jB (NF-jB) pathway [8].
In an attempt to identify hub proteins that may be potential diagnostic markers or even therapeutic tar- gets for the correction of muscle wasting, the expres- sion of pivotal proteins involved in all the mechanisms discussed previously was investigated in denervation- induced atrophy, as well as in three animal models of LGMD and in the mdx mouse, a DMD model. Our study demonstrates that: (a) the UPS is transiently upregulated after denervation, consistent with its known role in atrophy, but it does not seem to be greatly activated in MD; (b) FoxO1 is a biological marker the LGMD2A murine model; and (c) among all the genes considered, the expression of CARP, together with its downstream target, p21WAF1/CIP1, appears to be the only one that system- atically increases. CARP overexpression in muscle fibres fails to induce an atrophic phenotype, indicating that CARP per se cannot initiate the phenomenon. fast-twitch fibres Nonetheless, observed in this situation, together with the observa- tion that the p21WAF1/CIP1 expression pattern seems to reflect CARP level, suggests that CARP might play a role in muscle plasticity.
Results
The proteasome pathway components are only transiently upregulated, whereas increased CARP expression is maintained throughout denervation-induced-atrophy
The expression of several factors possibly involved in atrophy was investigated by the evaluation of their mRNA level by quantitative RT-PCR (qRT-PCR) in conditions leading to transitory or definitive atrophy. The genes studied were those encoding: (a) two tran- scription factors involved in the control of muscle mass: NF-jB-p65 and FoxO1; (b) several components
Even though the literature largely explores the con- vergent role of the UPS components in atrophy, mus- cle wasting is a complex mechanism in which specific, although poorly understood, pathways could play a role. In particular, cardiac ankyrin repeat protein (CARP) was suggested to be involved in these pro- cesses. CARP, together with ankyrin repeat domain- containing protein 2 (Ankrd2) and diabetes-related ankyrin repeat protein, forms a family of transcription regulators known as muscle ankyrin repeat proteins. These three isoforms share in their C-terminal region a minimal structure composed of several ankryrin-like domains possibly involved in protein–protein inter- action, PEST motifs characteristics of rapidly degraded protein, and a putative nuclear localization signal. CARP is expressed in both cardiac and skeletal mus- cles, and was reported to be either upregulated [9] or
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
670
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
the UPS – ubiquitin (Ub), E2-14 kDa,
lost
after
21 days of
two E3 of ubiquitin ligases, MuRF1 and MAFbx, and the C2, C8 and C9 subunits of the proteasome; and (c) CARP, a transcriptional regulator associated with perturbation of muscle mass. Transient or chronic denervation of the posterior limb was induced and the mRNA levels were measured in tibialis anterior (TA) muscles at four different times following the initiation of the treat-
ments (days 3, 9, 14 and 21). Atrophy was efficiently triggered by the treatment, as 40% of the TA weight was chronic denervation (Fig. 1A). When denervation was only transient, the TA weight also initially decreased, but slowly increased again from day 14 while innervation occurred [25] (sta- tistically higher than chronic denervation from day 14 to day 21, P < 0.05).
A
50 50 50 50
45 45 45 45
) ) g g m m
40 40 40 40
Control
*
35 35 35 35
Transient
i i
*
30 30 30 30
Definitive
*
25 25 25 25
( ( t t h h g g e e w w A A T T
20 20 20 20
*
*
15 15 15 15
Day 3 Day 3 Day 3 Day 3
Day 9 Day 9 Day 9 Day 9
Day 14 Day 21 Day 14 Day 21 Day 14 Day 21 Day 14 Day 21
B
NF-kB
FoxO1
l l
l l
400 400 400
*
**
o o r r t t
o o r r t t
*
300 300 300
n n o o c c f f
**
n n o o c c f f
200 200 200
100 100 100
o o % %
o o % %
300 300 300 300 250 250 250 250 200 200 200 200 150 150 150 150 100 100 100 100 50 50 50 50
0 0 0
0 0 0
T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21
T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21
Ubiquitin
E2
150 150 150
l l
150 150 150
l l
o o r r t t
o o r r t t
**
100 100 100
100 100 100
*
*
**
n n o o c c f f
n n o o c c f f
*
*
50 50 50
*
**
50 50 50
*
o o % %
o o % %
0 0 0
0 0 0
T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21
T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21
C2
C8
200 200 200
l l
200 200 200
*
l l
o o r r t t
o o r r t t
150 150 150
150 150 150
100 100 100
100 100 100
n n o o c c f f
n n o o c c f f
*
* **
50 50 50
50 50 50
o o % %
o o % %
0 0 0
0 0 0
T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21
T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21
MuRF1
C9
l l
200 200 200
**
1000 1000 1000
l l
*
** **
150 150 150
100 100 100
100 100 100
*
10 10 10
50 50 50
o o r r t t n n o o c c f f o o % %
o o r r t t n n o o c c f f o o % %
0 0 0
1 1 1
T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21
T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21
MAFbx
CARP
10 000
l l
100 000
l l
**
** **
** **
**
*
**
10 000
*
1000
**
**
1000
100
100
10
o o r r t t n n o o c c f f o o % %
10
o o r r t t n n o o c c f f o o % %
1
1
T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 T0 T3 T9 T14 T21 D0 D3 D9 D14D21
T0 T3 T9 T14T21 D0 D3 D9 D14D21 T0 T3 T9 T14T21 D0 D3 D9 D14D21 T0 T3 T9 T14T21 D0 D3 D9 D14D21
Fig. 1. Effect of transient or definitive denervation on muscle weight and gene expression profiles. Male mice of the 129SvPasIco strain were treated transiently (T) by crushing or definitively (D) by section of the sciatic nerve. Samples were taken from six animals on each date (control, 3, 7, 9, 14 and 21 days after nerve injury). (A) Weight of TA muscles from control, crushed and sectioned limbs (n = 6 per time point). Other muscles of the lower limb, such as EDL and soleus muscles, present similar proportional loss of weight. P-values are shown as *P < 0.05 for significance between control and each time point, and as hP < 0.05 for significance between tran- sient and definitive denervation. (B) Each graph demonstrates the expression level for a gene of interest (FoxO1, NF-jB-p65, Ub, E2-14 kDa, C2, C8, C9, MuRF1, MAFbx and CARP ) as assessed by qRT-PCR in TA muscles of treated animals (n = 2–6 for each time point). Results are expressed as percentage of expression level measured in the respective sham-operated muscles. *P < 0.05 and **P < 0.01 for significance between control and each time point; hP < 0.05 for significance between transient and definitive denervation.
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
671
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
was upregulated to very similar levels in every muscle of the C3-null strain (about two-fold over control, with P < 0.05 for quadriceps, EDL and psoas), whereas its expression was slightly decreased in all the other models (Fig. 2).
The expression of Ub was not affected in any of the four pathologies considered, whereas that of E2-14 kDa showed a tendency to decrease in several muscles (Fig. 2). In the mdx4Cv model, the levels of the three proteasome subunits (C2, C8 and C9) were affected, C2 and C8 being downregulated and C9 upregulated. Unexpectedly, considering their role in atrophy, neither MuRF1 nor MAFbx expression increased in these animal models, their levels being even significantly reduced in some cases (Fig. 2).
The results showed that, with both transient and definitive denervation, FoxO1, NF-jB-p65 and several components of the UPS (subunits C2, C8 and C9, and the two E3s MuRF1 and MAFbx) were immediately and transiently upregulated, with higher variations in the case of the two E3s (note the logarithmic scale) increase, their expression Fig. 1B). After this initial returned rapidly to normal levels, even displaying a slight reduction for every proteasome subunit consid- ered (C2, C8 and C9). Ubiquitin mRNA levels decreased very early during the time course of atrophy, remaining very low when denervation was definitive, but progressively increasing again from the start of reinnervation when the sciatic nerve was only crushed (Fig. 1B). E2-14 kDa expression, which remained sta- ble when atrophy was only transient, was reduced at late stages (from day 14) of definitive denervation- induced atrophy (Fig. 1B). CARP expression increased with atrophy (Fig. 1B). Whereas CARP expression slowly decreased back to control level with the reduc- tion of atrophy in transient denervation, it stayed high when sciatic nerve regeneration was prevented. CARP upregulation was particularly important, as reflected by the logarithmic scale.
The most remarkable effect observed herein was robust upregulation of CARP mRNA (note the loga- rithmic scale) in most muscles of all models of MDs (Fig. 2). Interestingly, this increase seemed to be higher in the muscles strongly affected by the pathologies. The increase was far more important in the Sgca-null and in the mdx4Cv models, two dystrophies character- ized by a similar pathogenesis and caused by a defect in one of the components of the dystrophin-associated glycoprotein complex.
CARP is robustly upregulated in murine MDs, whereas FoxO1 expression is increased specifically in C3-null animals
CARP is expressed at the protein level in myofibres of denervation-induced atrophy models and in mononucleated cells of highly regenerative MD animals
indeed important,
enough. The
protein was
the mRNAs measured in The expression levels of denervation conditions were also compared by qRT- PCR in several models of MD: a natural model of dysferlin deficiency [26], which we backcrossed on a C57BL/6 background and renamed B6.A/J-dysf prmd (model for LGMD2B), and three engineered models deficient in either dystrophin (mdx4Cv [27]), calpain 3 (C3-null; unpublished), or a-sarcoglycan (Sgca-null [28]), models of DMD, LGMD2A and LGMD2D, respectively. Every strain was used at an age where the symptoms of the disease are detectable (4 months of age for all models except C3-null mice, which were evaluated at 7 months of age) and was compared to its respective control breed. The levels of mRNA expres- sion were measured in five muscles [quadriceps, extensorum digitorum longus (EDL), TA, soleus and psoas], chosen in order to reflect the muscle impair- ment specificity – which varies between models – and the type of fibres composing the muscle (see Experi- mental procedures).
The results of qRT-PCR showed that the level of NF-jB-p65 was slightly increased in specific muscles of every murine model, especially in the two most inflam- matory models, mdx4Cv and Sgca-null (Fig. 2). FoxO1
Among all the genes whose expression was investi- gated in the different models of muscle disorder, we demonstrated that the CARP gene was the only one whose expression systematically increased, which is consistent with CARP’s role as a hub protein partici- pating in common pathological molecular pathway(s). CARP protein expression was hence measured by western blot in conditions of denervation-induced atrophy and in murine models of MD (Fig. 3). Inter- estingly, we observed that the protein was detected by western blot provided that the mRNA level reached 60-fold over the basal condition. This ele- ment probably accounts for the inability to detect in which its mRNA CARP in many conditions upregulation is although not therefore important detected from day 3 in both denervation conditions, remaining high until day 21 when the sciatic nerve was sectioned, but dropping to undetectable levels when reinnervation occurred during transient dener- vation (Fig. 3A, upper left panel). As regards the murine models of dystrophies, CARP protein was
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
672
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
Fig. 2. Gene expression profiles in murine models of MD. Each graph demonstrates the expression level for a gene of interest (FoxO1, NF-jB-p65, Ub, E2-14 kDa, C2, C8, C9, MuRF1, MAFbx and CARP ) as assessed by qRT-PCR in quadriceps, EDL, TA, soleus and psoas muscles of C3-null, B6.A/J-dysf prmd, Sgca-null and mdx4Cv animals (n = 3–4 for each point). Results are expressed as percentage of expres- sion level measured in the respective control muscles (129svPasIco and C57BL/6). P-values for significance between wild-type and deficient animals: *P < 0.05 and **P < 0.01.
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
673
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
A
CARP
Ponceau red
T0 T3 T9 T14
T21 D3 D9 D14 D21
C3-null 129SvPasIco T3
CARP
Ponceau red
C57BL/6
Sgca-null
T3
C57BL/6 B6.A/J-Dysf T3
mdx4cn
B
mdx4cn
Sgca-null
Day3 after denervation
Control
C 255.0
2550
Control
Denervated
0.0
0.0
1
1
4
4
4
4
0
0
.
0
.
0
p
p
i
x
i
x
e
e
l
s
l
s
1 5 6 0 . 0 p i x e l s
1 5 6 0 . 0 p i x e l s
D
mdx4cn
Control
Sgca-null
50 µm
50 µm
50 µm
E
CARP
Pax7
Merge
lower
detected in Sgca-null animals only (Fig. 3A, left panel).
In order to clarify CARP cellular distribution within the protein was
immunodetection of
the muscle,
performed on sections of muscles from denervated (3 days after denervation), a-sarcoglycan-deficient and dystrophin-deficient animals, and their appropriate control strains. Specificity of the CARP antibody was
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
674
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
Fig. 3. Analysis of CARP protein level and cellular localization in denervation-induced atrophy and in murine models of MD. (A) In conditions of both transient (T) and definitive (D) denervation, the level of expression of CARP protein was assessed on equivalent amounts of lysate proteins resolved by western blot. The standardization of the loading was verified by Ponceau red staining. The expression of CARP protein correlates perfectly with the mRNA profile. The expression of CARP protein was estimated by the same method in the psoas muscle (all models but C3-null) or the deltoid muscle (C3-null mice) of the different MD models (comparison made in each case with the adequate wild- type strain). We previously verified that the upregulation of the level of CARP transcripts is similar in both deltoid and psoas in the C3-null strain (five-fold over wild-type control, data not shown). The results show that the upregulation of the expression of CARP protein can be visualized in the Sgca-null model only. (B) CARP was detected by specific immunostaining (in green) on transverse sections of control (129svPasIco), denervated (129svPasIco), Sgca-null and mdx4Cv muscles. Staining with dystrophin (in red) was used to delimit the fibres. A view of each muscle taken with a 40· objective is presented, showing the very specific staining observed within clusters of small myofibres. Scale bars: 30 lm. (C) Surface plots representing the density of pixels from whole muscle sections after immunostaining show that CARP expression increases after denervation. Original images were processed using IMAGEJ software (8-bit images, Fire look-up table; http://rsb. info.nih.gov/ij/). (D) Very intense foci of mononucleated cells are observed in Sgca-null and mdx4Cv muscles, but not in control muscles. Scale bars: 50 lm. (E) Costaining for CARP and Pax7 shows that the cells identified in (D) are positive for Pax7.
shown). Whereas MLC-f expression was inversely correlated with CARP level in denervated animals, its even slightly level was generally unaffected, or increased, in muscles of MD models (data not shown). As neither MLC-2v nor MLC-f expression were corre- lated consistently with CARP level, neither of these proteins seems to be involved in the CARP signalling pathway in skeletal muscle. In contrast, in both dener- vation and MD models, p21WAF1/CIP1 gene expression paralleled the CARP profile, i.e. increased when muscle degeneration occurred, and progressively decreased back to control level during the reinnervation phase of transient denervation (Fig. 4). It is worth mentioning that p21WAF1/CIP1 upregulation was of the same order of magnitude as CARP upregulation, as reflected by the logarithmic scale.
CARP overexpression in wild-type mouse TA muscle does not induce atrophy, but alters fibre type composition
first confirmed by the very specific staining observed in cultured HER911 cells transfected with a plasmid encoding CARP (data not shown). In all sections (con- trol, denervated and MD animals), intense staining was seen within scattered clusters of small myofibres (Fig. 3B). No difference in the number of these clusters was observed between conditions, indicating that the increase in CARP expression did not originate from these cells. In denervation-induced atrophy, additional diffuse checked-pattern staining of higher-calibre fibres was also detected, with a higher intensity in denervated muscles than in control sections (Fig. 3C). Considering the dystrophic process present in Sgca-null and mdx4Cv animals, it is difficult to evaluate whether such upregu- lation also occurred in these models. In any case, very intense foci corresponding to the cytoplasm of small round cells flanking the muscle fibres were observed in Sgca-null and mdx4Cv animals (Fig. 3D). These cells expressed Pax7, the first transcription factor activated during myogenesis (Fig. 3E). Immunostaining of the neurofilament protein (NF) failed to reveal any colo- calization with CARP (data not shown).
The p21WAF1/CIP1 gene expression profile parallels CARP in both MD and denervation-induced atrophy models
level of mRNA in the
control
In an attempt to dissect the molecular mechanisms activated downstream of the CARP gene, the gene expression of three relevant target genes chosen on account of CARP targets in cardiac and vascular tis- sues was measured by qRT-PCR in both denervation and MD models: the slow isoform of myosin light chain MLC-2v [23], its paralogous gene in skeletal muscle fast fibres, myosin light chain, fast (MLC-f), and the cell cycle inhibitor p21WAF1/CIP1 [24]. Although it was previously reported to be expressed at low levels in skeletal muscle [29], MLC-2v gene expression remained undetectable in our conditions (data not
Considering that the upregulation of CARP persisted in definitive denervation and was consistent in MD models, we tried to understand its contribution to these conditions and therefore investigated its func- tion(s) in skeletal muscle. A pseudotyped adeno-associ- ated virus 2/1 (AAV2/1) vector in which the CARP coding sequence is fused with the yellow fluorescent protein (YFP) sequence was injected into the TA mus- cle of normal mice. One month after injection, direct observation of the skinned injected muscle using con- focal fluorescence microscopy allowed the visualization of a high level of YFP fluorescence. Measurement of the level of CARP mRNA by qRT-PCR confirmed strong expression of the transgene (more than 60 times the experiment, P < 0.01; Fig. 5A,B). This was indeed reflected by the appearance of a band corresponding to CARP expres- sion in western blots (Fig. 5C).
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
675
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
p21WAF1/CIP1
p21WAF1/CIP1
Fig. 4. Gene expression profiles of p21WAF1/CIP1 after transient or definitive denervation and in murine models of MD. The gene expression of p21WAF1/CIP1 was measured by qRT-PCR in TA muscles subjected to denervation-induced atrophy (n = 2–6 for each time point), and in quadri- ceps, EDL, TA, soleus and psoas muscles of the four MD models (n = 3–4 for each point). T, transient denervation; D, definitive denervation. Results are expressed as percentage of expression level measured in the respective control muscles for MDs (129svPasIco and C57BL/6) or in the sham-operated muscles for denervation models. In every situation, p21WAF1/CIP1 gene expression reflects CARP level.
investigated components of
We next investigated whether any phenotype was apparent following CARP expression. In these condi- tions, the TA muscle weight was not affected (Fig. 5D). The histological appearance of the muscles (Fig. 5E). Morphometric analyses per- was normal formed on sliced muscles (Fig. 5F) revealed no differ- ences in terms of number or mean diameter of fibres in comparison with the untreated control, although the slight switch of the curve detected in the presence of CARP might reflect a tendency to generate bigger fibres. Muscle sections were negative for terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) staining, a marker of apoptosis (data not shown). As members of the CARP family were recently suggested to play a role in fibre typing [30], sections was performed immunohistochemistry of slow myosin. A shift using an antibody against towards a reduction of slow-twitch fibre type was observed in the presence of CARP (P < 0.05; Fig. 5G).
First, in line with their documented role in atrophy [31–33], we demonstrated that the expression levels of most the UPS increase transitorily during transient and definitive denervation. However, the mRNA expression levels of both Ub and E2-14 kDa, previously reported to be upregulated in atrophic conditions [5], do not increase, suggesting that neither protein is rate-limiting in this atrophic situa- tion. Consistent with this result, the role of E2-14 kDa has lately been reconsidered, as the inactivation of the corresponding genes does not seem to induce atrophy resistance, at least in the conditions tested [34]. In con- trast to the denervation situation, the mRNA expres- sion levels of the UPS elements were almost never increased in the four MDs tested, suggesting that the UPS is not overly activated in these diseases. Whether this reflects the slow progression of the diseases with respect to the atrophy phenomenon or weak involve- ment of the UPS in the pathogenesis remains to be determined.
Discussion
in an attempt
In this study, to identify proteins involved in the physiopathology of muscle wasting, we examined the variation in the expression levels of sev- eral atrophy-associated genes during transient and definitive denervation and in four models of MD. The main results gained from these studies are: (a) that the levels of essential components of the UPS are aug- mented rapidly and transiently during denervation- induced atrophy, but are not elevated in most MD muscles; (b) that FoxO1 mRNA expression is signifi- cantly increased in an LGMD2A model; and (c) that CARP is robustly upregulated in numerous murine MD models and in denervation-induced atrophy.
Second, FoxO1 was demonstrated to be specifically upregulated in every muscle of the C3-null strain. Besides raising the interesting possibility that FoxO1 could be used as a diagnostic marker for LGMD2A, our results indicate that FoxO1 expression increases as the absence of calpain 3, either a consequence of because of a functional relationship between the two proteins, or by a specific pathophysiological mecha- nism unique to calpain 3 deficiency. Regardless of its cause, this upregulation of FoxO1 is very likely to play an important role in the atrophy observed in this dis- ease, as its in vivo overexpression was previously dem- onstrated to induce reduction of muscle mass [6,35]. However, this phenomenon does not seem to proceed through MuRF1 and MAFbx, as their expression levels did not increase in our C3-null strain, but might
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
676
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
A
B
25 000
l
**
20 000
e v e
l
) l o r t
15 000
**
n o c f
10 000
o %
(
5000
A N R m P R A C
0
Control
CARP
C
WB CARP
Ponceau red
Control
+ CARP
E
D
60
) g m
40
( t
i
20
h g e w A T
0
Control
+CARP
Control
+ CARP
F
G h c t i
Control
w
100
t -
+ CARP
80
*
l
n o
w o s f
60
o
A T / r e b m u n
40
i
i t c e s / s e r b
e r b F
i f
20
r e b m u n
900 800 700 600 500 400 300 200 100 0
0
Control
+ CARP
n a e M
0–10
10–20
20–30
30–40
40–50
80–90
50–60
60–70
70–80
100–110 90–100
Fibre diameter (µm)
Fig. 5. Effect of CARP overexpression in muscle. (A) One month after intramuscular injection of AAV–CARP–FP into the TA muscle, trans- duction efficiency was visualized by fluorescence microscopy. Note that most observable fibres expressed the construct, apart from a few negative fibres, which reflected the fluorescence background level. Scale bar: 50 lm. (B) The level of CARP transcript overexpression was evaluated by qRT-PCR. Results are expressed as percentage of expression level measured in untransduced control muscles. n = 5–7; **P < 0.01 for significance between AAV–CARP–FP-injected TA muscle and contralateral control. (C) Expression of CARP protein was evalu- ated by western blot. Equivalent amounts of proteins were resolved, and Ponceau red staining was also used to confirm the standardization of the loading. (D) Weights of injected TA muscles (n = 13) were compared to those of control samples. No significant difference was observed. (E) Histological analyses of muscles. Frozen sections of injected TA muscles (right panel) stained with haematoxylin–phloxin–sa- fran show features identical to normal sections (left panel). Scale bars: 20 lm. (F) Morphometric analysis of muscles overexpressing CARP. The number of fibres and their minimum diameter in injected muscles are not significantly different as compared to the control (n = 4). (G) Slow fibres were detected using slow myosin immunostaining, and their numbers were determined on three slices of the TA muscle mid- section. The number of slow fibres is reduced significantly (*P < 0.05) in CARP-expressing muscles as compared to noninjected muscles, indicating that CARP can influence the fibre type (n = 6).
instead involve other FoxO1-dependent signalling cascades, such as the autophagy pathway [36–38] and/ or the control of satellite cell proliferation [39], two mechanisms important for muscle mass regulation [40].
Provided that upregulation of FoxO1 is found also in LGMD2A patients, it seems highly likely that imped- ing FoxO1 increase and/or inhibiting its activity might improve the phenotype.
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
677
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
that
els, which suggests that either p21WAF1/CIP1 is not inhibiting the cell cycle or else that the inhibition pro- cess is not entirely efficient. Second, p21WAF1/CIP1 has previously been reported to be upregulated within the myonuclei of denervated muscles, a location where it might be required to protect fibres against denerva- tion-induced apoptosis [50]. Taken as a whole, the findings in the MD and denervation models studied the systematic upregulation of herein suggest p21WAF1/CIP1 whenever CARP expression increases might oppose cell proliferation and/or inhibit apop- tosis, thus preventing muscle remodelling.
Third, the most striking evidence obtained from our investigation is that CARP expression appears to be persistently upregulated in denervation-induced atro- phy and is also elevated in all the MD models investi- gated. This last observation adds to the panel of muscle pathologies already reported to be associated with an increase in CARP expression: DMD, spinal muscular atrophy, facio-scapulo-humeral muscular dystrophy, amyotrophic lateral sclerosis, and peroxisome prolifera- tor-activated receptor-induced myopathy [41], as well as the mdx, Swiss Jim Lambert (SJL) and muscular dystrophy with myositis (MDM) animal models, defi- cient respectively in dystrophin, dysferlin and titin [42– 48]. Overall, CARP seems to be a general marker of muscle damage. The reason(s) for CARP upregulation remain(s) obscure, and whether CARP expression par- ticipates in or represents an attempt to resist the unre- lenting muscle degeneration is an important issue.
It should also be noted that muscle ankyrin repeat proteins, which include CARP, have recently been sug- gested to be important for sarcomere length stability and muscle stiffness and to have an inhibitory role in the regenerative response of muscle tissue [30]. Here, we showed that CARP overexpression induces a switch towards fast-twitch fibres. All of these elements add to the previous observations related to the effects of p21WAF1/CIP1, and support the idea that CARP plays a global role in muscle plasticity. Accordingly, the main- tenance of CARP expression during chronic denerva- tion suggests that this protein plays an active part in this static condition and might contribute actively to the prevention of remodelling through blockade of adaptive pathways during deleterious muscle processes. Interestingly, besides MDs, CARP has been reported to be upregulated in many other pathological tissues [12–17], nephropathic kidneys (hypertrophic hearts [51], and wounded epidermis [52]), which suggests that CARP is a widely spread marker of tissue alterations.
It is of interest that CARP is the only protein show- ing a variation of profile between transient and defini- tive denervation, with persistence of upregulation in the latter condition. The CARP profile precisely reflects muscle atrophy, which could be consistent with the idea that CARP is an important factor in this mechanism. However, several facts support the idea that CARP probably has no active part to play in muscle atrophy per se. First, there is no consistent positive correlation between CARP expression and atrophic situations [9,11], and it can even be upregulated when skeletal muscle mass increases [18–21]. Second, in our hands, CARP overexpression in a normal muscle background failed to induce significant changes in the number and calibre of fibres.
If the consequences of CARP overexpression prove impeding to be detrimental for the skeletal muscle, CARP expression would seem to be especially interest- ing, as CARP expression is increased in many different muscle diseases. Considering that transforming growth factor-b, tumour necrosis factor-a and interleukin-1a are known stimuli of CARP expression, pharmacologi- cally targeting these pathways might be an option. Indeed, as it has already been demonstrated that drug- mediated inhibition of tumour necrosis factor-a [53] or transforming growth factor-b [54] in the mdx mouse model greatly improves the muscle histology, it would be interesting to investigate the role of CARP in these signalling pathways.
Experimental procedures
Animals
Interestingly, although CARP is upregulated to very similar levels in both denervation and MD models, two different CARP expression sites are observed, in Pax7-positive mononucleated cells and within the cyto- plasm of large myofibres, suggesting that CARP plays a role in myogenic activation, as well as in mature fibres. It is possible that a common molecular signal- ling pathway encompassing CARP and p21WAF1/CIP1 occurs at these two locations. Indeed, among the three potential target genes tested herein, the p21WAF1/CIP1 gene is the only one whose expression matches strictly with CARP level. In addition, p21WAF1/CIP1 expression was observed at the same locations (proliferating myo- blasts [49] and terminally differentiated myotubes [50]) as CARP overexpression. First, in the skeletal myo- genic lineage, p21WAF1/CIP1 upregulation leads to the irreversible withdrawal of myoblasts from the cell cycle, stimulates differentiation, and confers protection against apoptosis [49]. However, intense regeneration is still ongoing in both the Sgca-null and mdx4Cv mod-
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
678
All mice were handled in accordance with the European guidelines for the humane care and use of experimental
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
In vivo experiments
animals. The C3-null model corresponds to complete inac- tivation of calpain 3 expression. Exon 1 of the calpain 3 gene has been targeted by an IRES–LacZ–Lox-PGK– hygro–lox cassette to allow the expression of the LacZ transgene and prevent the expression of the calpain 3 gene from the muscle-specific promoter upstream of exon 1. (Sgca-null) model has been The a-sarcoglycan-deficient previously described [28]. The mdx4Cv model is an engi- neered model carrying a missense mutation in exon 53 of the dystrophin gene [55,56] and was obtained from the Jackson Laboratory (Ann Harbor, USA). A/J mice, which have a retrotransposon insertion in intron 4 of the dysfer- lin gene [26], were backcrossed with C57BL/6 for four generations and renamed B6.A/J-dysfprmd. Control mice from the 129SvPasIco and C57BL/6 strains were pur- chased from Charles River Laboratories (Les Oncins, France).
the skin of
B6.A/J-dysfprmd and Sgca-null models and their controls, and aged 7–8 months for the C3-null model and its con- trol. Muscles were chosen in order to reflect the muscle impairment specificity – which varies between models – and the type of fibres composing the muscle. In the C3-null model, the quadriceps muscle is unaffected by the disease, the EDL and TA muscles are weakly affected, and the soleus and psoas muscles are the most strongly affected (C. Roudaut & I. Richard, unpublished data). In the A/J mouse, the first dystrophic signs are seen at 2 months of age, and progress as a function of age. The quadriceps femoris and triceps brachii muscles are the most severely affected, whereas the gastrocnemius, soleus and tibialis anterior muscles show mild histopathology, even at late stages of the disease [26]. Placing the A/J mutation on a C57BL/6 background has no effect on the disease presentation (N. Bourg & I. Richard, unpublished data). In the Sgca-null and mdx4Cv models, every muscle is strongly affected by the disease (even though no con- clusions can be drawn concerning the psoas muscle in the mdx4Cv model, as no data are currently available) [28,56]. The type of fibres forming the muscle differs between muscles: the quadriceps muscle is composed roughly of 50% type 1 fibres and 50% type 2 fibres, the TA and EDL muscles contain about 5–10% type 1 fibres, the soleus muscle is composed exclusively of type 1 fibres, and the psoas muscle is composed exclusively of type 2 fibres.
of genes
ubiquitous France). acidic The
To obtain denervation of the muscle of the lower limb, thigh of 2-month-old male the dorsal 129SvPasIco mice (n = 6 for each time point) was cut, and the posterior muscles were split apart to reveal the sciatic nerve. Chronic denervation was obtained by resec- tion of a 5 mm nerve segment. To avoid regeneration, the proximal end of the nerve was ligatured. In contrast, for transient denervation, the sciatic nerve was crushed for 10 s at midthigh with a no.(cid:2)5 Dumont forceps. This con- dition allows nerve regeneration. In each group, addi- tional animals were sham operated, and their muscles were used as controls. In these animals, the skin was cut, and muscles or sciatic nerves were visualized, but no treatment was applied. TA muscles were sampled 3, 9, 14 and 21 days after denervation. Chronic denervation was checked at the time of muscle excision by visualization of abnormal gait of the limb and by verifying the disconti- nuity of the sciatic nerve at the thigh. The TA, EDL and soleus muscles were sampled at the appropriate times (after 3, 9, 14, 21 days) after transient or definitive dener- vation.
Construction and production of viral vector
isolated from mouse muscle using Total RNA was (Gibco, BRL). cDNA was synthesized Trizol reagent total RNA using the SuperScript first from 1 lg of strand synthesis system for the RT-PCR kit (Invitrogen, Cergy Pontoise, France) and random oligonucleotides. Expression encoding NF-jB-p65, FoxO1, E2-14 kDa, Ub, the C2, C8 and C9 subunits of the pro- teasome, MuRF1, MAFbx, CARP, p21WAF1/CIP1, MLC- 2v and MLC-f was monitored by a real-time qRT-PCR method using TaqMan probes (Perkin Elmer, Courta- boeuf, ribosomal phosphoprotein was used to normalize the data across samples. Its expression was monitored by SYBRGreen incorporation. The primer pairs and TaqMan probes used for amplification are given in Table 1. Each experiment was performed in duplicate and repeated at least twice.
Quantitative RT-PCR
To obtain CARP overexpression in muscle, 2 · 1011 viral genomes suspended in 25 lL of recombinant AAV2/1 viral preparation were injected into the left TA muscle of anaes- thetized 2-month-old 129SvPasIco male mice (n = 13). TA muscles were sampled 1 month after injection, and directly observed using confocal fluorescence microscopy (emission wavelength used for data collection: 514 nm) to allow visualization of YFP fluorescence. Muscles were then quickly frozen in liquid nitrogen.
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
679
The coding sequence of CARP was obtained by PCR amplification using mouse cDNA extracted from muscle of a 129SvTer mouse as a template. The primers used were 5¢-CACCATGATGGTACTGAGAG-3¢ and 5¢-GAA TGTAGCTATGCGAGAGTTC-3¢. The PCR product was first cloned into pcDNA3.1D/V5–His–Topo (Invitrogen), and then transferred, after enzymatic restriction, into an AAV-based pSMD2-derived vector [57], where the CARP Quadriceps, EDL, TA, soleus and psoas muscles were sampled from four animals aged 4 months for the mdx4Cv,
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
Table 1. Primers and probe sets used for qRT-PCR.
Acronym
Name
Accession no.
Upper primer (5¢- to 3¢) Probe (5¢- to 3¢) Lower primer (5¢- to 3¢)
Proteasome subunit C2 (Psma1)
AF060088
C2
Proteasome subunit C8 (Psma3)
AF060089
C8
Proteasome subunit C9 (Psma4)
AF060093
C9
CARP
Cardiac ankyrin repeat protein
NM_013468
E2-14 kDa
Ubiquitin-conjugating enzyme
NM_009458
E2B (Ube2b)
FoxO1
Forkhead box protein O1 (FoxO1)
NM_019739
MAFbx
F-box only protein 32 (Fbox32)
NM_026346
MLC-f
Myosin light chain, fast
BC055869
MLC-2v
Myosin light chain, slow
NM_010861
MuRF1
Tripartite motif-containing 63
NM_001039048
(Trim63)
NM_009045
NF-jB-p65
v-Rel reticuloendotheliosis viral oncogene homolog A (Rela)
P0
Acidic ribosomal phosphoprotein
XR_004667
p21WAF1/CIP1
NM_007669
Cyclin-dependent kinase inhibitor 1A (p21WAF1/CIP1)
Ub
Ubiquitin
X51703
289mC2.F: ATGCAACTTTATGCGCCAGG 313mC2.P: TTTGGATTCCAGATTTGTGTTTGACAGACCA 392mC2.R: GGATCTGGGTTTTGCTTCCA 343mC8.F: TCTTGCAGACAGAGTGGCCA 391mC8.P: CGCTGTTAGACCTTTTGGCTGCAGTTTC 439mC8.R: CGCACTGTAAGACCCCAACA 6mC9.F: TCTGCACCCTCACCGTCTTC 58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: TGGCACTGATTTTGGCTCCT 83E2_14.F: GGGATTTCAAGCGATTGCAA 129E2_14.P: CGCCCCATCTGAAAACAACATCATGC 191E2_14.R: GGTGTCCCTTCTGGTCCAAA 1297mFoxO1.F: CTAAGTGGCCTGCGAGTCCT 1369mFoxO1.P: CCAGCTCAAATGCTAGTACCATCAGTGGGAG 1445mFoxO1.R: GTCCCCATCTCCCAGGTCAT 1235mMafBx.F, CTGGAAGGGCACTGACCATC 1265mMafBx.P, CAACAACCCAGAGAGCTGCTCCGTCTC 1353mMafBx.R, TGTTGTCGTGTGCTGGGATT 396mMLCfast.F: TGGAGGAGCTGCTTACCACG 423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA 500mMLCfast.R: TCTTGTAGTCCACGTTGCCG 381mMLC-2V.F: GAAGGCTGACTATGTCCGGG 403mMLC-2V.P: ATGCTGACCACACAAGCAGAGAGGTTCTC 461mMLC-2V.R: GCTGCGAACATCTGGTCGAT 958mMurf1.F AGGGCCATTGACTTTGGGAC 995mMurf1.P AGGAGGAGTTTACAGAAGAGGAGGCTGATGAG 1047mMurf1.R CTCTGTGGTCACGCCCTCTT M1833p65.F: GGCGGCACGTTTTACTCTTT M1857p65.P: CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT 1584p21.F: GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: GTGCTTTGACACCCACGGTA 22mUbiq.F: TCGGCGGTCTTTCTGTGAG 51mUbiq.P: TGTTTCGACGCGCTGGGCG 96mUbiq.R: GTTAACAAATGTGATGAAAGCACAAA
sequence is placed under the control of a cytomegalovirus promoter and fused at its 5¢-end with YFP and at its 3¢-end with cyan fluorescent protein. This last construct is named pAAV.CMV.CARP-FP. The integrity of all constructs was confirmed by automated sequencing.
inverted terminal
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
680
and AAV65MGB/taq, AAV2/1 viral preparations were generated by packaging AAV2-inverted terminal repeat recombinant genomes in AAV1 capsids using a three-plasmid transfection protocol as previously described [58]. Recombinant vectors were gradient purified by using double caesium chloride ultracentrifugation followed by dialysis against sterile NaCl/Pi. After DNA extraction by successive treatments with DNase I and proteinase K, viral genomes were quantified by a TaqMan real-time PCR assay using prim- ers and probes complementary to the inverted terminal repeat region. The primer pairs and TaqMan MGB probes used for repeat amplification were: 5¢-CTCCATCACTAGGGGTTCCTTGT 1AAV65/Fwd, A-3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC 5¢-GTTAATGATT ATGGC-3¢;
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
Immunofluorescence, histological and morphometric analysis of muscle
AACCC-3¢. Titre is expressed as viral genome per mL (vgÆmL)1).
with Eukitt (fluka) and visualized on a Nikon Eclipse E60 microscope. Digital images were acquired with a 4· objec- tive, a CCD camera (Sony) and a motorized stage. The number of positive muscle fibres was determined on three levels of sections per muscle, with cartograph software (Microvision, Evry, France) (n = 6 for each condition).
in NaCl/Tris at for
Western blot
DNA fragmentation was visualized on muscle transverse sections fixed with 3.7% formalin using the TUNEL tech- (Roche nique according to the manufacturer’s protocol Applied Science, Meylan, France). Muscle slices were mounted in Vectashield containing DAPI for analysis by fluorescence microscopy on a Leica confocal microscope. Positive controls were performed on some sections using 0.5 mgÆmL)1 DNase I room (Sigma) temperature to TUNEL staining. 10 min prior DNase1-treated sections incubated with fluorescein isothio- cyanate-labelled nucleotide mixture, without addition of terminal deoxynucleotidyl transferase, were used as negative controls.
Muscles CARP-specific polyclonal antibodies were obtained by injec- tion of the KTLPANSVKQGEEQRK peptide into rabbits. Horseradish peroxidase-linked donkey anti-(rabbit IgG) and sheep anti-(mouse IgG) antibodies were purchased from GE Healthcare Europe (Saclay, France). from control Cryosections (8 or 10 lm in thickness) were prepared from frozen muscles. Transverse sections were processed for hae- matoxylin–phloxin–safran histological staining. For deter- mination of the number and minimal diameter of fibres, histochemical immunostaining with a rabbit polyclonal antibody against laminin (Dako, Trappes, France; Z0097) was performed to delimit each fibre as follows. Unfixed transverse cryosections were incubated for 30 min with NaCl/Pi/10% fetal bovine serum in order to block unspe- cific sites, and then overnight with a 1 : 1000 dilution of primary antibodies at room temperature. After washing with NaCl/Pi, sections were incubated with a secondary antibody, goat anti-(rabbit Ig) conjugated with horseradish peroxidase (Kit En Vision Rabbit HRP, Dako; K4002) for 30 min at room temperature. Sections were mounted with (Sigma-Aldrich Chimie, Lyon, France) after 4¢, Eukitt 6-diamidino-2-phenylindole (DAPI) staining and visualized on a Nikon Eclipse E60 microscope. Digital images of a slice corresponding to the muscle midsection were acquired with a 4 · objective, a CCD camera (Sony, Clichy, France) and a motorized stage. Images were then analysed with ellix software (Microvision, Evry, France).
IgG)
anti-chicken A11042; dilutions
Statistics
and denervated mice were homogenized using an ultra-turrax T8 in a buffer contain- ing 20 mm Tris (pH 7.5), 150 mm NaCl, 2 mm EGTA, 1% Triton X-100, 2 lm E64 and protease inhibitors (com- plete mini protease inhibitor cocktail; Roche Applied Science). After centrifugation at 10 000 g for 10 min at 4 (cid:2)C, the supernatants were recovered for western blot analysis. The samples were denatured before SDS/PAGE using LDS NuPage buffer (Invitrogen) supplemented with 100 mm dithiothreitol. Protein concentrations were deter- mined by the bicinchoninic acid methodology (Thermo Fisher Scientific, Brebie` res, France). Fifty micrograms of protein samples were subjected to SDS/PAGE in precast 4–12% acrylamide gradient gels (NuPage system; Invitro- gen) and transferred onto poly(vinylidene difluoride) mem- branes (Millipore) by the application of an electric field (100 V, 1 h). The transfer efficiency was evaluated by Ponceau red protein staining (0.2% w/v, in 5% acetic acid). The membranes were probed with antibodies against CARP (dilution 1 : 500). Detection was performed with secondary antibodies (dilution 1 : 10 000) coupled to horseradish peroxidase. Visualization was performed using the SuperSignal West Pico substrate (Pierce). Immunostainings were performed on transverse muscle sections. Unfixed sections were incubated for 60 min at room temperature in Mouse-On-Mouse blocking reagent (Vector; MKB-2213) and then overnight at 4 (cid:2)C with pri- mary anti-CARP IgG (PTC; 11427-1-AP; dilution 1 : 50). After extensive NaCl/Pi washes, sections were incubated first with biotinylated goat anti-(rabbit (Vector; BA-1000; dilution 1 : 500) for 60 min at room temperature and, after additional washes, with streptavidin conjugated with Alexa Fluor 488 (Invitrogen; S11223; dilution 1 : 500). Costainings were performed using various primary anti- bodies [Pax7 (DSHB; Pax7-a-1ea; dilution 1 : 100) and NF (Millipore, Saint-Quentin-en-Yvelines, France; AB5539; dilution 1 : 50)], and detected using antibodies conjugated to Alexa Fluor 594 (Invitrogen; goat anti-mouse A11020 or 1 : 1000). DAPI goat nuclear staining was also performed (Invitrogen; D21490). Sections were mounted with fluoromount-G (CliniSciences, Montrouge, France; 0100-01) and visualized on a Leica confocal microscope. Digital images of a slice correspond- ing to the muscle midsection were acquired with a 40· objective, a CCD camera (Sony) and a motorized stage.
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
681
Slow-fibre staining was performed using the monoclonal antibody anti-skeletal slow myosin, heavy chain (dilution 1 : 1000; Sigma; M-8421) on transverse sections correspond- ing to the muscle midsection according to the protocol of the ARK peroxidase kit (Dako). Sections were mounted Data are presented as means ± standard error of the mean. Individual means and distributions were compared
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
tests, myostatin-stimulated myoblasts. Biochem Biophys Res Commun 326, 660–666.
using the Mann–Whitney and the Kolmogorov–Smirnov nonparametric respectively. Differences were considered to be statistically significant at P < 0.05 or P < 0.01.
11 Stevenson EJ, Giresi PG, Koncarevic A & Kandarian SC (2003) Global analysis of gene expression patterns during disuse atrophy in rat skeletal muscle. J Physiol 551, 33–48.
Acknowledgements
the
technical
12 Aihara Y, Kurabayashi M, Saito Y, Ohyama Y,
Tanaka T, Takeda S, Tomaru K, Sekiguchi K, Arai M, Nakamura T et al. (2000) Cardiac ankyrin repeat pro- tein is a novel marker of cardiac hypertrophy: role of M-CAT element within the promoter. Hypertension 36, 48–53.
expertise excellent We acknowledge I. Adamski, L. Arandel, C. Georger, A. Jollet, of T. Marais, A. Verdot, and L. Van Wittenberghe. We thank Dr M. Barkats and the Howard Hughes Medi- cal Institute for providing us with NF specific antibody and Sgca-null mice (Iowa City, USA), respectively. We are grateful to S. Lupton for checking the language. This work was funded by the Association Franc¸ aise contre les Myopathies.
13 Ihara Y, Suzuki YJ, Kitta K, Jones LR & Ikeda T (2002) Modulation of gene expression in transgenic mouse hearts overexpressing calsequestrin. Cell Calcium 32, 21–29.
References
1 Emery AE (2002) The muscular dystrophies. Lancet 14 Arber S, Hunter JJ, Ross J Jr, Hongo M, Sansig G, Borg J, Perriard JC, Chien KR & Caroni P (1997) MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization, dilated cardiomyopathy, and heart failure. Cell 88, 393–403. 359, 687–695.
2 Daniele N, Richard I & Bartoli M (2007) Ins and outs of therapy in limb girdle muscular dystrophies. Int J Biochem Cell Biol 39, 1608–1624.
15 Zolk O, Frohme M, Maurer A, Kluxen FW, Hentsch B, Zubakov D, Hoheisel JD, Zucker IH, Pepe S & Eschenhagen T (2002) Cardiac ankyrin repeat protein, a negative regulator of cardiac gene expression, is aug- mented in human heart failure. Biochem Biophys Res Commun 293, 1377–1382. 3 Taylor RG, Tassy C, Briand M, Robert N, Briand Y & Ouali A (1995) Proteolytic activity of proteasome on myofibrillar structures. Mol Biol Rep 21, 71–73.
4 Scheffner M, Nuber U & Huibregtse JM (1995) Protein ubiquitination involving an E1–E2–E3 enzyme ubiquitin thioester cascade. Nature 373, 81–83.
16 Miller MK, Bang ML, Witt CC, Labeit D, Trombitas C, Watanabe K, Granzier H, McElhinny AS, Gregorio CC & Labeit S (2003) The muscle ankyrin repeat pro- teins: CARP, ankrd2/Arpp and DARP as a family of titin filament-based stress response molecules. J Mol Biol 333, 951–964.
5 Nury D, Doucet C & Coux O (2007) Roles and poten- tial therapeutic targets of the ubiquitin proteasome sys- tem in muscle wasting. BMC Biochem 8(Suppl. 1), S7. 6 Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh K, Schiaffino S, Lecker SH & Gold- berg AL (2004) Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 117, 399–412.
17 Nagueh SF, Shah G, Wu Y, Torre-Amione G, King NM, Lahmers S, Witt CC, Becker K, Labeit S & Granzier HL (2004) Altered titin expression, myocardial stiffness, and left ventricular function in patients with dilated cardiomyopathy. Circulation 110, 155–162. 18 Carson JA, Nettleton D & Reecy JM (2002) Differential gene expression in the rat soleus muscle during early work overload-induced hypertrophy. FASEB J 16, 207– 209.
7 Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO, Gonzalez M, Yancopoulos GD & Glass DJ (2004) The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell 14, 395–403.
19 Hentzen E, Lahey M, Peters D, Mathew L, Barash I, Friden J & Lieber R (2006) Stress-dependent and independent expression of the myogenic regulatory factors and the Marp genes after eccentric contractions in rats. J Physiol 570, 157–167.
8 Cai D, Frantz JD, Tawa NE Jr, Melendez PA, Oh BC, Lidov HG, Hasselgren PO, Frontera WR, Lee J, Glass DJ et al. (2004) IKKbeta/NF-kappaB activation causes severe muscle wasting in mice. Cell 119, 285–298.
20 Barash IA, Mathew L, Ryan AF, Chen J & Lieber RL (2004) Rapid muscle-specific gene expression changes after a single bout of eccentric contractions in the mouse. Am J Physiol Cell Physiol 286, C355– C364.
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
682
9 Baumeister A, Arber S & Caroni P (1997) Accumulation of muscle ankyrin repeat protein transcript reveals local activation of primary myotube endcompartments during muscle morphogenesis. J Cell Biol 139, 1231–1242. 10 Yang W, Zhang Y, Ma G, Zhao X, Chen Y & Zhu D 21 Chen YW, Nader GA, Baar KR, Fedele MJ, Hoffman EP & Esser KA (2002) Response of rat muscle to acute (2005) Identification of gene expression modifications in
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
33 Sacheck JM, Hyatt JP, Raffaello A, Jagoe RT, Roy resistance exercise defined by transcriptional and trans- lational profiling. J Physiol 545, 27–41. 22 Jeyaseelan R, Poizat C, Baker RK, Abdishoo S,
RR, Edgerton VR, Lecker SH & Goldberg AL (2007) Rapid disuse and denervation atrophy involve transcrip- tional changes similar to those of muscle wasting during systemic diseases. FASEB J 21, 140–155.
Isterabadi LB, Lyons GE & Kedes L (1997) A novel cardiac-restricted target for doxorubicin. CARP, a nuclear modulator of gene expression in cardiac progen- itor cells and cardiomyocytes. J Biol Chem 272, 22800– 22808. 34 Lecker SH (2003) Ubiquitin–protein ligases in muscle wasting: multiple parallel pathways? Curr Opin Clin Nutr Metab Care 6, 271–275. 35 Kamei Y, Miura S, Suzuki M, Kai Y, Mizukami J,
23 Zou Y, Evans S, Chen J, Kuo HC, Harvey RP & Chien KR (1997) CARP, a cardiac ankyrin repeat protein, is downstream in the Nkx2-5 homeobox gene pathway. Development 124, 793–804.
Taniguchi T, Mochida K, Hata T, Matsuda J, Abura- tani H et al. (2004) Skeletal muscle FOXO1 (FKHR) transgenic mice have less skeletal muscle mass, down- regulated type I (slow twitch/red muscle) fiber genes, and impaired glycemic control. J Biol Chem 279, 41114–41123. 36 Zhao J, Brault JJ, Schild A, Cao P, Sandri M,
24 Kanai H, Tanaka T, Aihara Y, Takeda S, Kawabata M, Miyazono K, Nagai R & Kurabayashi M (2001) Transforming growth factor-beta/Smads signaling induces transcription of the cell type-restricted ankyrin repeat protein CARP gene through CAGA motif in vascular smooth muscle cells. Circ Res 88, 30– 36.
Schiaffino S, Lecker SH & Goldberg AL (2007) FoxO3 coordinately activates protein degradation by the autophagic/lysosomal and proteasomal pathways in atrophying muscle cells. Cell Metab 6, 472–483. 37 Mammucari C, Milan G, Romanello V, Masiero E, 25 Lefaucheur JP & Sebille A (1995) The cellular events of injured muscle regeneration depend on the nature of the injury. Neuromuscul Disord 5, 501–509. 26 Ho M, Post CM, Donahue LR, Lidov HG, Bronson Rudolf R, Del Piccolo P, Burden SJ, Di Lisi R, Sandri C, Zhao J et al. (2007) FoxO3 controls autophagy in skeletal muscle in vivo. Cell Metab 6, 458–471.
RT, Goolsby H, Watkins SC, Cox GA, Brown RH Jr (2004) Disruption of muscle membrane and phenotype divergence in two novel mouse models of dysferlin defi- ciency. Hum Mol Genet 13, 1999–2010. 38 Mammucari C, Schiaffino S & Sandri M (2008) Down- stream of Akt: FoxO3 and mTOR in the regulation of autophagy in skeletal muscle. Autophagy 4, 524–526. 39 Rathbone CR, Booth FW & Lees SJ (2008) FoxO3a
preferentially induces p27Kip1 expression while impair- ing muscle precursor cell-cycle progression. Muscle Nerve 37, 84–89. 27 Chapman VM, Miller DR, Armstrong D & Caskey CT (1989) Recovery of induced mutations for X chromo- some-linked muscular dystrophy in mice. Proc Natl Acad Sci USA 86, 1292–1296.
28 Duclos F, Straub V, Moore SA, Venzke DP, Hrstka RF, Crosbie RH, Durbeej M, Lebakken CS, Ettinger AJ, van der Meulen J et al. (1998) Progressive muscular dystrophy in alpha-sarcoglycan-deficient mice. J Cell Biol 142, 1461–1471. 29 Baker PE, Kearney JA, Gong B, Merriam AP, Kuhn
40 Bechet D, Tassa A, Taillandier D, Combaret L & Attaix D (2005) Lysosomal proteolysis in skeletal muscle. Int J Biochem Cell Biol 37, 2098–2114. 41 Casey WM, Brodie T, Yoon L, Ni H, Jordan HL & Cariello NF (2008) Correlation analysis of gene expression and clinical chemistry to identify biomarkers of skeletal myopathy in mice treated with PPAR agonist GW610742X. Biomarkers 13, 364–376.
DE, Porter JD & Rafael-Fortney JA (2006) Analysis of gene expression differences between utrophin/dystro- phin-deficient vs mdx skeletal muscles reveals a specific upregulation of slow muscle genes in limb muscles. Neurogenetics 7, 81–91. 42 Bakay M, Zhao P, Chen J & Hoffman EP (2002) A web-accessible complete transcriptome of normal human and DMD muscle. Neuromuscul Disord 12(Sup- pl. 1), S125–S141. 43 Nakamura K, Nakada C, Takeuchi K, Osaki M,
30 Barash I, Bang ML, Mathew L, Greaser ML, Chen J & Lieber RL (2007) Structural and regulatory roles of the muscle ankyrin repeat protein family in skeletal muscle. Am J Physiol Cell Physiol 293, C218–C227. 31 Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L,
Shomori K, Kato S, Ohama E, Sato K, Fukayama M, Mori S et al. (2002) Altered expression of cardiac anky- rin repeat protein and its homologue, ankyrin repeat protein with PEST and proline-rich region, in atrophic muscles in amyotrophic lateral sclerosis. Pathobiology 70, 197–203. Clarke BA, Poueymirou WT, Panaro FJ, Na E, Dharmarajan K et al. (2001) Identification of ubiquitin ligases required for skeletal muscle atrophy. Science 294, 1704–1708.
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
683
44 Nakada C, Tsukamoto Y, Oka A, Nonaka I, Takeda S, Sato K, Mori S, Ito H & Moriyama M (2003) Cardiac- restricted ankyrin-repeated protein is differentially induced in Duchenne and congenital muscular dystro- phy. Lab Invest 83, 711–719. 32 Zhao J, Zhang Y, Zhao W, Wu Y, Pan J, Bauman WA & Cardozo C (2008) Effects of nandrolone on denerva- tion atrophy depend upon time after nerve transection. Muscle Nerve 37, 42–49.
L. Laure et al.
Cardiac ankyrin repeat protein in muscle plasticity
45 Nakada C, Oka A, Nonaka I, Sato K, Mori S, Ito H & Moriyama M (2003) Cardiac ankyrin repeat protein is preferentially induced in atrophic myofibers of congeni- tal myopathy and spinal muscular atrophy. Pathol Int 53, 653–658. 52 Shi Y, Reitmaier B, Regenbogen J, Slowey RM, Opale- nik SR, Wolf E, Goppelt A & Davidson JM (2005) CARP, a cardiac ankyrin repeat protein, is up-regulated during wound healing and induces angiogenesis in experimental granulation tissue. Am J Pathol 166, 303– 312.
53 Grounds MD & Torrisi J (2004) Anti-TNFalpha (Remi- cade) therapy protects dystrophic skeletal muscle from necrosis. FASEB J 18, 676–682. 54 Cohn RD, van Erp C, Habashi JP, Soleimani AA,
46 Porter JD, Khanna S, Kaminski HJ, Rao JS, Merriam AP, Richmonds CR, Leahy P, Li J, Guo W & Andrade FH (2002) A chronic inflammatory response dominates the skeletal muscle molecular signature in dystrophin- deficient mdx mice. Hum Mol Genet 11, 263–272. 47 Suzuki N, Aoki M, Hinuma Y, Takahashi T, Onodera Y, Ishigaki A, Kato M, Warita H, Tateyama M & Itoyama Y (2005) Expression profiling with progression of dystrophic change in dysferlin-deficient mice (SJL). Neurosci Res 52, 47–60. Klein EC, Lisi MT, Gamradt M, ap Rhys CM, Holm TM, Loeys BL et al. (2007) Angiotensin II type 1 recep- tor blockade attenuates TGF-beta-induced failure of muscle regeneration in multiple myopathic states. Nat Med 13, 204–210.
55 Im WB, Phelps SF, Copen EH, Adams EG, Slightom JL & Chamberlain JS (1996) Differential expression of dystrophin isoforms in strains of mdx mice with differ- ent mutations. Hum Mol Genet 5, 1149–1153. 56 Judge LM, Haraguchiln M & Chamberlain JS (2006) 48 Witt CC, Ono Y, Puschmann E, McNabb M, Wu Y, Gotthardt M, Witt SH, Haak M, Labeit D, Gregorio CC et al. (2004) Induction and myofibrillar targeting of CARP, and suppression of the Nkx2.5 pathway in the MDM mouse with impaired titin-based signaling. J Mol Biol 336, 145–154.
Dissecting the signaling and mechanical functions of the dystrophin–glycoprotein complex. J Cell Sci 119, 1537– 1546. 49 Walsh K & Perlman H (1997) Cell cycle exit upon myogenic differentiation. Curr Opin Genet Dev 7, 597–602. 50 Ishido M, Kami K & Masuhara M (2004) In vivo
57 Snyder RO, Miao CH, Patijn GA, Spratt SK, Danos O, Nagy D, Gown AM, Winther B, Meuse L, Cohen LK et al. (1997) Persistent and therapeutic concentra- tions of human factor IX in mice after hepatic gene transfer of recombinant AAV vectors. Nat Genet 16, 270–276.
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
684
expression patterns of MyoD, p21, and Rb proteins in myonuclei and satellite cells of denervated rat skeletal muscle. Am J Physiol Cell Physiol 287, C484–C493. 51 Matsuura K, Uesugi N, Hijiya N, Uchida T & Moriy- ama M (2007) Upregulated expression of cardiac anky- rin-repeated protein in renal podocytes is associated with proteinuria severity in lupus nephritis. Hum Pathol 38, 410–419. 58 Bartoli M, Poupiot J, Goyenvalle A, Perez N, Garcia L, Danos O & Richard I (2006) Noninvasive monitor- ing of therapeutic gene transfer in animal models of muscular dystrophies. Gene Ther 13, 20–28.
