Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells

Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells Guopei Zheng1,*, Min Zhou1,*, Xinrong Ou2, Bo Peng1, Yanhui Yu1, Fangren Kong1, Yongmei Ouyang1 and Zhimin He1

1 Cancer Research Institute, Xiangya School of Medicine, Central South University, Changsha, Hunan, China 2 Department of Stomatology, Xiangya Hospital, Central South University, Changsha, Hunan, China

Keywords CA9; cDNA microarray; drug resistance; pingyangmycin; tongue cancer

Correspondence Zhimin He, Cancer Research Institute, Xiangya School of Medicine, Central South University, Xiangya Road #110, 410078 Changsha, Hunan, China Fax: +86 0731 82355043 Tel: +86 0731 82355041 E-mail: hezhimin2005@yahoo.com

*These authors contributed equally to this work

(Received 20 June 2010, revised 6 August 2010, accepted 31 August 2010)

doi:10.1111/j.1742-4658.2010.07836.x

Drug resistance is the major obstacle to successful cancer treatment. To understand the mechanisms responsible for drug resistance in tongue can- cer, Tca8113 cells derived from moderately differentiated human tongue squamous cell carcinoma were exposed to stepwise escalated concentrations of pingyangmycin (PYM) to develop the resistant cell line called Tca8113 ⁄ PYM, which showed over 18.78-fold increased resistance to PYM as compared with Tca8113 cells, and cross-resistance to cisplatin, pirarubicin, paclitaxel, adriamycin, and mitomycin. We found that the resistance was not associated with multidrug resistance transporter 1 (p170, p-gp), multi- drug resistance-associated protein 1 and breast cancer resistance protein overexpression, so we hypothesized that Tca8113 ⁄ PYM cells must have some other resistance mechanism selected by PYM. To test this hypothesis, the global gene expression profiles between Tca8113 and Tca8113 ⁄ PYM cells were compared by cDNA microarray. Eighty-nine genes and thirteen expressed sequence tags with differential expression levels between the two cell lines were identified. Some differential expression levels were validated with real-time PCR and western blot. Furthermore, the functional valida- tion showed that both carbonic anhydrase (CA) inhibitor acetazolamide application and CA9 silencing with CA9 antisense oligonucleotides contrib- ute to the medium pH increase of Tca8113 ⁄ PYM cells and enhanced PYM chemosensitivity. Moreover, both acetazolamide and CA9 antisense oligo- nucleotides significantly increased PYM-induced caspase 3 activation in Tca8113 ⁄ PYM cells. Thus, our study suggests that the resistance of Tca8113 ⁄ PYM cells is probably associated with CA9 and other differential expression molecules, and that CA9 may be an important marker for pre- diction of PYM responsiveness in tongue cancer chemotherapy.

Introduction

Squamous cell carcinoma of the head and neck is the fifth most common cancer worldwide, and is a signifi- cant source of cancer morbidity and mortality. More

than 500 000 new cases are estimated to occur world- wide every year [1,2]. Tongue cancer is the most com- mon type of squamous cell carcinoma of the head and

FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS

4506

Abbreviations ADM, adriamycin; ASO, antisense oligonucleotide; Atz, acetazolamide; BCRP, breast cancer resistance protein; BMP2, bone morphogenetic protein 2; CA, carbonic anhydrase; cDDP, cisplatin; DKK1, dickkopf homolog 1; EST, expressed sequence tag; HIF, hypoxia-inducible factor; MDR, multidrug resistance; MDR1, multidrug resistance transporter 1 (p170, p-gp); MMC, mitomycin; MRP1, multidrug resistance- associated protein 1; MT, metallothionein; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; PARP, poly(ADP-ribose) polymerase; pHe, extracellular pH; pHi, intracellular pH; pNA, p-nitroaniline; PYM, pingyangmycin; VP-16, etoposide; 5-FU, fluorouracil.

G. Zheng et al. Role of CA9 in PYM resistance

Tca8113 ⁄ PYM cells, with acquired resistance induced by PYM, expecting to reveal new molecules related to PYM resistance, and to provide candidate biomarkers to predict the clinical response to PYM-based chemo- therapy in tongue cancers.

Results

Biological characteristics of Tca8113 ⁄ PYM cells

for PYM treatment

In order to explore the mechanism responsible for PYM resistance in tongue cancer, in the first step of the pres- line, ent study we established a PYM-resistant cell Tca8113 ⁄ PYM. The Tca8113 ⁄ PYM cell line was obtained by stepwise selection from its sensitive parent cell line with PYM over a period of 2 years. At the beginning of induction, cell growth was strongly sup- pressed. However, at the end of induction, Tca8113 ⁄ PYM cells exhibited a stable growth pattern in medium with 0.2 mgÆL)1 PYM. After further maintenance for 5 weeks in PYM-free medium, the mean population doubling time was found to be 35.76 ± 4.62 h for Tca8113 ⁄ PYM cells, as compared with 35.12 ± 4.18 h for Tca8113 cells (no statistically significant difference; P > 0.05) (Fig. 1A). After cells had been treated with different concentrations of PYM from 0 to 800 mgÆL)1 for 48 h, dose–response curves were plotted, as shown in Fig. 1B. The IC50 values in Tca8113 and Tca8113 ⁄ PYM cells were 27.16 ± 1.78 mgÆL)1 and 509.47 ± 37.71 mgÆL)1, respectively (P < 0.01). The resistance index was 18.78, indicating that the PYM-resistant cell line was successfully established.

neck, and the incidence is increasing every year. It is found to be rapidly progressing, to frequently metasta- size, and to have a poorer prognosis than carcinoma of other sites in the oral cavity [3]. Chemotherapy plays a very important role in tongue cancer treatment, especially for patients who are detected at a late stage or have potential recurrence after surgical procedures. The benefits of chemotherapy include reduction of the improved survival rate, and distant metastasis rate, preservation of organ function, whether or not com- bined with local ⁄ regional treatment [4]. In the clinic, pingyangmycin (PYM), cisplatin (cDDP) and fluoro- uracil (5-FU) are mostly used in chemotherapy of ton- gue cancer, but the effectiveness of monotherapy with PYM for preoperative chemotherapy is only about 67% [5,6]. Moreover, the therapeutic benefits of che- intrinsic motherapy can be attenuated because of and ⁄ or acquired drug resistance, especially multidrug resistance (MDR). ATP-binding cassette transporters such as MDR transporter 1 (p170, p-gp) (MDR1) have been reported in some primary tongue squamous cell chemotherapy-inducible, carcinomas, and they are showing relevance to drug resistance [7]. Accumulating evidence suggests that multiple complex mechanisms may be involved, simultaneously or complementarily, in the emergence and development of drug resistance in cancers. Although some advances in cancer drug resistance research have been made, indicating that ATP-binding cassette transporters play important roles in cancer drug resistance but cannot fully explain the resistance phenomenon, there are still only a few stud- ies focusing on tongue cancer.

The antiapoptotic activity of Tca8113 ⁄ PYM cells was also measured with Hoechst33258 stain (Fig. 1C). Twenty-four hours after treatment with 300 mgÆL)1 PYM, despite increased numbers of apoptotic cells, typically identified as those cells that possess signifi- cantly smaller, condensed and fragmented nuclei under a fluorescence microscope, in both cell lines, the rate of apoptosis in Tca8113 cells was much higher than that in Tca8113 ⁄ PYM cells: 88.10± 7.96% and 15.86± 2.75%, respectively (P < 0.01).

In addition,

PYM, a water-soluble glycopeptide produced by Streptomyces pingyangensin, is a new type of cytotoxic glycopeptide antitumor antibiotic developed in China in the 1980s. It is a member of the bleomycin family, and is also known as bleomycin A5. It has been found to reduce the DNA synthesis of cancer cells and cut off the DNA chain [8]. With its wide antitumor spec- trum and lower toxicity in chemotherapy of malignant tumors [9], PYM plays a particular curative role in chemotherapy for treatment of squamous cell carci- noma, malignant lymphoma, Hodgkin’s disease, and lymphangioma [10]. It is fairly extensively used in che- motherapy for the treatment of neoplasms in the head and neck region [10]. However, the therapeutic benefits of PYM can be attenuated in the clinic, because of intrinsic and ⁄ or acquired drug resistance, which is the major limitation of PYM-based chemotherapy.

is extremely important

it

in order to determine whether the resistance was associated with the overexpression of well-documented resistance-related molecules MDR1, multidrug resistance-associated protein 1 (MRP1), and breast cancer resistance protein (BCRP), RT-PCR was performed (Fig. 1D). There was no significant differ- ence in MDR1 or BCRP mRNA level between Tca8113 and Tca8113 ⁄ PYM cells, and there was no detectable expression of MRP1, indicating that resis- tance to PYM may be associated with some other mole- cules.

The mechanism of cellular resistance to PYM is not to fully understood, but understand it for successful treatment of tongue carci- noma. In this study, we established a cellular model,

FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS

4507

G. Zheng et al. Role of CA9 in PYM resistance

A

) 4 0 1 × ( l l e w / r e b m u n

l l e C

Fig. 1. Biological characteristics of Tca8113 ⁄ PYM cells. (A) Growth curves for both cell lines were obtained in three independent exper- iments, and showed no difference in the mean doubling time. (B) Responses of Tca8113 and Tca8113 ⁄ PYM cells to PYM. Tca8113 ⁄ PYM cells were more resistant to the antiproliferative activity of PYM. Each point represents the mean of six independent experi- ments. (C) The effects of PYM-induced apoptosis on both cell lines were observed with Hoechst33258 stain. The results represent three independent experiments, and show that Tca8113 ⁄ PYM cells are much more resistant to PYM-induced apoptosis. (D) Relative mRNA expression levels of MDR1, MRP1 and BCRP between both cell lines after normalization to b-actin mRNA levels were deter- mined by RT-PCR. RT-PCR analysis was repeated three times, and showed no significant expression difference between the two cell lines for MDR1 or BCRP, and no detectable expression of MRP1.

Days

B

Cross-resistance profiles of Tca8113 ⁄ PYM cells

)

%

(

i

e t a r n o i t i b h n

I

summarized in Table 1. The

results

Concentration of PYM (mg·L–1)

lines to cDDP, piraru- The sensitivities of both cell bicin, paclitaxel, mitomycin (MMC), adriamycin (ADM), etoposide (VP-16) and 5-FU were determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay, and the IC50 for each agent was calculated. Both cell lines were treated with differ- ent concentrations of each agent, and the IC50 values are revealed Tca8113 ⁄ PYM cells showed resistance to cDDP, pira- rubicin, paclitaxel, ADM and MMC, but not to VP-16 or 5-FU, indicating that Tca8113 ⁄ PYM was a typical MDR model, and that studies on the mechanism of resistance in this cell line have potential significance.

C

Differential gene expression profiles between Tca8113 ⁄ PYM and Tca8113 cells

Because there were no differences in expression of the well-known resistance-related genes MDR1, MRP1 or BCRP, to identify genes generally involved in PYM

Table 1. IC50 values (mgÆL)1) for selected agents (mean ± stan- dard deviation, n = 3). The results show MDR characteristic of Tca8113 ⁄ PYM cells. RI, resistance index, representing IC50Tca8113 ⁄ PYM ⁄ IC50Tca8113.

Agent Tca8113 RI Tca8113 ⁄ PYM

D

509.47 ± 37.71** 7.92 ± 0.60**

23.68 ± 3.63* 0.64 ± 0.15* 6.72 ± 0.87* 0.87 ± 0.14*

PYM cDDP Paclitaxel MMC Pirarubicin ADM VP-16 5-FU 27.16 ± 1.78 2.27 ± 0.50 11.07 ± 1.63 0.32 ± 0.03 3.33 ± 0.55 0.48 ± 0.14 17.50 ± 6.21 10.68 ± 2.54 27.29 ± 8.73 10.78 ± 2.39 18.78 3.49 2.14 1.99 1.88 1.81 1.56 1.01

FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS

4508

**P < 0.01 and *P < 0.05 versus Tca8113.

G. Zheng et al. Role of CA9 in PYM resistance

compared gene

expression profiles resistance we between Tca8113 ⁄ PYM and Tca8113 cells by cDNA microarray. We excluded genes whose expression was increased or decreased by less than two-fold in PYM- resistant cells (as compared with the parent cells). A total of 89 genes were selected, among which 41 genes were upregulated (Table 2) and 48 genes were down- regulated (Table 3) in the Tca8113 ⁄ PYM cell line. In addition, 13 expressed sequence tags (ESTs) were also selected, four of which were upregulated and nine of

which were downregulated (Table 4). Interestingly, in our microarray data, there were also no significant dif- ferences in expression of MDR1, MRP1 or BCRP between these two cell in agreement with the lines, results of RT-PCR, so we considered that the resis- tance may be related to a number of other differential genes associated with a variety of cellular functions, such as those encoding carbonic anhydrase (CA) 9, metallothionein (MT) 2A, bone morphogenetic pro- tein 2 (BMP2), and dickkopf homolog 1 (DKK1).

Table 2. Genes with upregulated expression in Tca8113 ⁄ PYM cells.

No. Gene name GenBank ID Gene product Ratio

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 CA9 BMP2 PARN LYPD3 ITPR1 MT2A ITGA5 NOL5A SDC4 C20orf139 PPP2R2B ITGB5 METRN NOL5A EIF4G1 MAN1B1 ENO2 DDIT4 SGK TSC22D1 NCBP2 RUVBL1 HNRPAB NDRG1 GCLC PGRMC2 FKBP1A MT1K FRS3 NM_001216 NM_009309 NM_002582 NM_014400 NM_002222 NM_175617 NM_002205 NM_006392 NM_002999 NM_080725 NM_004576 NM_002213 NM_024042 NM_006392 NM_182917 NM_016219 NM_001975 NM_019058 NM_005627 NM_183422 NM_007362 NM_003707 NM_031266 NM_006096 NM_001498 NM_006320 NM_000801 NM_176870 NM_006653 4.993 4.933 3.644 3.208 2.98 2.955 2.881 2.71 2.623 2.621 2.618 2.604 2.546 2.524 2.386 2.382 2.377 2.371 2.353 2.307 2.277 2.268 2.258 2.249 2.235 2.222 2.215 2.215 2.188 Carbonic anhydrase 9 Bone morphogenetic protein 2 Poly(A)-specific ribonuclease LY6 ⁄ PLAUR domain containing 3 Inositol 1,4,5-trisphosphate receptor, type 1 Metallothionein 2A Integrin a5 precursor Nucleolar protein 5A (56 kDa with KKE ⁄ D repeat) Syndecan 4 (amphiglycan, ryudocan) Sulfiredoxin-1 b-Isoform of regulatory subunit B55, protein phosphatase 2 isoform a Integrin b5 Meteorin, glial cell differentiation regulator Nucleolar protein 5A (56 kDa with KKE ⁄ D repeat) Eukaryotic translation initiation factor 4c, 1 a-1,2-Mannosidase Enolase 2 RTP801 Serum ⁄ glucocorticoid-regulated kinase TSC22 domain family, member 1 Nuclear cap-binding protein subunit 2 Similar to RuvB (E. coli homolog)-like 1 Homo sapiens heterogeneous nuclear ribonucleoprotein A ⁄ B N-myc downstream-regulated gene 1 Glutamate-cysteine ligase, catalytic subunit Progesterone membrane-binding protein FK506-binding protein 1A Metallothionein-1k suc1-associated neurotrophic factor target 2 (fibroblast growth factor receptor substrate 2)

30 31 32 33 34 35 RAB31 MCM2 RSL1D1 EHD4 C20orf30 SFPQ NM_006868 NM_004526 NM_015659 NM_139265 NM_014145 NM_005066 2.147 2.102 2.097 2.075 2.072 2.06 Small GTP-binding protein rab22b Minichromosome maintenance protein 2 homolog Ribosomal L1 domain containing 1 Hepatocellular carcinoma-associated protein HCA10 Chromosome 20 ORF 30 Splicing factor proline ⁄ glutamine rich (polypyrimidine tract-binding protein associated)

36 37 38 39 MT1B CUL4A MYC P4HA1 NM_005947 NM_003589 NM_002467 NM_000917 2.028 2.022 2.021 2.018

FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS

4509

40 41 TPM4 SOCS3 NM_003290 NM_003955 2.006 2.004 Metallothionein 1B Cullin 4A v-myc myelocytomatosis viral oncogene homolog Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), a-polypeptide I Tropomyosin 4 Suppressor of cytokine signaling 3

G. Zheng et al. Role of CA9 in PYM resistance

Table 3. Genes with downregulated expression in Tca8113 ⁄ PYM cells.

No. Gene name GenBank ID Gene product Ratio

1 2 3 4 5 PTGES FBN2 MAGEB2 RBP4 GALNT10 NM_198797 NM_001999 NM_002364 NM_006744 NM_198321 3.356 3.279 3.086 2.941 2.653 Prostaglandin E synthase Fibrillin 2 Melanoma antigen family B PRO2222 UDP-N-acetyl-a-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10

6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 UPP1 HLA-C HIST1H2BK HOXB7 COX7B SCNN1A AMACR GSTK1 CASP1 DKK1 IDI1 RPS4X USP37 H2bk MYST4 GNG11 PQBP1 FKBP9 PSPHL C15orf24 HSPC016 DPYSL2 ARF4 SLTM TCP1 SIGLEC5 CAS1 DHCR24 PGD IDH3A ABHD10 MED11 TMEM85 UXT NRD1 MUCDHL PKN3 HSPH1 ALG12 B2M ZNF541 NOLA3 PDGFA NM_181597 NM_002117 NM_080593 NM_004502 NM_001866 NM_001038 NM_014324 NM_015917 NM_033292 NM_012242 NM_004508 NM_001007 NM_020935 NM_080593 NM_012330 NM_004126 NM_005710 NM_007270 NM_003832 NM_020154 NM_015933 NM_001386 NM_001660 NM_024755 NM_030752 NM_003830 NM_022900 NM_014762 NM_002631 NM_005530 NM_018394 NM_001001683 NM_016454 NM_153477 NM_002525 NM_021924 NM_013355 NM_006644 NM_024105 NM_004048 NM_032255 NM_018648 NM_002607 2.625 2.618 2.577 2.5 2.475 2.457 2.451 2.375 2.37 2.32 2.299 2.242 2.242 2.242 2.237 2.232 2.232 2.212 2.212 2.198 2.141 2.132 2.132 2.123 2.119 2.119 2.105 2.105 2.079 2.066 2.058 2.037 2.033 2.028 2.024 2.02 2.02 2.016 2.016 2.012 2.008 2.004 2.004 Uridine phosphorylase 1 HLA class I histocompatibility antigen H2B histone family, member T Homeobox B7 Cytochrome c oxidase subunit VIIb precursor Amiloride-sensitive sodium channel subunit a a-Methylacyl-CoA racemase Glutathione S-transferase j1 Caspase 1 Dickkopf homolog 1 Isopentenyl-diphosphate d isomerase Ribosomal protein S4, X-linked Desmuslin isoform B; desmuslin isoform A Histone cluster 1 MYST histone acetyltransferase (monocytic leukemia) 4 Guanine nucleotide-binding protein (G protein), c11 Polyglutamine-binding protein 1 FK506-binding protein 9 Phosphoserine phosphatase-like Chromosome 15 ORF 24 Coiled-coil domain-containing protein 72 Dihydropyrimidinase-like 2 ADP-ribosylation factor 4 SAFB-like, transcription modulator t-complex 1, transcript variant 1 Sialic acid-binding Ig-like lectin 5 O-acetyltransferase 24-Dehydrocholesterol reductase Phosphogluconate dehydrogenase Isocitrate dehydrogenase 3 (NAD+) a Abhydrolase domain containing 10 Mediator complex subunit 11 Transmembrane protein 85 Ubiquitously expressed transcript isoform 2 Nardilysin (N-arginine dibasic convertase) l-Protocadherin isoform 1 Protein kinase N3 Heat shock 105 kDa Asparagine-linked glycosylation 12 homolog b2-Microglobulin Zinc finger protein 541 Nucleolar protein family A, member 3 Platelet-derived growth factor a isoform 1 ⁄ 2

Confirmation of differential expression by real-time PCR and western blot

To confirm the results of the microarray, we carried out quantitative real-time PCR and western blot, each

been repeated three times. Eight differential expression genes and ESTs were examined at the mRNA level (Fig. 2A). A good correlation between the real-time PCR results and the microarray data was seen. For example, the mean fold changes in upregulation as

FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS

4510

G. Zheng et al. Role of CA9 in PYM resistance

Table 4. ESTs with downregulated ⁄ upregulated expression in Tca8113 ⁄ PYM cells.

No. GenBank ID UniGene Cluster ID Fold downregulation ⁄ upregulation

functional

linkages

CD237904, and 2.544 and 2.884 for AL707095. The mean fold changes in downregulation as determined by microarray analysis and by real-time PCR were, respectively, 2.320 and 2.794 for DKK1, and 2.415 and 2.895 for BC037851. Also, the expression of MT2A and CA9 was further tested by western blot (Fig. 2B), exploring their to biochemical mechanisms that could be related to PYM resistance. Both real-time PCR and western blot analyses con- firmed the microarray results.

CA9 interference sensitizes Tca8113 ⁄ PYM cells to PYM

CD237904 AL707095 AK095731 BU540113 AK026328 BC037851 AF150180 BG928109 KIAA0218 AK026818 BX647692 ARHGAP11A AK128436 Hs.661577 Hs.475334 Hs.634213 Hs.460089 Hs.232604 Hs.385499 Hs.571467 Hs.669957 NM_014760 Hs.605083 Hs.639904 NM_014783 Hs.371680 3.722 2.544 2.434 2.025 )2.584 )2.415 )2.217 )2.174 )2.132 )2.024 )2.016 )2.008 )2 1 2 3 4 5 6 7 8 9 10 11 12 13

A

B

Fig. 2. Validation of microarray results. (A) Real-time PCR: relative expression levels of selected transcripts are shown in a fold scale between Tca8113 ⁄ PYM and Tca8113 by normalizing against b-actin. Bars and standard errors representing relative expression of tested genes normalized against b-actin in the data were obtained from three independent experiments. (B) Using western blot, we validated the protein expression levels of MT2A and CA9, using a-tubulin as a loading control. The figure represents three independent experiments.

Recent studies have demonstrated that CA9 over- expression represents biological tumor aggressiveness, and is associated with poor clinical outcome in several tumors, including head and neck, cervix, kidney and lung cancers. However, the nature and mechanism of CA9 involvement are not well established; in particu- lar, direct evidence in drug resistance is lacking. In our present study, CA9 expression was upregulated in Tca8113 ⁄ PYM cells, and we conducted two series of experiments to investigate its role in PYM resistance. In the first series of experiments, the CA function inhibitor acetazolamide (Atz) was used. First, we determined 800 lm as the concentration of Atz to be used for the follow-up experiments (data not shown). Then we measured the pH of the culture medium affected by Atz. The pH of Tca8113 ⁄ PYM cells, 6.37 ± 0.11, is much lower than that of Tca8113 cells, 6.65 ± 0.16, indicating that CA9 does actually play a role. After Atz administration, the medium pH of Tca8113 ⁄ PYM cells was significantly increased, by about 0.36 units (Fig. 3A). We found that 800 lm Atz enhanced the sensitivity of Tca8113 ⁄ PYM cells to PYM, with an IC50 reduction from 509.47 ± 37.71 mgÆL)1 to 89.41 ± 9.33 mgÆL)1 (P < 0.01), but had no effect on their parent cell line, Tca8113 (Fig. 3B). In addition, we observed the effect of Atz on PYM-induced apoptosis with Hoechst33258 stain, and found that Atz combined with 100 mgÆL)1 PYM increased the proportion of apoptotic Tca8113 ⁄ PYM cells by about 56% (Fig. 3C). The observation of apoptosis was validated by the detection of the func- tional states of caspase 3 and poly(ADP-ribose) poly- merase (PARP) at the protein level 24 h after the respective treatments, suggesting that Atz can signifi- cantly enhance 100 mgÆL)1 PYM-induced caspase 3 and PARP cleavage (Fig. 3D).

determined by microarray analysis and by real-time PCR were, respectively, 4.993 and 5.584 for CA9, 4.933 and 4.291 for BMP2, 3.772 and 4.815 for

To further validate the functional role of CA9 upregulation in Tca8113 ⁄ PYM cells, in the second ser- ies of experiments inhibition of CA9 gene expression

FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS

4511

G. Zheng et al. Role of CA9 in PYM resistance

A

B

C

D

Fig. 3. The effect of inhibition of CA9 function by Atz on PYM activity. Every experiment was repeated three times, and bars and standard errors in the data were obtained from three independent experiments. (A) The pH change of Tca8113 and Tca8113 ⁄ PYM cells with or with- out Atz treatment. The pH of the culture medium for Tca8113 ⁄ PYM cells was much lower than that for Tca8113 cells. Atz clearly increased the pH of culture medium for Tca8113 ⁄ PYM cells, but not for Tca8113 cells. 4, versus Tca8113, P < 0.05; q, versus Tca8113, P > 0.05; h, versus Tca8113 ⁄ PYM, P < 0.01. (B) The dose–inhibition rate curve plotted from MTT assay results. Atz significantly enhanced the effect of PYM on Tca8113 ⁄ PYM cells, with a marked reduction in IC50 value, but not on Tca8113 cells. (C) Atz significantly enhanced PYM-induced apoptosis of Tca8113 ⁄ PYM cells as shown by Hoechst33258 stain, and indicated with arrows, representing three independent experiments. (D) Caspase 3 and PARP cleavage represent molecular effects of Atz combined with PYM on Tca8113 ⁄ PYM cells.

cant effects on the induction of antiproliferation or apoptosis by 100 mgÆL)1 PYM. Caspase 3 and PARP cleavage was also detected (Fig. 4E), suggesting that silencing of CA9 expression could suppress the antia- poptotic activity of Tca8113 ⁄ PYM cells to enhance the PYM effect.

by (cid:2) 0.3 units

94.78 ± 9.62 mgÆL)1

to

cells

with CA9 antisense oligonucleotides (ASOs) was employed. Tca8113 ⁄ PYM cells were transfected with CA9 ASOs, and western blot analysis showed that ASO 2# markedly downregulated CA9 expression, so the ASO 2# was selected for further study (Fig. 4A). CA9 ASO transfection elevated the medium pH of (P < 0.01) Tca8113 ⁄ PYM cells (Fig. 4B) and enhanced PYM chemosensitivity, with a significant decrease in the IC50 value from 509.47 ± 37.71 mgÆL)1 (P < 0.01) (Fig. 4C), and an increase of (cid:2) 52% in the proportion induced by 100 mgÆL)1 PYM of apoptotic (Fig. 4D); the control scrambled ASO had no signifi-

To further observe the enhanced effect of CA9 inter- ference on PYM-induced Tca8113 ⁄ PYM apoptosis, cas- pase 3 activity was investigated. Tca8113 ⁄ PYM cells were pretransfected with scrambled ASO and CA9 ASO, and then incubated in 100 mgÆL)1 PYM. Simulta- neously, Tca8113 ⁄ PYM cells were treated with 100 mgÆL)1 PYM alone or combined with Atz. After

FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS

4512

G. Zheng et al. Role of CA9 in PYM resistance

A

C

B

E

D

F

Fig. 4. The effect of CA9 ASO on PYM. Every experiment was repeated three times, and bars and standard errors in the data were obtained from three independent experiments. (A) The CA9 expression change mediated by ASO showed that CA9 ASO2# significantly reduced the CA9 protein level. So the CA9 ASO 2# was selected for the follow-up experiments. (B) CA9 ASO increased the medium pH of Tca8113 ⁄ PYM cells, but scrambled ASO did not. *:versus Tca8113 ⁄ PYM, P < 0.01. (C, D) CA9 ASO significantly decreased cell viability, with a marked reduction in IC50 value, and increased the apoptotic activity induced by PYM on Tca8113 ⁄ PYM cells. (E) Western blot analysis revealed that CA9 ASO could enhance PYM-induced caspase 3 activation and subsequent PARP cleavage. (F) Effect of CA9 ASO on PYM-induced caspase 3 activation on Tca8113 ⁄ PYM cells. The rela- tive activation of caspase 3 shown was cal- culated from the average of three experiments. Each value is expressed as ratio of caspase 3 activation level to untreated level, and the untreated level was set to 1. *versus untreated, P > 0.05; **versus untreated, P < 0.01.

24 h of treatment, caspase 3 activity was determined. As shown in Fig. 4F, Atz and CA9 ASO significantly increased PYM-induced caspase 3 activity in Tca8113 ⁄ - PYM cells (P < 0.01) as compared with untreated cells.

Discussion

resistance

A major problem in the clinical chemotherapeutic treatment of cancer is intrinsic or acquired resistance to current chemotherapeutic agents [11], particularly the acquisition of MDR. This underlines the critical importance of exploring the molecular mechanisms involved in the drug resistance of cancer cells for improving current treatments in the clinic.

PYM is widely used in the treatment of various squamous cell tumors, including tongue cancer. This stresses the need to elucidate the mechanism of drug resistance induced by PYM. Here, we established an isogenic PYM-resistant variant, Tca8113 ⁄ PYM, from the tongue cancer cell line Tca8113 to compare their gene expression profiles directly. cDNA microarray analysis, which is a powerful technology for the identi- fication of well-documented and novel genes associated with response or to chemotherapeutic agents, was used [12], and revealed that 41 genes were upregulated and 48 genes were downregulated in the Tca8113 ⁄ PYM cell line. However, there were no differ- ences in the expression of MDR1, MRP1 or BCRP

FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS

4513

G. Zheng et al. Role of CA9 in PYM resistance

between the two cell lines, revealing that the drug resis- tance of tongue cancer induced by PYM may be related to some other molecules, such as CA9.

squamous

et al. [23] showed that forced expression of CA9 con- tributed to extracellular acidification and to the main- tenance of a more alkaline resting pHi. Importantly, the efficiency of caspase activation by cytC was found to be pH-sensitive, and lower pH contributed to more caspase activation [24]. The change in cytosolic pH may play a very important role in regulating the apop- totic process, but whether CA9-mediated drug resis- tance is associated with the maintenance of cytosolic pH, what happens inside cells after Atz or CA9 ASO is administered in combination with PYM, and how the overexpression of CA9 occurrs during PYM induc- tion will be investigated in further studies.

chemotherapy inducible

CA9 plays a very important role in PYM-induced drug resistance, but CA9 interference cannot com- pletely reverse resistance. Most of the other genes with altered expression are correlated with tumorigenesis, and some reports have also suggested a role for them in the drug response. For example, MTs, which are known to participate in fundamental cellular processes such as cell proliferation and apoptosis [25,26], have been suggested to protect against toxic and carcino- genic events mediated by a broad range of nonmetal lines of evidence suggest that toxicants [27]. Several MTs are [28], and their expression constitutes a protective mechanism that pre- vents the apoptosis induced by cisplatin and doxorubi- cin [29,30]. In addition, irinotecan-induced changes in MT expression correlated with clinical response in gas- tric cancer patients, and MT overexpression modestly increased the resistance of AGS cells to irinotecan [31]. In our previous study, we established a human MT2A recombinant with soluble high-yield expression, and demonstrated its hydroxyl radical-scavenging ability and significant protective role against DNA damage caused by UVC radiation [32]. In the present study, the expression of MT2A was upregulated in Tca8113 ⁄ PYM cells. MT2A, as the main isoform of MTs, may closely mediate the resistance of Tca8113 ⁄ PYM cells to PYM.

CA9 is a zinc metalloenzyme catalyzing the revers- ible conversion of CO2 to bicarbonate and a proton, is a cell surface glycoprotein, and reduces local extracel- lular pH [13]. CA9 overexpression has been identified in a number of solid tumors, including renal carcino- mas and, particularly, clear cell adenocarcinomas, cer- vical carcinomas, ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladder carcinomas and non-small cell lung carcinomas. CA9 is strongly induced by hypoxia via the transcription factor hypoxia-inducible factor (HIF)-1 or by an HIF- independent pathway, such as the activation of oncog- enes (Ras, SRC, and PI3K) or inactivation of tumor suppressor genes (PTEN and p53), and is thought to play a role in the regulation of cancer cell prolifera- tion, cell transformation and survival under normoxia or hypoxia, making it a potential target for cancer therapy [14–16]. However, the array analysis showed no significant differences in expression of the above genes between Tca8113 and Tca8113 ⁄ PYM cells, and the western blot analysis of HIF-1a also showed no difference (data not shown). These negative data imply that a different mechanism, such as methylation or microRNA, is responsible for the upregulation of CA9 expression. Michael et al. suggested that CA9 expres- sion in squamous cell head and neck tumor had a significant relationship with resistance to chemoradio- therapy [17], in support of our study, but there was a lack of direct evidence for the mechanism. In our pres- study, CA9 expression was much higher ent in Tca8113 ⁄ PYM cells and the extracellular pH was much lower in the same incubation conditions. Gener- ally, solid tumors maintain a high intracellular pH (pHi) but a low extracellular pH (pHe). Adaptation of tumor cells to hypoxia and acidosis is a critical driving force in tumor progression and metastasis [18,19]. Tumor cells have developed key strategies to regulate their pHi, because a pHi variation of 0.1 can disrupt multiple biological functions, including ATP produc- tion, protein synthesis, cell proliferation, migration, and apoptosis [20–22]. Whether the adaptation corre- lates with the drug resistance needs further investiga- tion. Here, both CA9 function inhibition and CA9 expression silencing elevated the pHe of Tca8113 ⁄ PYM cells, suggesting that CA9 function really con- tributed to the regulation of pHe. Moreover, CA9 interference significantly decreased the IC50 of PYM in Tca8113 ⁄ PYM cells, and enhanced the effect of PYM-induced cell apoptosis and caspase 3 activity. However, the exact mechanism is still unclear. Chiche

BMP2 is a member of the transforming growth fac- tor superfamily, and is now recognized as a multipur- pose cytokine that stimulates migration and induces the proliferation and differentiation of many different cell types. BMP2 is expressed in a variety of carcinoma cell lines, especially tumors originating from the head and neck [33]. Recombinant BMP2 caused an (cid:2) 50% increase in early tumor growth of A549 cells in athy- mic nude mice, whereas BMP2 antagonists inhibited tumor growth by 50% [34]. Elaine et al. found that formation in BMP2 greatly enhanced blood vessel tumors formed by A549 cells in nude mice, and that, in vitro in endothelial cells, BMP2 stimulated Smad1 ⁄ 5,

FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS

4514

G. Zheng et al. Role of CA9 in PYM resistance

Erk1 ⁄ 2, and Id1 expression, which was associated with an increase in tube formation and proliferation, and suggested that BMP2 could promote tumor growth by stimulating angiogenesis [35]. BMP2 is closely related to cancer, but its role in chemotherapy has not been reported. Our data showed that expression of BMP2 in Tca8113 ⁄ PYM cells is 4.933-fold higher than in Tca8113 cells, so further investigations should be per- formed.

serum (Gibco, Carlsbad, CA, USA) at 37 (cid:2)C in a humidified atmosphere containing 5% CO2. The Tca8113 ⁄ PYM cell line was established by intermittent stepwise selection in vitro with PYM (Harbin Bolai Pharmaceutical, Harbin, China) over a period of 24 months, starting at 1 mgÆL)1 and ending at 30 mgÆL)1. Despite massive cell death among the sensitive Tca8113 cells under treatment, the cultures were maintained by regular changes of medium, with intermittent increases in the PYM concentration until the surviving cells recovered a normal growth pattern in medium with 0.2 mgÆL)1 PYM. Before experiments were performed, Tca8113 ⁄ PYM cells were maintained in PYM-free medium for at least 2 weeks. To investigate the cell growth curve, cells were seeded in a six-well plate at 5 · 104 cells per well, and the culture med- ium was replaced with fresh medium without PYM. Four wells were trypsinized each time after 1, 2, 3, 4, 5 and 6 days of incubation, and the cell number was determined. The average cell count obtained at each time point was plotted against the time, and the doubling time was calculated for the exponential growth phase.

MTT assay

It is well known that the Wnt–b-catenin pathway is aberrantly activated in many carcinomas [36]. As one of the natural Wnt antagonists, DKK1 simultaneously binds to LRP5 ⁄ 6 and the transmembrane proteins Kre- men 1 ⁄ 2, and induces LRP endocytosis, which prevents the formation of Wnt–Frizzled–LRP5 ⁄ 6 receptor com- plexes and blocks Wnt–b-catenin signaling [37,38]. DKK1 seems to have antitumor effects independently of the antagonism of b-catenin–TCF transcriptional activity in H28 and MS-1 mesothelioma and HeLa cer- vical cancer cells [39,40]. Some studies have demon- strated that DKK1 is downregulated in colon cancer [41] and medulloblastoma cells, perhaps because of the methylation of the promoter, and restoration of DKK1 expression can induce apoptosis and suppress colony formation [42]. As a suppressor of cancer, the downreg- ulated expression of DKK1 is associated with chemore- sistance, consistent with previous studies. However, whether its downregulation is the result of methylation of the promoter in Tca8113 ⁄ PYM cells and its precise effects in suppressing cancer or reversing of PYM resis- tance will be investigated in future studies.

Cells were seeded in 96-well plates at a density of 5 · 103 cells per well (200 lL per well) for 24 h before use. The culture medium was replaced with fresh medium containing antican- cer drug for 48 h. Water-soluble MTT (Sigma-Aldrich, St Louis, MO, USA) was added (20 lL). After 4 h of incuba- tion, the supernatant was discarded and the purple crystals were resuspended in 200 lL of dimethylsulfoxide. The absor- bance of each well was read at 570 nm on an ELISA XL (BIOHIT, BP800, Helsinki, Finland). The growth rate was cal- culated as the ratio of the absorbance of the experimental well to that of a blank well, and the IC50 was also calculated.

Hoechst stain

In addition, among the ESTs, we have identified a novel gene termed TCRP1 (tongue cancer drug resis- that tance associated protein; Genebank:EF363480) particularly mediates cDDP resistance, and a related study is being performed (data not shown).

In conclusion, the Tca8113 ⁄ PYM and Tca8113 cell lines are useful models for identifying candidate targets responsible for the mechanism of PYM-induced drug resistance in tongue cancer. Using cDNA microarray technology, we have identified 89 genes and 13 ESTs that may be related to PYM-inducible resistance. In particular, CA9 seems to be a potential biomarker, and its interference may be promising in drug resis- tance reversion.

Cells in exponential growth were cultured with fresh med- ium in a six-well plate in which the coverslips had been placed. After incubation for 24 h, cells were treated with or without agent for 48 h. Then, Hoechst33258 was used to detect apoptosis according to a standard procedure, a fluo- rescence microscope was used to observe apoptotic cells, which were typically identified as cells possessing signifi- cantly smaller, condensed and fragmented nuclei, the apop- totic cell number was determined under at least three views for every treated group, and the rate of apoptosis was cal- culated. The experiments were repeated three times.

Experimental procedures

RT-PCR and real-time PCR

Establishment of the Tca8113 ⁄ PYM cell line

Total RNA was extracted with a Trizol protocol, and cDNAs from the mRNAs were synthesized with the Super- Script first-strand synthesis system (Fermentas Life Science,

Tca8113 cells obtained from the China Center for Type Cul- ture Collection (Wuhan, China) were cultured in RPMI-1640 (Gibco, Carlsbad, CA, USA) containing 10% fetal bovine

FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS

4515

G. Zheng et al. Role of CA9 in PYM resistance

Table 5. Primers used for PCR.

Gene Size (bp) Forward primer (5¢- to 3¢) Reverse primer (5¢- to 3¢)

was carried out with antibodies against MT2A (rabbit poly- clonal antibody produced by our laboratory), CA9 and HIF-1a (Santa Cruz Biotechnology, Santa Cruz, CA, USA), caspase 3 and PARP (Cell Signal, Danvers, MA, USA), respectively, fol- lowed by incubation with a horseradish peroxidase-conjugated secondary antibody. Protein bands were detected with an ECL detection system (Amersham Biosciences, Beijing, China). The a-tubulin was detected with mAb (Santa Cruz Biotechnology) simultaneously as a loading control. All western blot analyses were repeated at least three times.

GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT GTACTTGCGCTCAGGAGGAG 178 246 173 138 83 259 92 128 109 114 107 312 MDR1 MRP1 BCRP CA9 BMP2 MT2A CD237904 AL707095 AK095731 DKK1 BC037851 b-Actin

Administration of CA9 ASOs to Tca8113 ⁄ PYM cells

Glen Brunie, MA, USA). The primer sets were synthesized by Invitrogen Biotechnology (Shanghai, China), and prod- uct lengths are listed in Table 5. MDR1, MRP1, BCRP and b-actin products were analyzed on a 1.5% agarose gel. Real-time PCRs of CA9, BMP2, MT2A, CD237904, AL707095, AK095731, DKK1 and BC037851 were carried out according to the standard protocol on a Roche Light- Cycler (Roche, Florence, CA, USA) with SYBR Green detection (TaKaRa SYBR Green Supermix). b-Actin was used as an internal (no differential expression) control. The fold change in relative expression of the target gene relative to b-actin was then calculated with the formula described by Livak et al. [43]. The real-time PCR for all selected genes was repeated three times.

cDNA microarray

sapiens

including Homo

efficiency,

tubulin,

A high-density oligonucleotide microarray (GeneChip_ Human 14K-Gene expression profile V2.0; Biochip Co., Shanghai, China) containing 15 553 probe sets was used to compare the gene expression profiles, according to the manu- facturer’s instructions. After hybridization, the signal inten- sity of the gene expression level was calculated with genechip operating software imagene (Affymetrix, Santa Clara, CA, USA). A number of housekeeping genes, as well as spike-in control transcripts were used to determine hybridiza- tion glyceraldeh lactate yde-3-phosphate dehydrogenase, b-actin, dehydrogenase, CYC1, H2be, EIF4A2, UBB, and NUP98. Genes whose expression levels were increased or decreased by more than two-fold in PYM-resistant cells (as compared with parent cells) were considered to be differentially expressed.

The three sequences of CA9 ASOs corresponding to differ- ent sites of human CA9 (1, 5¢-CCTCTCTGGGTGAAT CCTCTT-3¢; 2, 5¢-CAACTGCTCATAGGCACTGTT-3¢; and 3, 5¢-AATGAGCAGGACAGGACAGTT-3¢) were selected, and a scrambled oligonucleotide (5¢-TTCTCCTA AGTGGGTCTCTCC-3¢) was used as a control. The cells were transfected according to the instructions provided by the manufacturer of oligofectamine, a cationic lipid (Invi- trogen). Briefly, the day before transfection, Tca8113 ⁄ PYM cells were plated into six-well plates. When the cells were 30–50% confluent, they were transfected with 50 nm CA9 ASO or scrambled ASO after a preincubation for 20 min with oligofectamine in serum-free medium. Six hours after the beginning of the transfection, the medium was replaced with RPMI-1640 medium containing 10% fetal bovine serum. Two days later, CA9 expression was determined by western blot, the cell viability after PYM treatment was examined by MTT assay, and apoptosis was detected with Hoechst33258 stain.

Western blot analysis

Caspase 3 activity assay

Total proteins were extracted from cells, and then separated by 10% SDS ⁄ PAGE. The proteins were then transferred to a poly(vinylidene difluoride) membrane, and immunoblotting

Caspase 3 activity was determined with a caspase 3 activity kit (Beyotime), through cleavage of a colorless substrate

FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS

4516

7 Leng WD, Wang DZ, Feng G & He J (2004) Expres- sion and implication of Pgp, MRP, LRP, GST-p, Top-a in tongue squamous cell carcinoma. West China J Stomatol 1, 23–25.

8 Tai KW, Chang YC, Chou LSS & Chou MY (1998) Cytotoxicity effect of pingyangmycin on cultured KB cells. Oral Oncol 34, 219–223.

9 Li XT (1990) Anticancer spectrum of pingyangmycin in vitro. Zhongguo Yi Xue Ke Xue Yuan Xue Bao 12, 182–186.

specific for caspase 3 [Ac-DEVD-p-nitroaniline (pNA)], releasing the chromophore pNA. Assays were carried out according to the manufacturer’s instructions. To evaluate the activity of caspase 3, cell lysates were prepared after their respective treatments with various designated proce- dures. Assays were performed on 96-well microtiter plates by incubating 10 lL of protein from cell lysate per sample in 80 lL of reaction buffer and 10 lL of caspase 3 sub- strate (Ac-DEVD-pNA, 2 mm). Lysates were incubated at 37 (cid:2)C for 4 h. Samples were measured with an ELISA reader at an absorbance of 405 nm.

10 Zhong PQ, Zhi FX, Li R, Xue JL & Shu GY (1998)

G. Zheng et al. Role of CA9 in PYM resistance

Statistical analyses

Quantitative results were expressed as the mean ± standard deviation. Statistical analyses were carried out with spss for Windows, Version 11.0 (Chicago, IL, USA). Student’s t-test was used to evaluate the statistical significance. A P-value < 0.05 or < 0.01 was set as the criterion for statistical significance.

Acknowledgements

Long-term results of intratumorous bleomycin-A5 injec- tion for head and neck lymphangioma. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 86, 139–144. 11 Dean M, Fojo T & Bates S (2005) Tumour stem cells and drug resistance. Nat Rev Cancer 5, 275–284. 12 Zembutsu H, Ohnishi Y, Tsunoda T, Furukawa Y, Katagiri T, Ueyama Y, Tamaoki N, Nomura T, Kitahara O, Yanagawa R et al. (2002) Genome-wide cDNA microarray screening to correlate gene expres- sion profiles with sensitivity of human cancer xenografts to anticancer drugs. Cancer Res 62, 518–527. 13 Pastorekova S, Zatovicova M & Pastorek J (2008) Cancer associated carbonic anhydrases and their inhibition. Curr Pharm Des 14, 685–698.

This study was supported by grants from the National Natural Science Foundation of China (30873088) and the Doctoral Fund of the Ministry of Education of China (200805330009).

14 Murakami Y, Kanda K, Tsuji M, Kanayama H & Kagawa S (1999) MN ⁄ CA9 gene expression as a potential biomarker in renal cell carcinoma. BJU Int 83, 743–747.

15 Wykoff CC, Beasley NJ, Watson PH, Turner KJ,

References

1 Landis SH, Murray T, Bolden S & Wingo PA

(1999) Cancer statistics 1999. CA Cancer J Clin 49, 8–31.

Pastorek J, Sibtain A, Wilson GD, Turley H, Talks KL, Maxwell PH et al. (2000) Hypoxia-inducible expression of tumor-associated carbonic anhydrases. Cancer Res 60, 7075–7083.

16 Robertson N, Potter C & Harris AL (2004) Role of carbonic anhydrase IX in human tumor cell growth, survival, and invasion. Cancer Res 64, 6160–6165.

2 Chin D, Boyle GM, Porceddu S, Theile DR, Parsons PG & Coman WB (2006) Head and neck cancer: past, present and future. Exp Rev Anticancer Ther 6, 111–118.

17 Koukourakis MI, Giatromanolaki A, Sivridis E,

3 Moore SR, Johnson NW, Pierce AM & Wilson DF

(2000) The epidemiology of tongue carcinoma: a review of global incidence. Oral Dis 6, 75–84.

Simopoulos K, Pastorek J, Wykoff CC, Gatter KC & Harris AL (2001) Hypoxia-regulated carbonic anhydrase-9 (CA9) relates to poor vascularization and resistance of squamous cell head and neck cancer to chemoradiotherapy. Clin Cancer Res 7, 3399–3403. 18 Pouyssegur J, Dayan F & Mazure NM (2006) Hypoxia signaling in cancer and approaches to enforce tumour regression. Nature 441, 437–443.

4 Pignon JP, Bourhis J, Domenge C & Designe´ L (2000) Chemotherapy added to locoregional treatment for head and neck squamous-cell carcinoma: three meta- analyses of updated individual data. MACH-NC Collaborative Group. Mete-Analysis of Chemotherapy on Head and Neck Cancer. Lancet 355, 949–955.

19 Brahimi-Horn MC, Chiche J & Pouyssegur J (2007) Hypoxia signalling controls metabolic demand. Curr Opin Cell Biol 19, 223–229.

20 Roos A & Boron WF (1981) Intracelluar pH. Physiol

5 Chen XQ, Jian XC & Guo F (2002) Retrospective study on the patients with tongue squamous cell carcinoma to pinyangmycin preoperative chemotherapy. Lin Chuang Kou Qiang Yi Xue Za Zhi 18, 126–127.

Rev 61, 296–434.

21 Pouyssegur J, Sardet C, Franchi A, L’Allemain G &

Paris S (1984) A specific mutation abolishing Na+ ⁄ H+ antiport activity in hamster fibroblasts

6 Zhang Y (2003) Therapeutic efficacy of adjuvant piny- angmycin for preoperative chemotherapy in treatment of 77 patients with tongue cancer. Tian Jin Yi Ke Da Xue Xue Bao 9, 511–513.

FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS

4517

33 Jin Y, Tipoe GL, Liong EC, Lau TY, Fung PC &

precludes growth at neutral and acidic pH. Proc Natl Acad Sci USA 81, 4833–4837.

Leung KM (2001) Overexpression of BMP-2 ⁄ 4, -5 and BMPR-IA associated with malignancy of oral epithe- lium. Oral Oncol 37, 225–233.

34 Langenfeld EM, Calvano SE, Abou-Nukta F, Lowry

22 Chambard JC & Pouyssegur J (1986) Intracellular pH controls growth factor-induced ribosomal protein S6 phosphorylation and protein synthesis in the G0–G1 transition of fibroblasts. Exp Cell Res 164, 282–294.

23 Chiche J, Ilc K, Laferrie` re J, Trottier E, Dayan F,

SF, Amenta P & Langenfeld J (2003) The mature bone morphogenetic protein-2 is aberrantly expressed in non- small cell lung carcinomas and stimulates tumor growth of A549 cells. Carcinogenesis 24, 1445–1454.

Mazure NM, Brahimi-Horn MC & Pouysse´ gur J (2009) Hypoxia-inducible carbonic anhydrase IX and XII pro- mote tumor cell growth by counteracting acidosis through the regulation of the intracellular pH. Cancer Res 69, 358–368.

35 Langenfeld EM & Langenfeld J (2004) Bone morphoge- netic protein-2 stimulates angiogenesis in developing tumors. Mol Cancer Res 2, 141–149.

36 Reya T & Clevers H (2005) Wnt signalling in stem cells

and cancer. Nature 434, 843–850.

24 Matsuyama S, Llopis J, Deveraux QL, Tsien RY & Reed JC (2000) Changes in intramitochondrial and cytosolic pH: early events that modulate caspase activa- tion during apoptosis. Nat Cell Biol 2, 318–325.

37 Bafico A, Liu G, Yaniv A, Gazit A & Aaronson SA (2001) Novel mechanism of Wnt signalling inhibition mediated by Dickkopf-1 interaction with LRP6 ⁄ Arrow. Nat Cell Biol 3, 683–686.

38 Mao B, Wu W, Davidson G, Marhold J, Li M,

25 Nagel WW & Vallee BL (1995) Cell cycle regulation of metallothionein in human colonic cancer cells. Proc Natl Acad Sci USA 92, 579–583.

26 Jayasurya A, Bay BH, Yap WM & Tan NG (2000) Correlation of metallothionein expression with apoptosis in nasopharyngeal carcinoma. Br J Cancer 82, 1198–1203.

Mechler BM, Delius H, Hoppe D, Stannek P, Walter C et al. (2002) Kremen proteins are Dickkopf receptors that regulate Wnt ⁄ b-catenin signaling. Nature 417, 664–667.

27 Theocharis SE, Margeli AP & Koutselinis A (2003)

Metallothionein: a multifunctional protein from toxicity to cancer. Int J Biol Markers 18, 162–169.

28 Miyazaki H, Naitoh Y, Nakahashi Y, Yanagitani S,

39 Lee AY, He B, You L, Xu Z, Mazieres J, Reguart N, Mikami I, Batra S & Jablons DM (2004) Dickkopf-1 antagonizes Wnt signalling independent of b-catenin in human mesothelioma. Biochem Biophys Res Commun 323, 1246–1250.

40 Mikheev AM, Mikheeva SA, Liu B, Cohen P & Zarbl

Kuno K, Ueno Y, Okajima A & Inoue K (1998) Induc- tion of metallothionein isoforms in rat hepatoma cells by various anticancer drugs. J Biochem 124, 65–71. 29 Kelley SL, Basu A, Teicher BA, Hacker MP, Hamer

H (2004) Functional genomics approach for the identifi- cation of putative tumor suppressor genes: Dickkopf-1 as suppressor of HeLa cell transformation. Carcinogene- sis 25, 47–59.

DH & Lazo JS (1998) Over expression of metallothion- ein confers resistance to anticancer drugs. Science 241, 1813–1815.

41 Aguilera O, Fraga MF, Ballestar E, Paz MF, Herranz M, Espada J, Garcı´ a JM, Mun˜ oz A, Esteller M & Gonza´ lez-Sancho JM (2006) Epigenetic inactivation of the Wnt antagonist DICKKOPF-1 gene in human colorectal cancer. Oncogene 25, 4116–4121.

42 Vibhakar R, Foltz G, Yoon JG, Field L, Lee H, Ryu

GY, Pierson J, Davidson B & Madan A (2007) Dickkopf-1 is an epigenetically silenced candidate tumor suppressor gene in medulloblastoma. Neurooncology 9, 135–144.

30 Wang GW, Klein JB & Kang YJ (2001) Metallothion- ein inhibits doxorubicin-induced mitochondrial cyto- chrome c release and caspase-3 activation in cardiomyocytes. J Pharmacol Exp Ther 298, 461–468. 31 Chun JH, Kim HK, Kim E, Kim IH, Kim JH, Chang HJ, Choi IJ, Lim HS, Kim IJ, Kang HC et al. (2004) Increased expression of metallothionein is associated with irinotecan resistance in gastric cancer. Cancer Res 64, 4703–4706.

32 Yang F, Zhou M, He Z, Liu X, Sun L, Sun Y & Chen

43 Livak KJ & Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) method. Methods 25, 402–408.

Z (2007) High-yield expression in Escherichia coli of sol- uble human MT2A with native functions. Protein Expr Purif 53, 186–194.

FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS

4518

G. Zheng et al. Role of CA9 in PYM resistance