intTypePromotion=1

CÔNG NGHỆ GEN THỰC VẬT

Chia sẻ: Nguyễn Văn Lập | Ngày: | Loại File: PDF | Số trang:69

0
397
lượt xem
117
download

CÔNG NGHỆ GEN THỰC VẬT

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Hiện nay, bên cạnh phương pháp tạo giống cây trồng truyền thống nh ư lai hữu tính, gây đột biến…, ngành công nghệ sinh học với sự phát triển của công nghệ gen đã và đang tạo ra những bước đột phá do công nghệ gen cho phép đưa các gen có lợi vào thực vật để tạo ra những cây trồng có tính trạng mà chúng ta mong muốn.

Chủ đề:
Lưu

Nội dung Text: CÔNG NGHỆ GEN THỰC VẬT

  1. PHẦN V CÔNG NGH Ệ GEN TH ỰC VẬT
  2. 345 Phần V: CÔNG NGHỆ GEN THỰC VẬT CẤU TRÚC vector plasmid MANG GEN KHÁNG SÂU VÀ ỨNG DỤNG TRONG TẠO CÂY TRỒNG CHUYỂN GEN THÔNG QUA VI KHU ẨN Agrobacterium tumefaciens Lê Tấn Đức, Nguyễn Hữu Hổ, Nguyễn Văn Uyển Phòng Công ngh ệ gen thực vật, Viện Sinh học Nhiệt đới MỞ ĐẦU Hiện nay, b ên cạnh phương pháp tạo giống cây trồng truyền thống nh ư lai hữu tính, gây đột biến…, ngành công ngh ệ sinh học với sự phát triển của công nghệ gen đã và đang tạo ra những bước đột phá d o công ngh ệ gen cho phép đưa các gen có lợi vào thực vật để tạo ra những cây trồng có tính trạng m à chúng ta mong mu ốn. Hàng năm trên thế giới tốn rất nhiều chi phí trong việc phòng trừ sâu hại . Các nhà khoa h ọc đã và đang nghiên cứu chuyển nạp gen Bt (Bacillus thuringiensis) vào cây trồng để cây trồng tự sản sinh các protein gây ch ết sâu hại . Cây trồng mang gen kháng sâu Bt là một trong những th ành tựu của công nghệ sinh học trong việc cải tiến cây trồng. Cây mang gen tạo độc tố này có kh ả năng khá ng với các sâu hại chính thuộc bộ Lepidoptera, Coleoptera và Diptera. Hiện nay ngo ài việc cải tiến kỹ thuật chuyển gen Bt còn phải cải tiến gen thích hợp sao cho gen Bt, một gen của vi kh uẩn có thể biểu hiện có hiệu quả trong th ực vật. Phương pháp có hiệu quả để tạo cây chu yển gen là sử dụng súng bắn gen; tuy nhiên, đối với những cơ sở nghiên cứu chưa thể trang bị được thiết bị này thì việc chuyển gen bằng vi khuẩn Agrobacterium tumefaciens là phương pháp được lựa chọn; ngoài ra phương pháp dùng vi khu ẩn Agrobacterium tumefaciens còn có các ưu điểm riêng của nó mà các phương pháp khác không có đư ợc. Theo hướng dùng vi khu ẩn để chuyển nạp, chúng tôi đã nghiên c ứu tái cấu trúc vector plasmid mang ba gen là gen bar (gen ch ọn lọc), gen gusA (gen chỉ thị) và gen Bt cryIA nhằm tạo một số vector plasmid mới - được đặt t ên là plasmid pITB (Institute of Tropical Biology). Nội dung b ài báo này, chúng tôi trình bày k ết quả nghi ên cứu tái cấu trúc v à sử dụng các plasmid qua tái cấu trúc trong nghi ên cứu tạo cây cây hông và cây cải ngọt chuyển gen. VẬT LIỆU VÀ PHƯƠNG PHÁP 1. Cấu trúc plasmid mới Chủng Agrobacterium tumefaciens EHA 105 được sử dụng để chuyển gen. Chuẩn E. coli DH5: được dùng làm vi khu ẩn có khả năng biến nạp.
  3. 346 Hội nghị KHOA HỌC VÀ CÔNG NGHỆ 2007 Plasmid pCAMBIA 3301, plasmid pUbi.cryIA(b) và plasmid pUbi. cryIA(c). 2. Chuyển gen v ào cây Vật liệu v à dòng vi khu ẩn: Cây trong ống nghiệm được dùng làm v ật liệu chuyển gen. Sử dụng chủng vi khuẩn Agrobacterium tumefaciens (At) EHA 105 ch ứa plasmid ITB mang gen cryIA(c), gen bar và gen gusA. Phương pháp chuyển gen vào cây hông ( Paulownia fortunei) : Sử dụng vi khuẩn At được lắc qua đêm để gây nhiễm mảnh lá, sau đó các mảnh lá được nuôi cấy tr ên môi trường tái sinh tạo chồi (môi trường MS có 0,1 mg/l NAA và 10mg/l BA) có b ổ sung chất acetosyringone nồng độ 100 µM trong hai ngày. Sau đó rửa và diệt vi khuẩ n bằng dung dịch kháng sinh 500 mg/l cefotaxime trong th ời gian 30 phút, chuyển các mảnh lá sang môi trường tái sinh tạo chồi có chứa 4mg/l PPT v à 500mg/l cefotaxime. C ấy truyền 2 tuần/ lần tr ên cùng lo ại môi trường. Sau 6 tuần, mẫu lá có chồi tái sinh đ ược cấy truyền sang môi trường cho ra rễ có chứa 4 mg/l PPT. Các cây ra r ễ tốt được đưa ra trồng ở vườn ươm. Phương pháp chuyển gen v ào cây cải ngọt ( Brassica integrifolia L.): Lá mầm với cuống lá d ài 1-2mm của cây con từ hạt nẩy mầm 5 -6 ngày tu ổi được sử dụng l àm mẫu chuyển gen. Sử dụng vi khuẩn đ ã lắc qua đêm để gây nhiễm mẫu, sau đó các lá mầm được nuôi cấy trên môi trường tái si nh tạo chồi (môi trường MS có 2mg/l NAA, 4mg/l BA và 3,3mg/l AgNO 3) trong hai ngày (có b ổ sung acetosyringone n ồng độ 100 µM). Sau đó rửa và diệt vi khuẩ n bằng dung dịch kháng sinh 500 mg/l cefotaxime trong th ời gian 30 phút, chuy ển các mẫu sang môi trường tái sinh tạo chồi c ó chứa chất chọn lọc PPT và 500mg/l cefotaxime. C ấy truyền 2 tuần/ lần tr ên cùng lo ại môi trường. Sau 4 -5 tuần, mẫu có chồi tái sinh đ ược cấy truyền sang môi trường ra rễ ( môi trường MS có 0,1mg/l NAA và 6mg/l PPT). Phương pháp kiểm tra cây chuyển gen: Kiểm tra gen chỉ thị gusA bằng dung dịch X -Gluc: bằng cách ngâm các mảnh lá chồi nhỏ với dung dịch X-Gluc kho ảng 15 giờ ở 37 C, mẫu chuyển gen sẽ có m àu xanh chàm đặc trưng, mẫu đối chứng sẽ không chuyển m àu. PCR gen cryIA(c): DNA th ực vật được chạy PCR với cặp mồi chuy ên biệt, quy trình tách DNA th ực vật được thực hiện theo phương pháp c ủa Dellaporta (1983). Các cây chuyển gen được kiểm tra sự biểu hiện của gen cryIA(c) qua khả năng kháng sâu b ằng cách thả sâu xanh Heliothis armigera lên các m ẫu lá trong đĩa pétri. KẾT QUẢ V À THẢO LUẬN 1. Cấu trúc plasmid mới Việc gắn gen cryIA(b) và cryIA(c) vào plasmid pCAMBIA 3301 để tạo plasmid mới như sau:
  4. 347 Phần V: CÔNG NGHỆ GEN THỰC VẬT Vectơ plasmid CAMBIA 3301 có độ dài 12 Kb chứa gen gusA và gen bar. Có 14 enzyme giới hạn tại vị tr í cloning site trong vùng T-DNA, ở đó cho phép tách hoặc ghép các đoạn gen mong muốn. Tron g thí nghiệm này chúng tôi đ ã sử dụng enzyme giới hạn Hind III (A/AGCTT) để cắt tạo hai đầu Hind III của chuỗi plasmid pCAMBIA 3301. Plasmid pUbi.cryIA(b) và plasmid pUbi.cryIA(c) ch ứa gen cryIA có độ dài 4 kb, ở hai đầu của toàn bộ gen này (promoter-gen-terminator) có vị trí cắt bởi enzyme giới hạn Hind III. Nên chúng tôi đ ã sử dụng enzyme giới hạn Hind III để cắt ở hai vị trí n ày. Sau khi cắt bởi enzyme giới hạn Hind III các đoạn plasmid DNA đ ã được chạy điện di cho kết quả: với plasmid pCAMBIA đ ã được mở ra với hai đầu cắt bởi Hind III và được xử lý bởi AP (alkaline phosphat) để chúng khó có thể tự nối lại với nhau. C òn plasmid pUbi.cryIA do có hai v ị trí cắt nên tạo ra hai đoạn: 6 kb DNA tương ứng với thân còn lại của plasmid và đoạn 4 kb tương ứng với đoạn gen cryIA. Sau đó tiến hành nối kết 2 đoạn DNA plasmid pCAMBIA 12 kb v à đoạn gen cryIA 4 kb với nhau bởi enzyme ligase ở nhiệt độ 4 oC trong thời gian 16 giờ. Kết quả đ ã tạo được 2 plasmid m ới dài khoảng 16 kb. Để kiểm tra kết qủa này chúng tôi đ ã chuyển 2 plasmid mới v ào vi khuẩn biến nạp E.coli, nhân b ản E. coli và tách chi ết ADN. Sử dụng lại enzyme giới hạn Hind III để cắt cho kết quả mỗi plasmid đ ã cho được hai băng DNA với 1 đoạn 12 kb v à 1 đoạn 4 kb (xem ảnh 2 điện di) ho àn toàn phù h ợp với kích thước plasmid mới được chúng tôi đặt t ên là plasmid pITB-CRY (Institute of Tropical Biology) ch ứa 3 gen và được chuyển v ào dòng vi khuẩn Agrobacterium tumefaciens EHA 105. Chuyển gen vào cây hông: Sau khi chuyển gen bằng vi khuẩn At, mẫu lá được đăt trên môi trường có PPT nồng độ 4mg/l, đa số các mảnh lá bắt đầu v àng sau 2 tu ần nuôi cấy, một số mảnh lá vẫn duy tr ì màu xanh nhưng không h ình thành mô s ẹo, chỉ một số ít khoảng 10% h ình thành mô s ẹo và một số trong đó bắt đầu tái sinh sau 5 tuần nuôi cấy. S au giai đoạn chọn lọc n ày các chồi con được chuyển sang môi trường MS để ra rễ với 4 mg/l PPT. Và ch ỉ có vài dòng cây tiếp tục phát triển v à ra rễ, được chúng t ôi giả định l à cây chuyển gen. Kết quả quá trình chuyển gen được thể hiện như sau: Bảng 1: Tỷ lệ tái sinh chồi và cây chuyển gen của các mảnh lá trên môi trường có 4mg/l PPT sau khi nhiễm với Agrobacterium tumefaciens và mẫu lá đối chứng Thí Số mẫu Số mẫu lá Số mẫu lá Số lượng Tần số chuyển gen nghiệm lá tái sinh dòng cây tạo mô (%) chồi chuyển gen sẹo Chuyển 580 52 21 5 0,8 gen Đối chứng 30 0 0 0 0 Để khẳng định đây l à những cây hông chuyển gen, chúng tôi cấy cây hông giả định chuyển gen và cây đối chứng vào môi trường ra rễ với chất chọn lọc PPT nồng độ 4mg/l để thử khả năng chống chịu, sau 2 t uần toàn bộ cây đối chứng chết ho àn toàn, trong khi các cây chuyển gen vẫn tiếp phát triển v à ra rễ, giúp chúng tôi khẳng định đây l à những cây hông đã được chuyển gen.
  5. 348 Hội nghị KHOA HỌC VÀ CÔNG NGHỆ 2007 Sự biểu hiện gen gusA của cây chuyển gen : Các chồi nhỏ, mảnh lá của cây chuyển gen đã được xử lý với dung dịch X -Gluc, kết quả cho thấy chồi v à mảnh lá này có màu xanh chàm đặc trưng khẳng định sự biểu hiện của gen gusA trong cây chuyển gen. Sự biểu hiện của gen bar trong cây chuyển gen: gen bar tạo tính trạng kháng thuốc trừ cỏ đã được khẳng định trong cây in vitro, tuy nhi ên chúng tôi mu ốn tiếp tục khảo sát sự tồn tại ổn định và khả năng biểu hiện của gen này trên cây sau khi được trồng ra môi trường tự nhiên ngoài vườn ươm. Chúng tôi sử dụng nồng độ 300mg/l PPT để phun l ên các cây đối chứng và cây chuyển gen 1 tháng tuổi tại vườn ươm. Sau 2 tuần nhận thấy các cây hông chuyển gen tiếp tục sinh trưởng và phát triển bình thường, chỉ có một d òng cây hơi bị vàng lá phía dưới nhưng vẫn sống và phát triển cho phép chúng tôi khẳng định một lần n ữa đây là những cây hông đã nhận được gen chuyển. Sự hiện diện của gen cryIA(c) và khả năng kháng sâu của cây chuyển gen: Phân tích PCR với cặp mồi chuyên biệt cho gen cryIA(c) cho thấy các mẫu DNA của cây chuyển gen sau khi chạy điện di có xuất hiện các băng có kích thước 0,65 kb giống như mẫu đối chứng dương tính plasmid, chúng là k ết quả của sự khuếch đại gen cryIA(c) trong khi mẫu cây đối chứng ho àn toàn không có băng. Qua đó chúng tôi kh ẳng định sự hiện diện của gen cryIA(c) trong nhiễm sắc thể của cây chuyển gen. Sau đó các cây hông chuyển gen đ ược chuyển ra trồng trong vườn ươm. Để thử nghiệm tính kháng sâu các lá nhỏ đ ược đặt trong đĩa pétri c ùng sâu xanh Heliothis armigera. Sau 3 ngày, với các lá đối chứng diện tích lá bị hại lớn, kích th ước sâu tăng rõ rệt, trong khi đó ở lá cây chuyển gen diện tích lá bị sâu ăn nhỏ, sâu tăng tr ưởng rất kém và sau 3 ngày sâu hoàn toàn không còn ăn và chết nhiều vào ngày thứ 5 hoặc 6. Chuyển gen v ào cây cải ngọt: Với phương pháp sử dụng lá mầm của cây con từ hạt nẩ y mầm 5-6 ngày tu ổi, cấy lá mầm vào môi trường tái sinh 3 -4 ngày trước khi nhúng cuống lá mầm v ào dịch vi khuẩn để lây nhiễm, thời gian ủ với vi khuẩn l à hai ngày trên môi trường có bổ sung 100 µM Acetosyringone và sau khi r ửa được cấy trên môi trường tái sinh có Cefotaxime 500mg/l và 4mg/l PPT thì sau 3-4 tuần các chồi tái sinh h ình thành và chúng được cấy truyền trên môi trường MS có 6mg/l PPT để kiểm tra khả năng kháng PPT của cây. Chúng tôi đ ã thực hiện thí nghiệm chuyển gen nhiều lần với số mẫu trun g bình từ 80- 120 mẫu/lần. Kết quả được trình bày ở bảng 2. Bảng 2. Tỷ lệ tái sinh ch ồi và cây, trên môi trường có 4mg/l PPT, của các lá mầm được nhiễm với Agrobacterium tumefaciens v à của mẫu lá mầm đối chứng Thí nghi ệm Số lá mầm Số lá mầm Số lá mầm Số lượng d òng cây Tần số giả định chuyển gen thí nghi ệm tạo mô sẹo tái sinh ch ồi chuyển gen (%) Chuyển gen 1380 52 21 2 0,14 (3,7%) ( 1,5%) Đối chứng 30 0 0 0 0 Qua thí nghi ệm, chúng tôi nhận thấy số lượng lá mầm chống chịu với chất chọn lọc 4mg/l PPT để hình thành mô s ẹo khoảng 3,7% nhưng số lượng có thể tái sinh chồi chỉ ở mức 1,5% và gần như đa số các chồi đều không phát triển v à chết ở các lần cấy truyền sau, theo chúng tôi đây là hiện tượng được coi là escape khá ph ổ biến trong quá tr ình chuyển
  6. 349 Phần V: CÔNG NGHỆ GEN THỰC VẬT gen hoặc chồi ở thể khảm v à chỉ còn 2 chồi tiếp tục phát triển trên môi trường MS với 6mg/l PPT - điều này cho thấy tần số chuyển gen thấp (0,14%). Chúng tôi cho rằng khi chuyển gen trên các đối tượng cây trồng khác như cây thuốc lá và cây hông thì m ẫu lá có khả năng tái sinh chồi cao từ xung quanh rìa lá nên vi khu ẩn Agrobacterium tumefaciens có thể xâm nhập v ào nhiều vị trí có khả năng tái sinh n ày, trong khi ở cây cải ngọt lá mầm chỉ có thể tái sinh tại cuống lá n ên vi khuẩn Agrobacterium tumefaciens chỉ có một vị trí duy nhất để có thể xâm nhiễm tạo cây chuyển gen. Các cây cải giả định chuyển gen đ ược phân tích PCR với cặp mồi chuyên biệt của gen cryIA(c) - cho thấy các mẫu DNA của cây giả định chuyển gen sau khi chạy điện di có xuất hiện các băng có kíc h thước 0,65 kb giống như mẫu đối chứng dương tính plasmid, chúng là kết quả của sự khuếch đại gen cryIA(c) trong khi mẫu cây đối chứng hoàn toàn không có băng. KẾT LUẬN Với việc sử dụng vi khuẩn Agrobacterium tumefaciens EHA 105 mang plasmid ITB để chuyển gen, chúng tôi đ ã nhận được một số dòng cây hông và cây c ải ngọt chuyển gen mang gen cryIA(c) kháng sâu xanh Heliothis armigera. B ằng các kỹ thuật sinh học phân tử và sinh học chúng tôi đ ã xác định được của gen n ày hiện diện trong cây hông và cây cải ngọt chuyển gen v à gen chuyển đã có biểu hiện tính trạng khá r õ rệt. Plasmid ITB (lane 2 và 3 mang Phân tích PCR gen cryIA(c) ở Phân tích PCR gen cryIA(c) ở gen cryIA(b) và cryIA(c) cây hông chuy ển gen (băng cây cải ngọt chuyển gen (băng DNA 0,65 kb) DNA 0,65 kb) Cây c ải ngọt giả định chuyển gen phát triển Cây hông gi ả định chuyển gen phát triển trên môi trư ờng chọn lọc PPT trên môi trư ờng chọn lọc PPT
  7. 350 Hội nghị KHOA HỌC VÀ CÔNG NGHỆ 2007 LỜI CÁM ƠN Các tác gi ả xin chân thành cám ơn Chương tr ình KC-04-13, Chương tr ình nghiên cứu cơ bản đã tài trợ thiết thực cho nghi ên cứu này. TÀI LI ỆU THAM KHẢ O 1. Lê Tấn Đức, Nguyễn Hữu Hổ, Nguyễn Văn Uyển, 2003. Tạo cây hông ( Paulownia fortunei) chuyển gen kháng sâu thông qua vi khuẩn Agrobacterium tumefaciens . Tuyển tập Báo cáo khoa học Hội nghị Công nghệ Sinh học to àn quốc, Hà Nội, 16- 17/12/2003. NXB Khoa học và K ỹ thuật, H à Nội, tr. 1088 -1090. 2. Lê Tấn Đức, Nguyễn Hữu Hổ, Phạm Thị Hạnh, Nguyễn Văn Uyển, 2005. Ảnh hưởng của tác nhân chọn lọc đến mô cây cải ngọt ( Brassica integrifolia) và nghiên cứu tạo cây cải ngọt chuyển gen. Tuyển tập Báo cáo Hội nghị khoa học t oàn quốc “Những vấn đề nghi ên cứu cơ bản trong Khoa học Sự sống” , Đại học Y H à Nội, Hà Nội, 3/11/2005, tr. 1194 -1197. 3. Phạm Thị Hạnh, L ê Tấn Đức, Nguyễn Hữu Hổ, Nguyễn Văn Uyển, 2005. Khảo sát khả năng tái sinh cây in vitro cây cải ngọt ( Brassica integrifolia) từ lá mầm v à trụ mầm phục vụ cho nghi ên cứu chuyển gen. Tuyển tập Báo cáo Hội nghị khoa học toàn quốc “Những vấn đề nghi ên cứu cơ bản trong Khoa học Sự sống” , Đại học Y Hà Nội, Hà Nội, 3/11/2005, tr. 498 -500. 4. Nguyễn Văn Uyển, L ê Tấn Đức, Nguyễn Hữu H ổ, 2003. Nghiên c ứu hệ thống tái sinh cây hông (Paulownia fortunei) và ảnh hưởng của tác nhân chọn lọc để tạo cây chuyển gen. Tuyển tập Báo cáo khoa học Hội nghị Công nghệ Sinh học to àn quốc, Hà Nội, 16-17/12/2003. NXB Khoa học và K ỹ thuật, H à Nội, tr. 866 -869. 5. Murashige, T., Skoog F., 1962. A revised medium for rapid growth and bioassay with tobacco tissue culture. Physiol Plant 15: 473-497. 6. Pua, E. C., Barfield D. G., 1991. Gene transfer in plants of Brassica juncea using Agrobacterium tumefaciens-mediated transformation. Plant Cell Reports 10: 308-314. SUMMARY Construction of plasmid vector and utilization for production of transgenic plants resistant to insect via Agrobacterium tumefaciens Le Tan Duc, Nguyen Huu Ho, Nguyen Van Uyen Institute of Tropical Biology New plasmid vector pITB-CRY (Institute of Tropical Biology) consisting bar, cryIA(c) and gusA genes was constructed and applied to transfer into Agrobacterium tumefaciens EHA 105 for Paulownia and Brassica plants genetic transformation. Many transgenic lines of both plant cultivars were obtained. PCR analyses and indigogenic GUS assay were performed to confirm the presence and the expression of bar, cryIA(c) and gusA genes. Insect bioassays with larvae showed an improvement of resistance against Heliothis armigera.
  8. 351 Phần V: CÔNG NGHỆ GEN THỰC VẬT TẠO CÂY THUỐC LÁ KHÁNG THUỐC TRỪ CỎ VÀ CÔN TRÙNG Phạm Thị Hạnh, Phan Tường Lộc, L ê Tấn Đức, Nguyễn Hữu Hổ Phòng Công ngh ệ gen thực vật, Viện Sinh học Nhiệt đới ĐẶT VẤN ĐỀ Một trong những yếu tố l àm giảm năng suất cây trồng trên đồng ruộng hiện nay l à những tác hại do sâu bệnh gây ra v à việc phòng trừ dịch hại này thường gây sự ô nhiễm môi trường ngày càng nghiêm tr ọng. Vấn đề n ày chỉ có thể được giải quyết thông qua sự kết hợp giữa khoa học hiện đại v à ý thức giữ gìn sinh thái môi tr ường. Một trong những ứng dụng của công nghệ sinh học để giải quyết vấn đề tr ên là tạo ra những cây trồng tự bản thân có kh ả năng chống chịu với các loại sâu bệnh. Trong các lo ại côn trùng gây h ại thì rầy, rệp chiếm vai tr ò quan trọng, việc chích hút nhựa của chúng l àm cây không phát triển đồng thời chúng là nguồn lây lan một số bệnh virus quan trọng nh ư virus gây b ệnh khảm ở cây thuốc lá ... Hiện nay, phương pháp chuyển gen v ào cây trồng bằng vi khuẩn Agrobacterium tumefaciens được xem là một phương pháp có hiệu quả, là phương pháp qua đó k ết quả chuyển gen thường biểu hiện kiểu tích hợp gen (DNA integration) t ương đối đơn giản, phù hợp với ý muốn của các nh à công ngh ệ gen. Nội dung báo cáo n ày, chúng tôi nghiên cứu tái cấu trúc plasmid mới mang gen bar (gen kháng thu ốc trừ cỏ) , gen gna (gen kháng côn trùng chích hút) và gen gusA; chuyển plasmid m ới cấu trúc v ào vi khu ẩn Agrobacterium tumefaciens và dùng dòng vi khu ẩn biến nạp trong nghi ên cứu tạo cây thuốc lá chuyển gen kháng thuốc trừ cỏ v à côn trùng. VẬT LIỆU VÀ PHƯƠNG PHÁP 1. Vật liệu Vi khuẩn E. coli chứa plasmid pBluescript SK +-GNA mang cassette gen nguyên vẹn [Bao gồm Promoter Ubiquitin (Ubi) + Trình t ự mã hoá protein GNA (gen gna) + Terminator Nopaline synthase (nos)], kích thư ớc khoảng gần 4 kb. Chủng vi khuẩn E. coli chứa pCAMBIA 3301 mang gen bar (gen kháng thu ốc trừ cỏ) và gusA (gen chỉ thị). Gen chỉ thị gusA: được phân lập từ vi khuẩn E. coli (Jefferson & ctv., 1987), mã hóa enzym -glucuronidase (không màu). Enzyme này xúc tác ph ản ứng phân gi ải cơ chất glucuronide (không m àu) để tạo th ành
  9. 352 Hội nghị KHOA HỌC VÀ CÔNG NGHỆ 2007 sản phẩm có màu xanh chàm đặc trưng dễ nhận biết. Glucuronide th ường d ùng gọi l à X-gluc, công th ức hóa học: 5 -bromo-4-chloro-3-indolyl- -D-glucuronide. Gen bar kháng ch ất phosphinothricin (PPT) đ ược phân lập từ vi khuẩn S. hygroscopicus . Gen này mã hóa cho enzym phosphinothricin acetyl transferase (PAT), giúp bi ến đổi PPT từ dạng ức chế sinh tổng hợp glutamine gây chết cây trồng sang dạng bị acetyl hóa không c òn gây độc cho cây. V ì v ậy, ngo ài tác dụng chọn lọc trong quá tr ình chuyển gen ở thực vật, gen bar còn có vai trò kháng thu ốc trừ cỏ Basta trong sản xuất nông nghiệp. Chủng vi khuẩn E. coli DH5 được dùng trong bi ến nạp nhằm khuếch đại số l ượng bản sao các plasmid. Chủng vi khuẩn Agrobacterium tumefaciens LBA 4404 dùng để biến nạp plasmid mới. Môi trường nuôi cấy: Môi trường Luria -Bertani (LB) ch ứa kháng sinh được sử dụng trong nuôi cấy v à biến nạp. Enzym gi ới hạn SacI, KpnI và enzym n ối DNA ligase T4. 2. Phương pháp a. Cấu trúc các plasmid mới Phương ph áp xử lý enzym để cắt DNA plasmid theo qui trình c ủa Sambrook và ctv. (1989). Các ph ản ứng nối kết được thực hiện ở nhiệt độ 14 0C trong thời gian 3 -4g. Biến nạp E. coli và Agrobacterium tumefaciens theo phương pháp sốc nhiệt, 42 0C trong 2 phút. Môi trường LB được bổ sung các kháng sinh thích hợp để chọn lọc cá thể biến nạp. Trong thí nghi ệm chúng tôi sử dụng các kháng sinh nh ư kanamycin (50 mg/l) và streptomycin (25mg/l). Các h ợp chất hóa sinh như IPTG (Isopropyl -D-thiogalactoside) 50mg/l và X-gal (5-Bromo 4-chloro 3-indolyl -D galactopyranoside) 40mg/l đư ợc bổ sung vào môi trường nuôi cấy các thể biến nạp để hoạt hoá enzym -galactosidase, cho phép chọn lọc các khuẩn lạc xanh/trắng. Ph ương pháp tách DNA plasmid các khu ẩn lạc để kiểm tra cloning theo phương p háp của bộ kit công ty Promega. b. Tạo cây thuốc lá kháng thuốc trừ cỏ v à kháng côn trùng Sử dụng giống thuốc lá sợi v àng Kutsaga 326. Lá cây thu ốc lá trong ống nghiệm được cắt kích thước khoảng 1x1cm được dùng làm nguyên li ệu chuyển gen. Sử dụng vi khuẩn đã lắc qua đêm để gây nhiễm mảnh lá, sau đó các mảnh lá đ ược nuôi cấy trên môi trường tái sinh tạo chồi (môi tr ường MS có 0,1mg/l NAA v à 1mg/l BA) trong hai ngày. Sau đó r ửa và diệt vi khuẩn bằng dung dịch Cefotaxim e 500mg/l trong thời gian 30 phút, chuyển các mảnh lá sang môi tr ường tái sinh tạo chồi có 10mg/l PPT và 500mg/l Cefotaxim e. Cấy truyền 2 tuần / lần tr ên cùng lo ại môi trường. Sau 6 tuần, mẫu lá có chồi tái sinh đ ược cấy truyền sang môi tr ường ra rễ có chứa 20 mg/l PPT. Các cây ra r ễ tốt được đưa ra trồng ở vườn ươm. Phương pháp ki ểm tra cây chuyển gen Khảo sát khả năng phát triển v à ra rễ của cây chuyển gen v à cây đối chứng in vitro trên môi trường MS có chứa chất chọn lọc nồng độ 20mg/l PPT.
  10. 353 Phần V: CÔNG NGHỆ GEN THỰC VẬT Kiểm tra gen chỉ thị gusA bằng dung dịch X -Gluc: bằng cách ngâm các mảnh lá v à chồi nhỏ với dung dịch X -Gluc kho ảng 15 giờ ở 370C, mẫu chuyển gen sẽ có m àu xanh chàm đặc trưng, còn mẫu đối chứng sẽ không chuyển m àu. Sự hiện diện của gen gna trong cây được kiểm tra qua phản ứng PCR với cặp mồi chuyên bi ệt như sau: Mồi 1: 5’CGG ATC CAT GGC TAA GGC AAG TCT CCT C-3’ và mồi 2: 5’CGG TAC CTC ATT ACT TTG AAG TCA CAA G -3’. Kích thước đoạn DNA của gen gna khuếch đại của phản ứng PCR đ ược mong đợi l à 0,47 kb. Sự hiện diện của gen bar được kiểm tra qua phân tíc h PCR với các cặp mồi như sau: Mồi 1: 5’ ATG AGC CCA GAA CGA CG 3’ v à mồi 2: 5’ TCA GAT CTC GGT GAC GG 3’. Gen bar ở cây chuyển gen qua phân tích PCR s ẽ có đoạn DNA được khuếch đại l à 0,5 kb. Các cây chuyển gen và đối chứng được phun dung d ịch Basta (PPT nồng độ 4g/l) có bổ sung chất bám dính Tween 80 để kiểm tra tính kháng thuốc trừ cỏ. KẾT QUẢ V À THẢO LUẬN 1. Cấu trúc plasmid mới Trong thí nghi ệm này chúng tôi đ ã xử lý cassette gen nguy ên vẹn [Bao gồm Promoter Ubiquitin (Ubi) + Trình t ự mã hoá protein GNA (gen gna) + Terminator Nopaline synthase (nos)], kích thư ớc khoảng gần 4 kb nằm tr ên plasmid Bluescript SK+ được cắt bởi hai enzym giới hạn Kpn I v à Sac I. Cassette này s ẽ được chèn vào v ị trí Lac Z alpha (trong vùng T-DNA, cũng được cắt bởi Kpn I v à Sac I) ở plasmid pCAMBIA 3301. Tiếp theo chạy điện di tr ên gel agarose 0,8% k ết quả điện di sau khi cắt bởi 2 enzym cho th ấy plasmid pBluescript SK+ -GNA được cắt làm hai đoạn, đoạn khoảng gần 4 kb l à nguyên cassette ch ứa gen gna c òn plasmid pCAMBIA ch ỉ có 1 đoạn khoảng 12 kb. Tách và làm s ạch đoạn cassette và plasmid backbone trước khi đưa vào nối kết (ligation). Phản ứng nối kết giữa gen gna v à vector pCAMBIA b ằng enzym ligase T4 ở 14 oC trong 3 gi ờ. Sau đó các sản phẩm tr ên được biến nạp v ào E. coli DH5 khả biến trong môi trường LB có 50 mg/l kháng sinh kanamycin, nuôi 37 oC qua đêm. Kết quả cho thấy trên các đĩa đối chứng (biếp nạp không có plasmid), các tế b ào E. coli DH5 do không được bổ sung plasmid khi thực hiện biến nạp n ên không có kh ả năng kháng Kanamycin, do vậy chúng không sinh trưởng được trên môi trường LB có bổ sung kanamycin. Ngược lại, các thể được biến nạp mang plasmid mới phát triển đ ược trên môi trường chọn lọc n ày chứng tỏ chúng chính l à các thể mong muốn. B ên cạnh đó, môi trường chọn lọc có bổ sung X -gal, dựa trên nguyên t ắc sàng lọc, các khuẩn lạc trắng tr ên đĩa biến nạp sẽ được sơ chọn để nhân bản plasmid mới. Để xác định kết quả, chúng tôi lấy
  11. 354 Hội nghị KHOA HỌC VÀ CÔNG NGHỆ 2007 một số khuẩn lạc m àu trắng nuôi trong môi trường LB lỏng có 50 mg/l kháng sinh kanamycin, nuôi lắc qua đ êm ở 370C. Sau khi tách DNA plasmid, ti ến hành x ử lý 2 enzym SacI và KpnI cho plasmid m ới và pCAMBIA. K ết quả xử lý enzym, chạy điện di trên gel 0,8% cho th ấy plasmid mới chứa 2 đoạn DNA: một đoạn 12 kb (t ương ứng pCAMBIA 3301 backbone) và m ột đoạn kích thước khoảng gần 4 kb (tương ứng cassette ch ứa gen gna); cho thấy plasmid đ ã được hình thành có kích th ước khoảng gần 16 kb. Như vậy có thể khẳng định gen mục ti êu đã được lắp ghép th ành công và plasmid mới đã được nhân bản trong E. coli, plasmid này được ký hiệu l à p3301-GNA. Sau đó chúng tôi đ ã tạo chủng Agrobacterium tumefaciens mang plasmid n ày. 2. Tạo cây thuốc lá kháng thuốc trừ cỏ v à kháng côn trùng Trên môi trường có PPT nồng độ 10 mg/l, các m ảnh lá đối chứng bị mất m àu màu xanh sau 2-3 tuần. Ngược lại, một số mảnh lá đ ã xử lý vi khuẩn chuyển gen vẫn c òn màu xanh và hình thành d ần các cụm mô sẹo v à chồi nhỏ. Sau 6 tuần chọn lọc, các chồi này được chu yển sang môi trường ra rễ có 20 mg/l PPT. Ch ồi thuốc lá qua xử lý chuyển gen vẫn tiếp tục p hát tri ển và ra rễ. Trong khi đó ở thí nghiệm đối chứng, chồi từ mô lá không x ử lý chuyển gen trên môi trường ra rễ chứa 20 mg/l PPT d ần dần v àng và ch ết trong 2-3 tuần. Do đó chúng tôi cho rằng những chồi v à cây phát tri ển trên môi trường 20 mg/l PPT là nh ững cá thể giả định chuyển gen. Qua thí nghiệm chuyển gen, cây sinh trưởng tốt trên môi trường có 20 mg/l PPT có s ự biểu hiện của gen g usA, lá của các cây này có màu xanh đặc trưng. Bảng 1: Tỷ lệ tái sinh chồi của cá c mảnh lá trên môi trường có 20mg/l PPT sau khi nhiễm với Agrobacterium v à mẫu lá đối chứng Thí nghi ệm Số mẫu lá thử Số lượng mẫu lá tái sinh Tần số chuyển gen( %) nghiệm chồi Chuyển gen 120 11 9,16 Đối chứng 20 0 0 Kiểm tra sự hiện diện của gen mục ti êu gna trong cây thu ốc lá chuyển gen: Phản ứng PCR được thực hiện với cặp mồi đặc hiệu cho gen gna. Đối chứng dương là plasmid pUbi-GNA và đối chứng âm l à DNA bộ gen tách chiết từ nhiễm sắc thể của cây không được chuyển gen. Kết quả cho thấy ở các dòng cây gi ả định chuyển gen có sự hiện diện của vạch DNA mong đợi có kích th ước bằng với kích thước của vạch đối chứng dương tính là 0,47 kb (so với thang chuẩn ). Không th ấy vạch n ày ở trường hợp cây thuốc lá đối chứng. Kết quả n ày chứng minh gen mục ti êu gna từ plasmid của vi khuẩn Agrobacterium đã được chuyển v à sáp nhập vào bộ gen của cây. Sự hiện diện của gen bar v à khả năng kháng thuốc trừ cỏ Basta: Kết quả phân tích PCR cho th ấy các mẫu DNA của cây chuyển gen xuất hiện băng DNA với kích thước khoảng 0,50 kb là k ết quả của việc khuếch đại gen bar. Do đó, chúng tôi có thể khẳng định bước đầu gen bar đã được chuyển v ào nhi ễm sắc thể của cây. Sau khi trồng tại
  12. 355 Phần V: CÔNG NGHỆ GEN THỰC VẬT vườn ươm khoảng 30 ngày, các cây thu ốc lá đối chứng đ ã được kiểm tra khả năng chống chịu với thuốc trừ cỏ Basta bằng cách phun thuốc với các n ồng độ 4 g/l PPT. Sau 14 ngày, t ất cả cây thuốc lá đối chứng đều bị chết ở nồng độ nói tr ên nên chúng tôi đ ã chọn nồng độ 4g/l PPT để xử lý số cây thuốc lá chuyển gen. Sau 14 ng ày, cây thu ốc lá chuyển gen vẫn tiếp tục sinh tr ưởng bình thường. KẾT LUẬN Như vậy bằng các kỹ thuật sinh học phân tử chúng tôi đ ã tạo được chủng Agrobacterium tumefaciens mang gen bar, gen gna và gen gusA . Sau đó đ ã sử dụng vi khuẩn này để tạo cây thuốc lá chuyển gen mang gen bar kháng thu ốc trừ cỏ v à gen gna kháng côn trùng chích hút. LỜI CÁM ƠN Các tác gi ả xin chân thành cám ơn Sở Khoa học v à Công ngh ệ Tp Hồ Chí Minh v à Trung tâm phát tri ển KHCN Trẻ - Thành Đoàn Tp H ồ Chí Minh đ ã tài trợ cho nghi ên cứu này. TÀI LI ỆU THAM KHẢO 1. Gleave A. P., 1992. A versatile binary vector syste m with a T-DNA organisational structure conductive to efficient integration of cloned DNA into the plant genome. Plant Molecular Biology 20: 1203 -1207. 2. Hilder V. A., Gatehouse M. R., Gatehouse J. A., Van Damme E., Boulter D., 1995. Expression of snowdrop lectin (GNA) in transgenic tobacco plants results in added protection against aphids. Transgenic Research 4: 18 -25. 3. Kumar K. K., Sudhakar D., Raija J. A., Balasubramanian P., 1999. Engineering resistance in elite indica rices to major diseases through Agr obacterium -mediated transformation.General Meeting of The International Program on Rice Biotechnology, September, 1999, Phuket, Thailand. 4. Murashige T., Skoog F., 1962. A revised medium for rapid growth and bioassay with tobacco tissue culture. Physiol. Plant. 15: 473-497.Ư 5. Rao K. V., Christou P., Gatehouse M. R., Gatehouse J. A, 1998. Expression of snowdrop lectin (GNA) in transgenic rice plants confers resistance to rice brown planthopper. Plant Journal 15(4): 469 -477. 6. Sambrook J., Fritsch E. F., Maniatis T., 1989. Molecular Cloning - A Laboratory Manual. Cold Spring Harbor Laboratory Press.
  13. 356 Hội nghị KHOA HỌC VÀ CÔNG NGHỆ 2007 SUMMARY Production of transgenic tobacco plants ( Nicotiana tabacum L.) resistant to insect and Basta R herbicide via Agrobacterium tumefaciens Pham Thi Hanh, Phan Tuong Loc, Le Ta n Duc, Nguyen Huu Ho Institute of Tropical Biology Intact gna gene cassette was collected from the plasmid pBluescript SK + by restriction enzymes KpnI và SacI and inserted in Lac Z alpha region on T-DNA of the plasmid pCAMBIA 3301. Consequently, newly for med plasmid was introduced into competent E. coli and Agrobacterium tumefaciens LBA 4404 (for transformation). After co-cultivation, tobacco leaf disks were cultured on selection medium containing 10 mg/l PPT (Phosphinothricin). Many transgenic tobacco plants with aphid resistance gene gna, herbicide resistance gene bar, and reporter gene gusA were obtained via Agrobacterium tumefaciens LBA 4404 carrying the plasmid pCAMBIA 3301-GNA. PCR analyses and indigogenic GUS assay were pe rformed to confirm the presen ce and the expression of gna, bar and gusA genes.
  14. 357 Phần V: CÔNG NGHỆ GEN THỰC VẬT . Hình 1. Ảnh điện di của Hình 2, 3: K ết quả phân tích PCR gen bar (h. 2) v à gna plasmid pCAMBIA 3301 - (h. 3) ở cây thu ốc lá chuyển gen. L: thang DNA 1 kb, GNA (1) và pCAMBIA PC: đ ối chứng d ương tính, NC: đ ối chứng âm tính, 3301 (2) 1,2,3,4: cây chuy ển gen Hình 4: Cây thu ốc lá chuyển Hình 5: Ch ồi cây thuốc lá Hình 6: Cây thu ốc lá chuyển gen và đ ối chứng tr ên môi chuyển gen biểu hiện gen và đ ối chứng sau khi gen gusA qua ngâm phun dung d ịch Basta trường chứa 20 mg/l PPT trong dung d ịch X-gluc
  15. 358 Hội nghị KHOA HỌC VÀ CÔNG NGHỆ 2007 NGHIÊN C ỨU TÁI SINH in vitro VÀ BƯỚC ĐẦU PHÂN TÍCH CÂY CÚC Dendranthema grandiflorum L. MANG GEN ipt tạo cytokinin Nguyễn Hữu Hổ, Lê Tấn Đức, Phan Tường Lộc, Phạm Đức Trí, Nguyễn Thị Thanh Phòng Công ngh ệ gen thực vật, Viện Sinh học Nhiệt đới MỞ ĐẦU Trong ngành tr ồng hoa thương mại, một trong các vấn đề đ ược quan tâm nhiều nhất là nghiên c ứu giữ cho cây hoa nói chung v à hoa cắt cành nói riêng sao cho lâu tàn. Các nhà sản xuất v à kinh doanh hoa c ảnh đ ã sử dụng một số tác nhân l àm cho hoa được tươi lâu như dung dịch chất điều hoà sinh trưởng (ĐHST) cytokinin (dihydrozeatin hoặc benzyladenin), dung d ịch đường, dung dịch sát k huẩn,,, để xử lý hoa cắt c ành hoặc xử lý đối với cả cây hoa. Cây hoa cúc là đối tượng cây hoa có nhu cầu ti êu thụ rất cao vì có hoa đẹp, đa dạng, nhiều màu sắc nhưng thời gian bền tươi của hoa cắt c ành không dài nh ất là khi đưa vào tiêu thụ giống cúc ôn đới hoặc trưng bày, bảo quản hoa trong điều kiện không thích hợp nên nghiên cứu làm tăng độ bền tươi của cây hoa này là vấn đề cần được quan tâm. Như chúng ta đ ã biết, các chất điều hoà sinh trưởng như auxin, gibberellin, ethylen, acid abscisic, cytokinin có ý ngh ĩa rất lớn trong việc điều ho à sự lão hoá. Trong các nhóm ch ất nêu trên, cytokinin chi ếm vai tr ò quan tr ọng [5,9,10,11]. Trong công nghệ nuôi cấy mô tế b ào in vitro, cytokinin có vai trò r ất rõ rệt trong việc giữ cho mô lá tách rời chậm thoái hoá d iệp lục tố - được xanh tươi lâu. Trong thực tiễn công tác giống cây trồng, việc xử lý cytokinin, li ên quan m ật thiết đến sự tươi lâu của rau vừa thu hoạch v à kéo dài tu ổi thọ của hoa cắt c ành, mang ý ngh ĩa thương mại rất cao. Trên thế giới, các nh à khoa h ọc đã nghiên c ứu chuyển gen nạp ipt (mã hoá enzym isopentenyl transferase có liên quan đ ến sinh tổng hợp cytokinin isopentenyl adenin, zeatin và dihydrozeatin) vào cây tr ồng mục đích l àm mô t ế bào của chúng tự sản xuất cytokinin. Th ực tế nghi ên cứu trên thế giới đã chứng minh rằng, ở một số tr ường hợp như cây thuốc lá [25], Petunia [5,10] cây bông c ải [11], cây cải x à lách [13,14] k ể cả cây cúc [8,9,10]…, tác dụng của cytokinin nội sinh (sản phẩm của gen đ ược chuyển nạp) đối với tuổi thọ của lá v à hoa của câ y chuyển nạp gen l à rất có ý nghĩa. Để tránh sự tạo dư thừa (overproduction) cytokinin gây thay đồi h ình dạng cây, các nh à khoa h ọc đã sử dụng một số loại promoter khác nhau tạo sự biểu hiện gen khi cây ở điều kiện đặc
  16. 359 Phần V: CÔNG NGHỆ GEN THỰC VẬT thù [1,5,9,10,13] trong đó có promote r SAG12 (tạo sự sinh tổng hợp cy tokinin khi mô đi vào trạng thái lão hoá) [5,13] mà chúng tôi s ử dụng trong nghi ên cứu này. Theo xu hướng trên, ở nghiên cứu này, qua k ết hợp công nghệ nuôi cấy mô v à công nghệ gen, chúng tôi nghi ên cứu tái sinh cây in vitro và chuyển gen ipt vào cây hoa cúc Dendranthema morifolium L. Với hy vọng sự hiện diện v à biểu hiện của gen ipt nói trên sẽ có tác dụng góp phần l àm cho cây hoa lâu héo tàn. VẬT LIỆU VÀ PHƯƠNG PHÁP Giống lan : Sử dụng giống cúc đại đoá Đ à Lạt có hoa m àu vàng. Phương pháp Môi trường nuôi cấy mô v à thử tính chống chịu đối với kháng sinh hygromycin 1. Môi trường nuôi cây: MS (Murashige -Skoog, 1962) [15 ] không ch ất điều ho à sinh trưởng (ĐHST). 2. Môi trường tái sin h chồi: MS có các chất ĐHST NAA , BA với các nồng độ khác nhau. 3. Môi trường vươn chồi tạo cây v à ra rễ: như môi trường số 1. 4. Môi trường thử tính chống chịu đối với kháng sinh hygromycin: nh ư môi trường 1 nhưng có hygromycin từ 5 - 10mg/l. Điều kiện nuôi cấy: 9 giờ chiếu sáng/ng ày, nhiệt độ 25 -28 oC. Dòng vi khuẩn và môi trường nuôi cấy Sử dụng d òng vi khu ẩn Agrobacterium tumefaciens LBA 4404 ch ứa plasmid pVDH396 (kích thước 15,9 kb) (do TS. Nguy ễn Thị Thanh thiết kế) mang gen ipt (có nguồn gốc từ vi khuẩn Agrobacterium tumefaciens ) tạo enzyme isopentenyl t ransferase [có promoter SAG12 (senescence associated gene 12, t ừ Arabidopsis thaliana ), gen gusA (có intron, promoter CaMV35S ) và gen kháng hygromycin hph (promoter CaMV35S ). Môi trường giữ giống vi khuẩn là môi trường LB có 50mg/l kanamycin. Để nhân giống cho nghiên c ứu chuyển gen, vi khuẩn đ ược nuôi cấy lắc qua đ êm trong môi trường khoáng AB (Chilton v à cs., 1974) c ũng có nồng độ kanamycin nh ư trên. Nhiệt độ nuôi cấy: 25 - 280C. Quy trình chuy ển gen Các mảnh lá với kích thước 0,6 x 0,6 cm, từ cây in vitro trên môi trường MS không chất điều hoà sinh trưởng, được sử dụng l àm vật liệu chuyển gen. Tóm tắt quy tr ình chuyển gen 1. Nuôi cấy mảnh lá trên môi trường có 0,5mg/l NAA v à 1mg/l BA trong th ời gian 2 ngày.
  17. 360 Hội nghị KHOA HỌC VÀ CÔNG NGHỆ 2007 2. Gây nhi ễm các mảnh lá với vi khuẩn trong thời gia n 10 phút. V ớt mẫu ra, thấm bớt dịch vi khuẩn thừa bằng giấy lọc. 3. Nuôi chung m ảnh lá với vi khuẩn trong 2 ng ày. Sử dụng môi trường như trên nhưng có acetosyringone 100 M. 4. Rửa thật sạch vi khuẩn bằng n ước cất v à bằng dung dịch cefotaxime 500 mg/l (kết hợp lắc nhẹ). 5. Vớt mẫu ra, thấm ráo nước và cấy các mảnh lá trên môi trường chọn lọc: như môi trường ở bước 1 của quy tr ình nhưng có bổ sung 10 mg/l hygromycin, 500 mg/l cefotaxime. Th ời gian nuôi 15 ng ày / chu k ỳ chọn lọc v à thực hiện 2 chu kỳ. 6. Tiếp tục thực h iện sự chọn lọc th êm 3 chu k ỳ (15 ng ày/chu k ỳ) trên môi trường chọn lọc như trên nhưng có 5mg/l hygromycin đến khi có chồi tái sinh. 7. Cấy truyền các chồi / cụm chồi tái sinh (cao khoảng 1 cm) sang môi trường MS không ch ất sinh trưởng cũng chứa 5mg/l hygromy cin đến khi vươn chồi, thời gian nuôi kho ảng 1 tháng. Kiểm tra cây chuyển gen 1. Tách các ch ồi vươn cao (khoảng 2cm) và c ấy truyền cũng sang môi tr ường MS không ch ất sinh trưởng có 5 mg/l hygromycin: theo dõi s ự vươn chồi và ra rễ trong thời gian khoảng 20 ng ày. 2. Nhuộm GUS (Jefferson v à ctv, 1987) [7]: ủ mô lá trong thuốc thử GUS qua đ êm ở 370C (tủ ấm). 3. PCR: S ự hiện diện của gen hph, gen gusA và gen ipt được kiểm tra d ùng các c ặp mồi đặc hiệu. Gen hph: HPH1: CGTCGTTCGAGAAGTTTC, HPH2: TACTTCTACACAGCCATC; chương trình nhi ệt: 94 C: 5 phút; 35 chu k ỳ (940C: 1 0 phút, 62 0C: 1 phút, 72 0C: 1 phút); 72 0C: 5 phút; khu ếch đại đoạn DNA 800 bp. Gen gusA: GUS1: CCTGTAGAAACCCCAACCCGTG, GUS2: CCCGGCAATAACATACGGCGTG; chương tr ình nhiệt: 94 C: 3 phút; 30 chu k ỳ (940C: 0 30 giây, 560C: 45 giây, 72 0C: 1 phút); 720C: 10 phút; khu ếch đại đoạn DNA 365 bp . Gen ipt: IPT1: TCAACCGGAAGCGGACGACC, IPT2: 0 0 GCCATGTTGTTTGCTAGCCAG; chương tr ình nhiệt: 90 C:10 phút; 40 chu k ỳ (94 C: 15 giây, 450C: 45 giây, 720C: 50 giây); 720C: 7 phút; khuếch đại đoạn DNA 355 bp. KẾT QUẢ V À THẢO LUẬN a. Tính ch ống chịu tự nhi ên của mô lá đối với hygromycin Theo m ột số tài liệu công bố về chuyển nạp gen qua sử dụng tác nhân chọn lọc l à hygromycin thì cây cúc là đối tượng rất mẫn cảm đối với tác nhân chọn lọc n ày. Qua triển khai thử nghiệm tính chống chịu đối với hygromycin d ùng v ật liệu l à mảnh lá v à cây con in vitro, kết quả cho thấy c ác mảnh lá (kích thước 0,6 x 0,6 cm) và cây con (cao
  18. 361 Phần V: CÔNG NGHỆ GEN THỰC VẬT khoảng 1,5 - 2cm) đều bị chết nâu tr ên môi trường MS không chất sinh trưởng có 10mg/l hygromyci n. Trên môi trường có nồng độ 5 mg/l hygromycin, ở mảnh lá có sự hình thành mô s ẹo nhưng mô sẹo đen dần v à không có kh ả năng tái sinh chồi, v à nếu có sự tái sinh chồi xảy ra th ì chồi rất yếu ớt, xanh nhạt; đối với thử nghiệm tr ên cây con thì cây tuy cũng có sự phát triển nhất định nh ưng chậm, rễ ra ngắn và có màu nâu đen, các lá gần gốc ở trạng thái héo nâu, rũ. Kết hợp thử nghiệm ri êng trên gi ống cúc thí nghiệm v à theo tài li ệu đã công b ố, chúng tôi ch ọn nồng độ hygromycin 10mg/l để chọn lọ c tế bào chuyển gen ở giai đoạn đầu (1 - 2 chu k ỳ) qua sử dụng phiến lá (không mang phần cuống) l àm vật liệu xử lý chuyển gen. Tuy vậy, chúng tôi cũng quan tâm cân đối việc gia giảm nồng độ tác nhân chọn lọc này để đảm bảo vừa có sự tái sinh ở mức t ương đối chấp nhận được vừa không bị lúng túng do việc tái sinh nhiều cây không phải l à cây chuyển gen. Cũng qua thực tế triển khai thử nghiệm n ày trên gi ống cúc đại đoá vàng Đồng Tháp (giống chịu nhiệt) th ì giống này lại tỏ ra ít mẫn cảm hơn giống cúc nói tr ên (số liệu cá nhân). b. Nghiên c ứu nuôi cấy mô tái sinh cây phục vụ nghi ên cứu chuyển gen Nói chung, trong nghiên c ứu nuôi cấy mô v à chuyển gen thì vi ệc quan tâm trạng thái sinh lý c ủa lá là yêu cầu quan trọng. Tuy giống cúc n ày phát tri ển rất tốt trong b ình nuôi cấy, lá xanh đậm v à to tạo thuận lợi cho việc lấy mẫu nh ưng theo kinh nghiệm nghiên cứu thì việc lấy các lá không ở vị trí ngọn cũng nh ư gần gốc là điều cần thiết nhất là đối với nghi ên cứu chuyển gen. Điều n ày rất rõ đối với nghi ên cứu nuôi cấy mô và chuyển gen đối với cây hoa cát t ường (tài liệu cá nhân). Chúng tôi đ ã bố trí một số môi trường thí nghiệm tái sinh tr ên cơ sở khoáng MS vớ i các nồng độ NAA 0,1; 0,5 v à 1mg/l k ết hợp với BA 1 v à 2mg/l. Kết quả cho thấy, nói chung, khi NAA cao (0,5; 1mg/l) kết hợp với BA 1 hoặc 2 mg/l thì s ự tái sinh chồi xảy ra theo ki ểu phát sinh cơ quan (organogenesis) [22] thông qua giai đo ạn trung gian l à mô sẹo. Ngược lại, khi nồng độ NAA thấp h ơn (0,1mg/l) k ết hợp với BA 1 hoặc 2 mg/l, nhất là khi dùng 2mg/l, thì s ự tái sinh ch ồi xảy ra ít qua giai đoạn mô sẹo, một số chồi có vẻ hình thành tr ực tiếp từ mảnh lá [20,22,23]. Đặc biệt, sự h ình thành tr ực tiếp này là thường theo kiểu sinh phôi sô-ma [19], x ảy ra nhiều khi chỉ d ùng BA t ừ 1 - 2mg/l mà không b ổ sung NAA (số liệu cá nhân). Theo m ột số tác giả nước ngoài nghiên c ứu chuyển gen tr ên cây cúc, s ự tái sinh theo dạng trực tiếp n ày không có l ợi cho nghi ên cứu. Kết quả nghi ên cứu của chúng tôi phù hợp ý kiến n êu trên. V ề vấn đề n ày, thực tế nghi ên cứu cho thấy khả năn g nhận được cây chuyển gen sẽ cao h ơn khi điều chỉnh sự tái sinh thông qua mô sẹo v ì theo chúng tôi t ế bào chuyển gen, trước hết, cần được nhân lên và như vậy sẽ tạo cơ hội cao cho sự tái sinh cây mang gen chuyển. Nói chung, hiện nay tr ên thế giới, nghi ên cứu nuôi cấy mô phục vụ nhân giống [2], sự phát sinh h ình thái [4,8, 20,22,26] và ph ục vụ chuyển nạp gen [17,18] đ ã và đang được các nh à khoa h ọc quan tâm rất nhiều ở đối tượng cây trồng n ày. c. Quy trình chuy ển gen Như đã nói ở trên do tính r ất mẫn cảm với hygromycin n ên chúng tôi , như đã trình bày trong ph ần quy tr ình chuyển gen, sự chọn lọc được thực hiện ở giai đoạn đầu với
  19. 362 Hội nghị KHOA HỌC VÀ CÔNG NGHỆ 2007 10mg/l hygr omycin, sau đó giảm xuống c òn 5mg/l nhằm tạo cơ hội cho sự tái sinh. Cách làm này c ủa chúng tôi ph ù hợp với cách thực h iện của một số tác giả nước ngo ài vì theo các tác gi ả ấy, tr ên giống cúc cụ thể ở công bố, th ì sự tái sinh không thể xảy ra dù đã có sự chuyển nạp gen (gen hph). Cũng do quá mẫn cảm đối với hygromycin n ên quá trình ch ọn lọc tế b ào chuyển gen từ sau xử lý v i khuẩn đến khi nhận được cây th ì khá dài. Điều này là do trên môi trường có hygromycin tế bào tăng sinh chậm và cây khi đ ã có đầy đủ thân lá phát triển cũng rất chậm. V à thực tế cũng cho thấy khi đ ã là cây chuyển gen nhưng chúng cũng phát triển khá chậm trên môi trường có nồng độ hygromycin dù không ph ải ở mức quá cao (5mg/l). Theo chúng tôi, đây là đi ểm đáp ứng đặc th ù của các giống cúc khi sử dụng tác nhân ch ọn lọc l à hygromycin. Qua quá trình chuy ển gen, chúng tôi đ ã nhận được 3 dòng ch ồi có khả năng vươn cao thành cây. Chúng đư ợc kiểm tra về khả năng sinh trưởng, ra rễ tr ên môi trường có hygromycin sẽ được trình bày d ưới dây. Hiện nay, tr ên thế giới, các nh à khoa h ọc dùng nhi ều phương pháp khác nhau [3, 6, 12, 16, 17, 21, 23, 24, 27] để chuyển một số ge n khác nhau nh ằm tạo ra các đặc tính mới cho cây cúc như cây chậm lão hoá [5, 9, 10, 13], tạo hoa có m àu sắc mới lạ, kháng virus [27]. d. Kiểm tra khả năng ra rễ trên môi trường có hygromycin Các cây vươn cao t ừ 2 cm trở lên được cấy sang môi trường MS không ch ất sinh trưởng có 5mg/l hygromycin đ ể theo d õi s ự sinh trưởng tiếp theo. So sánh với cây đối chứng, sự sinh trưởng tiếp tục với biểu hiện k èm theo là có s ự h ình thành r ễ là hai hi ện tượng xảy ra đồng thời đối với cây thực sự l à cây chuy ển gen; ngược lại, cây đối chứng mất ho àn toàn kh ả năng sinh trưởng dẫn đến sự chết sau đó tr ên cùng loại môi trường. e. Thử GUS Điểm gây sự chú ý ở đây l à các dòng chuyển gen đều cho kết quả âm tính đối với thử nghiệm GUS. Điểm đặc biệt nữa l à không chỉ riêng giống cúc này trên các dòng chuy ển gen khác nhau mà đối với giống cúc khác (đại đoá v àng Đồng Tháp) tạo ra cũng bằng phương pháp dùng vi khuẩn Agrobacterium v à bằng phương pháp chuyển gen khác (l à bắn gen) thì tất cả các dòng chuyển gen cũng đều cho kết quả âm tính (tài liệu của phòng). Theo một tài liệu nước ngoài, hiện tượng âm tính đối với thử GUS n ày vẫn chưa giải thích được khi dùng dòng vi khu ẩn LBA 4404 để chuyển nạp v à khi dùng promoter CAMV35S cho gen gusA. Tuy nhiên, theo chúng tôi, đây ch ỉ là gen chỉ thị nên dù có biểu hiện hay không l à điều không quan trọng, chỉ có điều nó gây cho ng ười nghiên cứu ít nhiều khó khăn khi muốn kiểm tra nhanh cây chuyển gen khi ch ưa cần làm PCR. f. Phân tich PCR các gen hph, gusA và ipt Các dòng cây được kiểm tra bằng PCR chỉ khi chúng đ ã qua giai đoạn tạo rễ v à có sinh trưởng bình thường trên môi trường có 5 mg/l hygromycin. K ết quả phân tích PCR các gen hph, gusA, ipt v ới các cặp mồi đặc hiệu cho thấy có sự hiện diện của các băng DNA được khuếch đại tương ứng là 800 bp, 365 bp và 355 bp.
  20. 363 Phần V: CÔNG NGHỆ GEN THỰC VẬT hph gusA ipt Hình hàng trên (t ừ trái sang phải): Phôi sô -ma, ch ồi hình thành tr ực tiếp v à gián tiếp từ mảnh l á Hình hàng d ưới (từ trái sang phải): Cụm chồi kháng hygromycin; phân tích PCR gen hph (800 bp), gen gusA (365 bp) và gen ipt (355 bp) KẾT LUẬN Qua nghiên c ứu nuôi cấy tái sinh cây v à chuyển nạp gen t rên cây cúc đại đoá vàng Đà Lạt nhờ vi khuẩn Agrobacterium tumefaciens, chúng tôi có một số kết luận sau: Trong số các môi trường khảo sát, môi trường thích hợp đồng thời cho việc tái sinh cây và cho nghiên c ứu chuyển nạp gen (ở khía cạnh cần sự tái sinh cây thông qua mô sẹo) là môi trường MS có 0,5mg/l NAA v à 1mg/l BA. Giống cúc nói tr ên rất mẫn cảm đối với hygromycin n ên việc chọn lọc áp lực cao (10mg/l hygromycin) ch ỉ nên được thực hiện trong 1 - 2 chu k ỳ đầu, sau đó cần giảm xuống (5 - 6mg/l hygromycin) ở giai đoạn tái sinh để có thể nhận đ ược chồi tái sinh. Đã nhận được 3 dòng cây cúc mang gen ipt, gen hph và gen gusA. Sự hiện diện của chúng đ ã được kiểm tra bằng phân tích PCR. LỜI CÁM ƠN Các tác gi ả xin chân thành cám ơn Sở Khoa học v à Công nghệ Thành ph ố Hồ Chí Minh đ ã tài trợ cho nghi ên cứu này. TÀI LI ỆU THAM KHẢO 1. Aida, R., S. Nagaya, K. Yoshida, S. Kishimoto, M. Shibata , A. Ohmiya, 2005. Efficient transgene expression in chrysanthemum, Chrysanthemum morifolium Ramat., with the promoter of a gene for tobacco elongation factor 1 protein. JARQ 39(4): 269-274. 2. Bhattacharya, P., S. Dey, N. Das, B. C. Bhattacharya, 1990. Rap id mass propagation of Chrysanthemum morifolium by callus derived from stem and leaf explants. Plant Cell Rep. 9: 439-442.
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2